SlideShare una empresa de Scribd logo
1 de 4
Descargar para leer sin conexión
E N V I R O N M E N TA L M O N I T O R I N G




                        BY J.S. SIDHU, C.T. TYLER, G. MA, AND M. SAMADPOUR, MOLECULAR EPIDEMIOLOGY, INC.,
                                               AND E.J. BRANDRETH, ALTHEA TECHNOLOGIES




IN BIOPHARMACEUTICAL manufacturing, an ac-                        manufacturers to take more rational and manageable
curate and comprehensive knowledge of the entire process          approaches to environmental montioring.
flow is a critical part of a thorough cGMP microbial                We recommend a polyphasic approach, one that
control program. The goal is to have precise data highlight-      makes use of key characteristics or properties of a
ing where incursion points may exist, and control those           particular unknown organism in tandem with its
points to limit or prevent migration into the process flow.       genetic information. Such an approach provides a more
Historically, the identification of cleanroom environmental       definitive taxonomic identification; it also avoids the
monitoring (EM) isolates has been limited to the genus or
group level for most organisms, with some ability to pro-          Genetic ID
vide species level identification only if absolutely required.     Comparisons to genetically similar microorganisms
   Recently, rapid technologies have become
                                                                   Genetic Distance        Genus                   Species
available, especially DNA-sequencing based systems,
to more quickly identify microorganisms. These                     0.000                   Shigella                sonnei
techniques can help manufacturers to understand and                0.000                   Shigella                flexneri
investigate potential physical and temporal sources                0.000                   Escherichia             coli
of contamination. However, while such genetic-based
                                                                   0.000                   Shigella                boydii
systems may be rapid, they are still inherently limited
by their inability to discriminate between species and             0.000                   Escherichia             sp.
some genera in some critical categories. Additionally,             0.007                   Enterobacter            hormaechei
an identification match is only possible if the organism           0.0019                  Shigella                dysenteriae
and its reference are adequately differentiated and in
                                                                   0.0022                  Enterobacter            sp.
the manufacturers’ database. Thus, with this increase
in technology comes the likelihood of identifying                  0.0031                  Cronobacter             sakazakii
a far greater number of potentially “objectionable”                0.0081                  Citrobacter             freundii
environmental organisms (e.g., coliforms, pathogens)
                                                                   0.0090                  Enterobacter            dissolvens
than ever before, as well as challenges in knowing what to
do with the additional data.                                       0.0100                  Kiebsiella              oxytoca
   It’s important, therefore, that new tools and the data          Microbial ID            Family: Enterobacteriaceae
they produce not take precedence over the practical                Conclusion
application of good microbiological practices. If                 Figure 1. Genetic-based identification reported the unknown isolate as
anything, these technologies increase the necessity for           “Family: Enterobacteriaceae.”
E N V I R O N M E N TA L M O N I T O R I N G




