The document describes how targeted resequencing microarray technology can be used to simultaneously detect and identify multiple respiratory pathogens from a single sample in 3 sentences or less:
Targeted resequencing microarray (RPM) technology uses thousands of DNA probes to interrogate sequences from respiratory pathogens and can detect genetic variants to identify known pathogens and potentially novel pathogens from a single sample, representing an improvement over traditional techniques that can only detect one pathogen at a time.
Call Girls Raipur Just Call 9630942363 Top Class Call Girl Service Available
Using Targeted Resequencing Microarrays for Simultaneous Definitive Detection and Identification of Multiple Respiratory Pathogens.
1. TessArae, LLC, Proprietary Information
Using Targeted Resequencing Microarrays for
Simultaneous Definitive Detection and Identification of
Multiple Respiratory Pathogens.
Agnieszka M. Lichanska, Clark Tibbetts, and
Matthew C. Lorence
TessArae, LLC, Potomac Falls, Virginia, USA
2. TessArae, LLC, Proprietary Information
Overview
Re-sequencing technology vs. traditional diagnostic
techniques
How does re-sequencing work?
How are the techniques different?
Identification of new pathogens - an example: novel
H1N1 flu
Additional examples of use of RPM-Flu 3.1 assay
Summary
3. TessArae, LLC, Proprietary Information
Shift in Microbial Diagnostics
TessArray™ !
TessArae Inc.
TessArray RPM-Flu v3.1
Respiratory Pathogen
Panel
P/N: 520-191
Phenotypic detection
and identification
Genotypic detection
and identification
Mainly single result per test Multiple results per one test
Multiple signatures per pathogen
Detection and confirmation
4. TessArae, LLC, Proprietary Information
RPM Strategy
GTATGGTAGTTGGGATAATTAGCTTGATGT
CATACCATCAACCCTATTAATCGAACTACA
GTATGGTAGTTGAGATAATTAGCTT
GTATGGTAGTTGCGATAATTAGCTT
GTATGGTAGTTGGGATAATTAGCTT
GTATGGTAGTTGTGATAATTAGCTT
CATACCATCAACACTATTAATCGAA
CATACCATCAACCCTATTAATCGAA
CATACCATCAACGCTATTAATCGAA
CATACCATCAACTCTATTAATCGAA
Probes to interrogate
center position of first
complementary target
strand
Probes to interrogate
center position of second
complementary target
strand
Target
25-base window of 8 transducers
Hemagglutinin A/Goose/Guangdong/1/96/H5N1
7. TessArae, LLC, Proprietary Information
TessArray®
RPM-Flu 3.1
TessArray™ !
TessArae, LLC
TessArray RPM-Flu v3.1
Respiratory Pathogen Panel
P/N: 520-191
Coronavirus (229E)
Coronavirus (OC43)
Coronavirus (NL63)
Coronavirus (SARS Urbani)
Cytomegalovirus (HHV-5)
Enteroviruses:
• Coxsackievirus (5 types)
• Echovirus (8 types)
• Rhinovirus (27 types)
Measles Virus
Metapneumovirus (types A, B)
Parainfluenza 1
Parainfluenza 2
Parainfluenza 3
Parainfluenza 4a
Parainfluenza 4b
RSV A
RSV B
Rubella Virus
Bordatella pertussis
Corynebacterium diphtheriae
Chlamydia psittaci
Chlamydia trachomatis
Chlamydophila pneumoniae
Haemophilus influenzae
Klebsiella pneumoniae
Legionella pneumophila
Moraxella catarrhalis
Mycobacterium kansasii
Mycobacterium tuberculosis
Mycoplasma pneumoniae
Neisseria meningitidis
Pseudomonas aeruginosa
Staphylococcus aureus
Streptococcus agalactiae
Streptococcus pneumoniae
Streptococcus pyogenes
Variola major
Bacillus anthracis
Francisella tularensis
Yersinia pestis
Influenza A HA1
Influenza A HA2
Influenza A HA3
Influenza A HA4
Influenza A HA5
Influenza A HA6
Influenza A HA7
Influenza A HA8
Influenza A HA9
Influenza A HA10
Influenza A HA11
Influenza A HA12
Influenza A HA13
Influenza A HA14
Influenza A HA15
Influenza A HA16
Influenza A NA1
Influenza A NA2
Influenza A NA3
Influenza A NA4
Influenza A NA5
Influenza A NA6
Influenza A NA7
Influenza A NA8
Influenza A NA9
Influenza A Mtx
Influenza A NS
Influenza A PB2
Influenza B HA1
Influenza B HA2
Influenza B NA1
Influenza B Mtx
Adenovirus B
Adenovirus C
Adenovirus D
Adenovirus E
Simultaneous differential diagnosis
of influenza-like illness
30 different types of viral and
bacterial respiratory pathogens
938,032 oligonucleotide probes
117,254 nucleotides of targeted
pathogen gene sequences per assay
8. TessArae, LLC, Proprietary Information
How the RPM Assay Works?