                                                                                                         Since the polyphasic
                                                                                                      determination presented the EM
                                                                                                      isolate as belonging to the same
                                                                                                      genus and species as the MCB and
                                                                                                      was a potentially objectionable
                                                                                                      organism (coliform), further analysis
                                                                                                      of its potential for pathogenicity
                                                                                                      was required. The process included
                                                                                                      targeted PCR analysis of toxins as
                                                                                                      well as attachment factors associated
                                                                                                      with recognized pathogenic forms,
                                                                                                      such as Enterotoxigenic E. coli
                                                                                                      (ETEC), Shiga-toxin producing E.
                                                                                                      coli (STEC), Enterohemorrhagic E.
                                                                                                      coli (EHEC), and Enteropathogenic
                                                                                                      E. coli (EPEC), or closely related
                                                                                                      species such as Shigella spp.
Figure 2. Polyphasic Microbial Identification (PMID) identified the isolate as Escherichia coli.           The following organisms were used
                                                                                                      for Quality Control purposes in the
Identities = 416/418 (99%), Gaps = 1/418 (0%)                                                         various analytical tests performed:
                                                                                                      E. coli ATCC 8739, Shigella sonnei
E. coli O157 23
                                                                                                      ATCC 25931, Klebsiella pneumoniae
                       ACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACAC          82
                       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
E. coli K-12 213094    ACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACAC          213035
                                                                                                      ATCC 10031, and Klebsiella oxytoca
E. coli O157 83        GCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGT          142
E. coli K-12 213034
                       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
                       GCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGT          212975
                                                                                                      ATCC 43863. These were obtained
E. coli O157 143       AGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGG          202
                                                                                                      as lyophilized cultures, reconstituted
E. coli K-12 212974
                       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
                       AGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGG          212915   and sub-cultured as recommended
E. coli O157 203       ATCGTCGCCTAGGTGAGCCGTTACCCCACCTACTAGCTAATCCCATCTGGGCACATCCGA          262      for isolated colonies. The study
                       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
E. coli K-12 212914    ATCGTCGCCTAGGTGAGCCGTTACCCCACCTACTAGCTAATCCCATCTGGGCACATCCGA          212855   was further supplemented with
E. coli O157 263       TGGCAAGAGGCCCGAAGGTCCCCCTCTTTGGTCTTGCGACGTTATGCGGTATTAGCTACC
                       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
                                                                                             322      ATCC-derived strains, Enterobacter
E. coli K-12 212854    TGGCAAGAGGCCCGAAGGTCCCCCTCTTTGGTCTTGCGACGTTATGCGGTATTAGCTACC          212795   cloacae ATCC 23355, Pseudomonas
E. coli O157 323       GTTTCCAGTAGTTATCCCNNCTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGC
                       |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
                                                                                             382
                                                                                                      aeruginosa ATCC 9027, E. coli ATCC
E. coli K-12 212794    GTTTCCAGTAGTTATCCCC-CTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGC          212736
                                                                                                      25922 and E. coli O157:H7 ATCC
E. coli O157 383       CACTCGTCAGCAAAGAAGCAAGCTTCTTCCTGTTACCGTTCGACTTGCATGTGTTAGG            440
                       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                     35150, from MEI’s QC collection as
E. coli K-12 212735    CACTCGTCAGCAAAGAAGCAAGCTTCTTCCTGTTACCGTTCGACTTGCATGTGTTAGG            212678
                                                                                                      well as two additional E. coli strains
Figure 3. Alignment comparison of partial 16S rRNA genetic sequence from platform strain E. coli      from lab and environmental sources.
K-12 with genetic sequence from pathogenic strain E. coli O157:H7. Note that >99 percent homol-          Additionally, Althea submitted
ogy at this sequence length is considered as indistinguishable.                                       an isolate of the Master Cell Bank
                                                                                                      platform strain used in processing.
pitfalls of potentially misidentifying               combining a genetic-based microbial              Representative cultures of each
organisms due to the limitations                     ID assay (16S rRNA sequencing) with              microorganism were subjected to
of various commercial phenotypic                     a broad spectrum for phenotypic and              16S rRNA sequencing, colonial,
and genotypic microbial ID systems                   biochemical analyses, to accurately              morphological, biochemical (Vitek
and their databases. This article                    identify a potentially objectionable             GNI, bioMérieux) observations and
will detail such an approach taken                   environmental organism submitted                 DNA fingerprinting using pulsed
recently during work at facilities of                by Althea. The organism of con-                  field gel electrophoresis (PFGE
Althea Technologies in San Diego.                    cern was recovered during routine                analysis—with restriction enzymes
                                                     environmental monitoring, while                  XbaI, AvrII and SpeI). Analysis of
AN ORGANISM OF CONCERN                               aliquoting in a tissue culture hood.             toxigenic and pathogenic potential
In the current study, Molecular                      The procedure involved a biofermen-              was conducted using a proprietary
Epidemiology Inc. (MEI) used a                       tation Master Cell Bank (MCB), with              polymerase chain reaction (PCR)
polyphasic identification approach,                  Escherichia coli as the platform.                method (MEI, 2010) to determine the



44   MAY 2012
E N V I R O N M E N TA L M O N I T O R I N G




Figure 4. PCR results for various targeted
marker genes: upper image shows recovery
of genomic DNA (lane 8, negative, is buffer
control); middle image shows GAPDH target
specific to members of Enterobacteriaceae
(note lane 5, negative, is Pseudomonas aeru-
ginosa); lower image shows recovery of target
toxin and attachment genes in control strain E.
coli O157:H7 (lane 7); lane 2 is study strain.


presence or absence of toxin markers
and pathogenicity factors in the
reference and subject strains.