Control Template Live Influenza Vaccine (FluMist® 2004-2005)
Trivalent mixture of different influenza virus A/HN and B subtypes
A/Canterbury/20/1999 (H1N1)
A/Wyoming/3/2003 (H3N2)
B/Jilin/20/2003
Hemagglutinin and Neuraminidase Genes from these Vaccine Strains
Engineered by Reassortment with Cold-Adapted Master Strains
A/Ann Arbor/6/1960 (H2N2)
B/Ann Arbor/1/1966
Matrix and Other Viral Genes from Master Strains
9. TessArae, LLC, Proprietary Information
Chip
Background
Segment
Tile AGT C
C
AG
T
Translation Key:
TGGAAAATGAAAGGACTTTGGATTTCCATGACTCCAATGTGAAGA!
Influenza A Virus segment 4 hemagglutinin (HA1)
15. TessArae, LLC, Proprietary Information
Detecting Seasonal Strains of Influenza
RPM-Detector Tiles for Seasonal A/H1N1 and Seasonal A/H3N2 Influenza Viruse s
Vir u s Target Gen e Detector Tile Sequence/Strai n Leng t h Prob e s
A/H1 N 1 Hemagglutinin(A/HA1 ) A/New Caledonia/20/1999(H1N1) 1500 bp 12,000
A/H1 N 1 Neuraminidase(A/NA1) A/New Caledonia/20/1999(H1N1) 1200 bp 9,600
A/H1 N 1 Matrix(A/H1N1-M ) A/Canterbury/100/2000(H1N1) 850 bp 6,800
A/H3 N 2 Hemagglutinin(A/HA3 ) A/Canterbury /125/2005(H3N2) 1500 bp 12,000
A/H3 N 2 Neuraminidase(A/NA2) A/Canterbury /125/2005(H3N2) 1200 bp 9,600
A/H3 N 2 Matrix(A/H3N2-M ) A/Canterbury /125/2005(H3N2) 850 bp 6,800
16. TessArae, LLC, Proprietary Information
A Sentinel Case
April 2009:
Patient presents at Washington, DC hospital
Recently returned from vacation in Mexico
Convalescing from recent flu-like illness
Anxious about reports of novel influenza outbreak
TessArray Outcomes:
01 May 2009 - Best Matches
L20309, X90504 H influenzae outer membrane protein P5
A/duck/Guanxi/2004(H5N1); A/chicken/Yogjakarta/2004(H5N1)
Very unusual result suggested patient had been infected by an avian influenza virus
Database updated following week, new sequence records from Mexico outbreak isolates
05 May 2009 - Best Matches
L20309, X90504 H influenzae outer membrane protein P5
A/California/07/2009(H1N1); A/Texas/04/2009(H1N1)
Perfect Match to New CDC Strain!
From a Test Designed in 2006 With No Prior Knowledge of New Strain
17. TessArae, LLC, Proprietary Information
T S R A - A ML_CNMC_01_050109 (“RPM-Flu Sentinel Case”)
Best Matches from VSRD Archive
Updated November 2008
Best Matches from VSRD Archive
Updated May 2009
A/chicken/Indonesia/7/2003(H5N1)
A/chicken/Puebla/231-5284/98(H5N2) A/chicken/Puebla/231-5284/98 (H5N2)
A/chicken/Yogjakarta/BBVet-IX/2004(H5N1)
A/duck/Guangxi/1436/2006(H5N1)
A/duck/Guangxi/351/2004(H5N1)
A/duck/Guangxi/3548/2005(H5N1)
A/duck/Guangxi/380/2004(H5N1)
A/duck/Guangxi/4016/2005(H5N1)
A/hooded vulture/Burkina Faso/2/2006(H5N1)
A/mallard/Alberta/111/99(H4N6) A/mallard/Alberta/111/99(H4N6)
A/mallard/Maryland/1235/2006(H3N6) A/mallard/Maryland/1235/2006(H3N6)
A/quail/Tasikmalaya/BPPV4/2004(H5N1)
A/swine/Hong Kong/1197/02(H3N2) A/swine/Hong Kong/1197/02(H3N2)
A/swine/Iowa/930/01(H1N2)
A/swine/Virginia/670/1987(H1N1)
A/swine/Virginia/671/1987(H1N1)
A/swine/British Columbia/28103/2005(H3N2)
A/California/04/2009(H1N1)
A/California/05/2009(H1N1)
A/California/06/2009(H1N1)
A/California/07/2009(H1N1)
A/California/08/2009(H1N1)
A/California/09/2009(H1N1)
A/California/10/2009(H1N1)
A/California/14/2009(H1N1)
A/Canada-ON/RV1527/2009(H1N1)
A/New York/06/2009(H1N1)
A/New York/10/2009(H1N1)
A/New York/11/2009(H1N1)
A/New York/15/2009(H1N1)
A/New York/18/2009(H1N1)
A/New York/19/2009(H1N1)
A/New York/20/2009(H1N1)
A/New York/22/2009(H1N1)
A/Ohio/07/2009(H1N1)
A/Texas/04/2009(H1N1)
A/Texas/05/2009(H1N1)
RPM detection and identification works for
strains and variants
that share at least 80% sequence similarity to
array detector tiles
The RPM-Flu 3.1 designed for A/H5N1 in 2006 is capable to sensitively detect and differentiate
the Novel A/H1N1 SOIV from Seasonal A/H1N1 and Seasonal A/H3N2 subtypes without modification
190/215 = 88%
18. TessArae, LLC, Proprietary Information
Avian A/H5N1 matrix
gene resequencing
detector tile sequence
(top sequence)
2009 Novel H1N1 (A/
Pensacola/INS107/2009
(H1N1)) strain (middle
sequence)
Sequence from a high titer
stock of a 2009 Novel H1N1
outbreak strain strain, A/
NHRC-California/BRD_40116
(H1N1) (bottom sequence)
Legend:
x = Mismatch
| = Match
21. TessArae, LLC, Proprietary Information
Detecting Emergent Strains
A/New Caledonia/20/1999(H1N1) Hemagglutinin
A/New Caledonia/20/1999(H1N1) Neuraminidase
A/Canterbury/100/2000(H1N1) Matrix
A/Canterbury/125/2005 (H3N2) Hemagglutinin
A/Canterbury/125/2005 (H3N2) Neuraminidase
A/Canterbury/125/2005 (H3N2) Matrix
2004-5 FluMist
A/New Caledonia/20/1999(H1N1)
A/New Caledonia/20/1999(H1N1)
A/Ann Arbor/6/1960(H2N2)
A/Wyoming/03/2003 (H3N2)
A/Wyoming/03/2003 (H3N2)
A/Ann Arbor/6/1960(H2N2)
2009-10 FluMist
A/South Dakota/6/2007(H1N1)
A/South Dakota/6/2007(H1N1)
A/Ann Arbor/6/1960(H2N2)
A/Uruguay/716/2007 (H3N2)
A/Uruguay/716/2007 (H3N2)
A/Ann Arbor/6/1960(H2N2)
What s on the Device:
What it Told Us:
TessArray™ !
TessArae, LLC
TessArray RPM-Flu v3.1
Respiratory Pathogen Panel
P/N: 520-191
2006-7 FluZone
A/New Caledonia/20/1999(H1N1)
A/New Caledonia/20/1999(H1N1)
A/Puerto Rico/8/1934(H1N1)
A/Wisconsin/67/2005 (H3N2)
A/Wisconsin/67/2005 (H3N2)
A/Puerto Rico/8/1934(H1N1)
2009-10 FluVirin
A/South Dakota/6/2007(H1N1)
A/South Dakota/6/2007(H1N1)
A/Puerto Rico/8/1934(H1N1)
A/Uruguay/716/2007 (H3N2)
A/Uruguay/716/2007 (H3N2)
A/Puerto Rico/8/1934(H1N1)
When Confronted With Different
Strains the Array Still Tells Us
What Is Present Based on the
Sequences of the Organisms
22. TessArae, LLC, Proprietary Information
Match SEPRL Reference Strain
H1N1 A/Turkey/Kansas/4880/80
H2N8 A/Herring Gull/DE/677/88
H3N2 A/turkey/MN/366767/2005
H4N6 A/Blue Winged Teal/LA/240B/88
H7N2 A/quail/PA/20304/98
H8N4 A/turkey/CO/169118-13/02
H10N7 A/quail/NJ/25254-22/95
H11N3 A/chicken/NJ/4645/96
H12N5 A/duck/LA/188D/87
H13N6 A/gull/MD/1824/78
AMPV, No AI Avian Metapneumovirus (Colorado Strain)
H5N3 A/duck/Singapore/F119/97
H7N3 A/chicken/Chile(F0)/176822/02
No AI Avian Paramyxovirus I (NDV, RPM-TEI assay)
H5N2 A/chicken/Mex/26654-1374/94
H7N1 A/turkey/Italy/4580/99
H7N3 A/chicken/Pakistan/1369-CR2/95
H7N7 A/chicken/Victoria/85
H14N5 A/mallard/Gurjev/263/82