CONFIRMING IDENTIFICATION
An initial isolate recovered from a
cleanroom sanitary fill operation
(aliquoting of MCB) was received for
identification by 16S rRNA genetic                  Figures 5a, 5b, 5c. A comparison of genetic sub-typing patterns of entire genomes by pulsed field
sequencing. The isolate was reported                gel electrophoresis showing distinctly different patterns between EM isolate (Althea Tech.) and
as a member of the Family Entero-                   other E. coli, pathogenic forms of E. coli and other selected pathogens and non-pathogens in Fam-
bacteriaceae (Figure 1)—consistent                  ily Enterobacteriaceae. Note the indistinguishable patterns of EM isolate and Platform E. coli under
with the industry and federally                     conditions of three different restriction enzymatic digests: XbaI, AvrII, and SpeI.
recognized guidelines (CLSI, 2008)
for genetic sequencing techniques                 culture of E. coli O157:H7 ATCC                     (PCR) analyses for specifically
for identification. Further taxonomic             35150. Furthermore, sequence                        targeted toxigenic and pathogenic
classification was required, and the              alignment data (Figure 3) indicate                  markers demonstrated the absence
application of a polyphasic micro-                the indistinguishable similarity                    of these markers in the submitted
biological ID (PMID) method clearly               in the 16S rRNA gene sequence                       organism (Figure 4, lane 2) when
differentiated and reported the                   associated with the pathogenic                      compared to the control organisms
isolate as E. coli (Figure 2).                    species. Therefore, reliance on                     (Figure 4, lane 7).
   Further comparisons with related               genetic-based ID or even a microbial                   Subsequent to the PMID of the EM
strains with pathogenic potential                 ID conclusion would not rule out the                isolate as E. coli, DNA Fingerprinting
differentiated and confirmed this                 possibility of a frank pathogen.                    comparison of the entire genome
identification (data not shown). Of                  To confirm that the EM isolate                   by PFGE analysis (employing three
concern was the equally identical                 had not acquired any pathogenic                     distinct restriction enzyme digests)
taxonomic ID presented by the QC                  potential, polymerase chain reaction                demonstrated the differences in
E N V I R O N M E N TA L M O N I T O R I N G




                                                         Coliform in
                                                       Classified Area
                                                                                                                               the facility is verified to be operating
                                                                                                                               with suitable environmental control
                                                  Microbial Identification
                                                                                                                               regarding the detection of coliforms.

               Polyphasic Microbial ID                                                     Genetic ID                          EM AND EXCURSION RESPONSE
                                                                                                                               A company should have an estab-
               Species Level ID: E. coli
                                                                                    Family Level Output:                       lished SOP which clearly identifies
                                                                                     Enterobacteriaceae
                                                                                                                               the actions to be taken, including
Strain Characterization              Toxigenicity and
                                                                                                                               clear directions if and when regula-
                                                                                   Species/Strains of Note
        by PFGE                 Pathogenicity analysis by PCR                                                                  tory notification (FDA, USDA, CDC,
                                                                                                                               etc.) would be required. In many cas-
Match to Platform Strain
                                    No toxin or pathogen
                                                                        Shigella sonnei
                                                                                                  E. coli O157:H7 (and other   es, the detection of an enteric organ-
                                     markers detected                                               pathogenic serotypes)
                                                                                                                               ism or a frank pathogen may include
                          No Risk                                                         Undefined Risk
                                                                                                                               the determination of non-pathoge-
                                                                                                                               nicity, or absence of virulence factors
                                                                                                                               and potential for toxigenicity, which
   Figure 6. MEI’s proprietary Polyphasic System Approach
                                                                                             CAPA
                                                                                                                               allows the manufacturer to better
   (PSA) towards the investigation of a potential “objection-                                                                  manage associated risk. The key is to
   able” organism.                                                                                                             understand the process and potential
                                                                                                                               incursion points, and to complement
   genetic profiles from other similarly                          demonstrated to be unequivocally                             them with Corrective Action/Preven-
   named control and environmental                                non-pathogenic and non-toxigenic                             tive Action, based on the potential
   strains (Figures 5a, 5b, 5c).                                  by PCR analysis of pathogenic and                            toxigenicity or pathogenicity of
      The isolate under investigation                             toxigenic potential. The entire pro-                         the organism. This, coupled with a
   is identified in the dendrograms                               cess using a thorough science-based                          science-based Risk Assessment, al-
   and its genomic pattern is clearly                             evaluation is illustrated in Figure 6.                       lows for a more rigorous evaluation
   distinguishable from the other                                    As such, this isolate was not                             of potential EM excursions.
   strains and yet indistinguishable                              an “objectionable” organism. The
   from the Master Cell Bank platform                             manipulation of the fermentation                             References
   strain. This, having already                                   strain—sampling, pipetting with                              1. Clinical Laboratory Standards Institute.
   demonstrated the strain’s lack of                              expected minute aspirations, etc.—                              Interpretive Criteria for Identification
   associated pathogenicity, confirms its                         can lead to isolated incidents of                               of Bacteria and Fungi by DNA Target
   clonal relationship with the MCB.                              detection of the bioprocess strain                              Sequencing: Approved Guideline. CLSI
                                                                  in any well-controlled facility.                                document MM18-A. Wayne, PA, 2008.
   BIOPROCESS STRAIN: A SCI-                                      The results presented here show                              2. Molecular Epidemiology, Inc. dba IEH
   ENCE-BASED EVALUATION                                          the benefits of polyphasic ID                                   Laboratories & Consulting Group. IEH
   In our study, the detection of an E.                           and the limitations of genetic or                               E. coli O157, Stx-producing E. coli, (STEC)
   coli recovered during environmen-                              phenotypic (rapid) microbial ID                                 with Intiman and Salmonella Test System.
   tal/production monitoring in the                               methods when used individually.                                 AOAC-RI PTM 100701, AOAC Research
   tissue culture hood was cause for                              Incorrect, incomplete or inadequate                             Institute, Gaithersburg, MD, USA, 2010.
   thorough and appropriate investiga-                            identification and characterization
   tion. Through the use of a detailed                            of strains of E. coli cannot exclude                         About the Authors
   polyphasic analysis approach, the                              potential pathogenic forms such as                           Jaspreet S. Sidhu, Ph.D. (VP, Business Devel-
   isolate was verified to be the same                            specific pathogenic serotypes (e.g.,                         opment and Pharmaceutical Microbiology),
   taxonomic genus and species as the                             O157; O104), Enterohemorrhagic                               Connor Tyler (Scientist), Greg Ma (Director
   bioprocess strain. Further testing via                         strains (EHEC) as well as E. coli                            of General Microbiology), and Mansour Sa-
   DNA fingerprinting by pulsed field                             subtypes STEC, ETEC, and EPEC,                               madpour, Ph.D. (President, CEO) represent
   gel electrophoresis demonstrated                               respectively. By detailed polyphasic                         Molecular Epidemiology, Inc. in Lake Forest
   that this was indeed the exact same                            analysis and demonstrating that any                          Park, Washington. E.J. Brandreth is VP of
   strain as used in the fermentation                             isolate of E. coli is linked directly to                     Quality and Regulatory Affairs for Althea
   process. In addition, the strain was                           the upstream production process,                             Technologies, San Diego.