H15N9 A/Shearwater/W. Australia/2576/79
Sample RPM Assay
1 H1N1
2 H2N8
3 H3N2
4 H4N6
6 H7N2
7 H8N4
9 H10N7
10 H11N3
11 H12N5
12 H13N6
13 AMPV, No AI
14 H5N3
15 H7N3
16 No AI
17 H5N2
18 H7N1
19 H7N3
20 H7N7
21 H14N5
22 H15N9
Specimens from USDA ARS SEPRL reference archive (20 Mar 08)
Avian Influenza Subtypes: Differential Diagnostics
23. TessArae, LLC, Proprietary Information
Reconciliation of Inter-Platform Results Discrepancies by
de novo DNA Sequencing of Viral Genes from Original Specimens
Sample ID
CDC-Certified
H5 (Asian) PCR
Ibis-T5000
ESI-MS
HA RSLT (P1)
Serology
TessArray®
RPM-Flu v3.1
Gold Standard
DNA Sequencing
2006900845 H5 H5N1 H5 H5N1 not tested
2006906089 H5 H5N1 H5 H5N1 not tested
2006900590 H5 H5N1 H5 H5N1 not tested
2006902838 H5 H5N1 H5 H5N1 not tested
2006902764 not tested H5N1 H5 H5N1 H5N1
2006905588 Flu UNKNOWN H7 H7N7 H7N7
2004909864 not tested H9N2 UNKNOWN H7N7 H7
2005912823 Flu H7N7 UNKNOWN H10N7 H10N7
2005912908 not tested H7N7 H10 H10N7 H10N7
2004900600 Flu H7N7 H10 H10N7 H10N7
2004900845 H5 H5N1 H10 H10N7 or H10N5 H10N7
2004900688 not tested H7N7 H11 H11N? H11
2005912306 Flu NEW UNKNOWN H13N6 or H13N8 H13
= Conflict with de novo sequencing results
Avian Influenza Subtypes: Differential Diagnostics
= Results concordant with de novo sequencing
Lin et al PLOS 2009
24. TessArae, LLC, Proprietary Information
Longitudinal Data Analysis
CT_Sick_050509 Rhinovirus
CT_Sick_042010 Parainfluenza Virus
CT_Healthy_Control_080508
CT_Sick_Day4_080603 Metapneumovirus
But not the novel A/H1N1!
25. TessArae, LLC, Proprietary Information
MLST-like Epidemiological Analysis:
Genomic diversity of Haemophilus influenzae from
50 Different Patients at MCRD San Diego
26. TessArae, LLC, Proprietary Information
MLST-Like Epidemiological Analysis:
Clonal genomic uniformity of Adenovirus Type 4
in Same 50 Patients at MCRD San Diego
27. TessArae, LLC, Proprietary Information
Summary
Real-time Epidemic/Pandemic Surveillance in Human and Animal
Populations
Simultaneous Detection and Definitive Identification of Multiple Pathogens
Characterization of Difficult Cases
Superior to Benchmark Platform Sensitivity and Specificity
Limits of Detection ~ 102 Genome Equivalents/specimen
Zero False Positive Detection Events
Immediate Identification of Known and Unknown Strains and Variants
Surveillance of Shift and Drift in Populations
Same Day Results
RPM Sequence-based Detector Array
Six Sigma Data Quality
Basecall Error Rate ≥ 10-6
28. TessArae, LLC, Proprietary Information
Acknowledgements
Naval Health Research Center/Naval Respiratory Disease
Laboratory, San Diego, CA
David Metzgar Chris Myers Christian Hansen
CDR Kevin Russell Jason Brown Larivhie Dela Cruz
CDR Dennis Faix Miguel Osuna David Ortiz
TessArae, LLC - Potomac Falls, VA
Clark Tibbetts Brian Weslowski Leah Morris
Matthew Lorence Lisa Borsuk Klaus Schafer
Naval Research Laboratory/Center for Bio/Molecular Science and
Engineering - Washington, DC
Joel Schnur Anthony Malanoski Nina Long
David Stenger Baochuan Lin Carolyn Kidd
Zheng Wang Dzung Thach Kate Blaney