   46   MAY 2012

Más contenido relacionado

La actualidad más candente

1a 1. science done
1a 1. science   done1a 1. science   done
1a 1. science donebiobuddy
 
Diagnostic microbiology.
Diagnostic microbiology.Diagnostic microbiology.
Diagnostic microbiology.DCROWN
 
(Tayo)semina presentation
(Tayo)semina presentation(Tayo)semina presentation
(Tayo)semina presentationIdowu Temitayo
 
Pace.indoor air2011
Pace.indoor air2011Pace.indoor air2011
Pace.indoor air2011nrpace
 
Towards better tools for fungal environmental metagenomics
Towards better tools for fungal environmental metagenomicsTowards better tools for fungal environmental metagenomics
Towards better tools for fungal environmental metagenomicsJason Stajich
 
Development of diagnostic kits
Development of diagnostic kitsDevelopment of diagnostic kits
Development of diagnostic kitsshiney chatak
 
Automated microbial identification system
Automated microbial identification systemAutomated microbial identification system
Automated microbial identification systemHanu Pratap
 
Bio 120 lecture 2 2011 2012
Bio 120 lecture 2 2011 2012Bio 120 lecture 2 2011 2012
Bio 120 lecture 2 2011 2012Marilen Parungao
 
Lab diagnosis of bacterial infections
Lab diagnosis of bacterial infectionsLab diagnosis of bacterial infections
Lab diagnosis of bacterial infectionsdrsadhana86
 
Automated system for bacterial identification
Automated system for bacterial identificationAutomated system for bacterial identification
Automated system for bacterial identificationDEEKSHANT KUMAR
 
The reliability of using vitek 2 compact system to detect
The reliability of using vitek 2 compact system to detectThe reliability of using vitek 2 compact system to detect
The reliability of using vitek 2 compact system to detectAlexander Decker
 
Evolution and exploration of the transcriptional landscape in two filamentous...
Evolution and exploration of the transcriptional landscape in two filamentous...Evolution and exploration of the transcriptional landscape in two filamentous...
Evolution and exploration of the transcriptional landscape in two filamentous...Jason Stajich
 
Connecting ultrastructure to molecules: Studying evolution of molecular comp...
Connecting ultrastructure to molecules: Studying evolution  of molecular comp...Connecting ultrastructure to molecules: Studying evolution  of molecular comp...
Connecting ultrastructure to molecules: Studying evolution of molecular comp...Jason Stajich
 

La actualidad más candente (19)

1a 1. science done
1a 1. science   done1a 1. science   done
1a 1. science done
 
Diagnostic microbiology.
Diagnostic microbiology.Diagnostic microbiology.
Diagnostic microbiology.
 
(Tayo)semina presentation
(Tayo)semina presentation(Tayo)semina presentation
(Tayo)semina presentation
 
Woudstra_2013_anaerobe
Woudstra_2013_anaerobeWoudstra_2013_anaerobe
Woudstra_2013_anaerobe
 
Pace.indoor air2011
Pace.indoor air2011Pace.indoor air2011
Pace.indoor air2011
 
Towards better tools for fungal environmental metagenomics
Towards better tools for fungal environmental metagenomicsTowards better tools for fungal environmental metagenomics
Towards better tools for fungal environmental metagenomics
 
Development of diagnostic kits
Development of diagnostic kitsDevelopment of diagnostic kits
Development of diagnostic kits
 
Viruses general characters diagnostic methods
Viruses general characters diagnostic methodsViruses general characters diagnostic methods
Viruses general characters diagnostic methods
 
Research Proposal
Research ProposalResearch Proposal
Research Proposal
 
Automated microbial identification system
Automated microbial identification systemAutomated microbial identification system
Automated microbial identification system
 
Bio 120 lecture 2 2011 2012
Bio 120 lecture 2 2011 2012Bio 120 lecture 2 2011 2012
Bio 120 lecture 2 2011 2012
 
Lab diagnosis of bacterial infections
Lab diagnosis of bacterial infectionsLab diagnosis of bacterial infections
Lab diagnosis of bacterial infections
 
Automated system for bacterial identification
Automated system for bacterial identificationAutomated system for bacterial identification
Automated system for bacterial identification
 
Mehlomakulu N N ethesis 20FEB15
Mehlomakulu N N ethesis 20FEB15Mehlomakulu N N ethesis 20FEB15
Mehlomakulu N N ethesis 20FEB15
 
Polymerase chain reaction
Polymerase chain reactionPolymerase chain reaction
Polymerase chain reaction
 
The reliability of using vitek 2 compact system to detect
The reliability of using vitek 2 compact system to detectThe reliability of using vitek 2 compact system to detect
The reliability of using vitek 2 compact system to detect
 
Evolution and exploration of the transcriptional landscape in two filamentous...
Evolution and exploration of the transcriptional landscape in two filamentous...Evolution and exploration of the transcriptional landscape in two filamentous...
Evolution and exploration of the transcriptional landscape in two filamentous...
 
Connecting ultrastructure to molecules: Studying evolution of molecular comp...
Connecting ultrastructure to molecules: Studying evolution  of molecular comp...Connecting ultrastructure to molecules: Studying evolution  of molecular comp...
Connecting ultrastructure to molecules: Studying evolution of molecular comp...
 
Detection of contaminants_in_human_cell_culture
Detection of contaminants_in_human_cell_cultureDetection of contaminants_in_human_cell_culture
Detection of contaminants_in_human_cell_culture
 

Destacado

ELF SLOs Adapting Program and Students’ Learning Outcomes January 2014
ELF SLOs Adapting Program and Students’ Learning Outcomes January 2014ELF SLOs Adapting Program and Students’ Learning Outcomes January 2014
ELF SLOs Adapting Program and Students’ Learning Outcomes January 2014Dr. Kate Mastruserio Reynolds
 
Trends in Biologics Outsourcing
Trends in Biologics OutsourcingTrends in Biologics Outsourcing
Trends in Biologics OutsourcingAjinomoto Althea
 
2015 2학기 KOSMOS 1주차 세미나
2015 2학기 KOSMOS 1주차 세미나2015 2학기 KOSMOS 1주차 세미나
2015 2학기 KOSMOS 1주차 세미나준혁 이
 
안내용 샘플 - B2B 영업 매뉴얼
안내용 샘플 -  B2B 영업 매뉴얼안내용 샘플 -  B2B 영업 매뉴얼
안내용 샘플 - B2B 영업 매뉴얼Jai Woo Shim
 
은상 기획서 폴라_20대를위한기획서
은상 기획서 폴라_20대를위한기획서은상 기획서 폴라_20대를위한기획서
은상 기획서 폴라_20대를위한기획서Seok dong Park
 
네이버 modoo![모두] 지금 바로 만들기
네이버 modoo![모두] 지금 바로 만들기네이버 modoo![모두] 지금 바로 만들기
네이버 modoo![모두] 지금 바로 만들기youngmi kang
 
HRValue.ru презентация проекта
HRValue.ru презентация проектаHRValue.ru презентация проекта
HRValue.ru презентация проектаIra Rynda
 
uzlifat fatmawati-descriptive about my lovely boarding house
uzlifat fatmawati-descriptive about my lovely boarding houseuzlifat fatmawati-descriptive about my lovely boarding house
uzlifat fatmawati-descriptive about my lovely boarding houseFatmawati Khodijah
 
Portafolio de evidencias de la Competencia Docente
Portafolio de evidencias de la Competencia DocentePortafolio de evidencias de la Competencia Docente
Portafolio de evidencias de la Competencia DocenteTania Guzmán
 
OLHE DENTRO - Inspirações do Amor - Dadaji
OLHE DENTRO - Inspirações do Amor - Dadaji OLHE DENTRO - Inspirações do Amor - Dadaji
OLHE DENTRO - Inspirações do Amor - Dadaji Truth Within
 
Brockmann suzanne tormenta inminente
Brockmann suzanne   tormenta inminenteBrockmann suzanne   tormenta inminente
Brockmann suzanne tormenta inminentePatricia Escandon
 
Caterna - Spielend sehen lernen. Online Sehübungen bei Amblyobie
Caterna - Spielend sehen lernen. Online Sehübungen bei AmblyobieCaterna - Spielend sehen lernen. Online Sehübungen bei Amblyobie
Caterna - Spielend sehen lernen. Online Sehübungen bei AmblyobieLaura Henrich
 
Madrid’s metro system map (2008)
Madrid’s metro system map (2008)Madrid’s metro system map (2008)
Madrid’s metro system map (2008)Juan Archanco
 

Destacado (20)

Wdt Practical19
Wdt  Practical19Wdt  Practical19
Wdt Practical19
 
ELF SLOs Adapting Program and Students’ Learning Outcomes January 2014
ELF SLOs Adapting Program and Students’ Learning Outcomes January 2014ELF SLOs Adapting Program and Students’ Learning Outcomes January 2014
ELF SLOs Adapting Program and Students’ Learning Outcomes January 2014
 
Trends in Biologics Outsourcing
Trends in Biologics OutsourcingTrends in Biologics Outsourcing
Trends in Biologics Outsourcing
 
2015 2학기 KOSMOS 1주차 세미나
2015 2학기 KOSMOS 1주차 세미나2015 2학기 KOSMOS 1주차 세미나
2015 2학기 KOSMOS 1주차 세미나
 
안내용 샘플 - B2B 영업 매뉴얼
안내용 샘플 -  B2B 영업 매뉴얼안내용 샘플 -  B2B 영업 매뉴얼
안내용 샘플 - B2B 영업 매뉴얼
 
은상 기획서 폴라_20대를위한기획서
은상 기획서 폴라_20대를위한기획서은상 기획서 폴라_20대를위한기획서
은상 기획서 폴라_20대를위한기획서
 
LDDTL
LDDTLLDDTL
LDDTL
 
네이버 modoo![모두] 지금 바로 만들기
네이버 modoo![모두] 지금 바로 만들기네이버 modoo![모두] 지금 바로 만들기
네이버 modoo![모두] 지금 바로 만들기
 
HRValue.ru презентация проекта
HRValue.ru презентация проектаHRValue.ru презентация проекта
HRValue.ru презентация проекта
 
uzlifat fatmawati-descriptive about my lovely boarding house
uzlifat fatmawati-descriptive about my lovely boarding houseuzlifat fatmawati-descriptive about my lovely boarding house
uzlifat fatmawati-descriptive about my lovely boarding house
 
Portafolio de evidencias de la Competencia Docente
Portafolio de evidencias de la Competencia DocentePortafolio de evidencias de la Competencia Docente
Portafolio de evidencias de la Competencia Docente
 
OLHE DENTRO - Inspirações do Amor - Dadaji
OLHE DENTRO - Inspirações do Amor - Dadaji OLHE DENTRO - Inspirações do Amor - Dadaji
OLHE DENTRO - Inspirações do Amor - Dadaji
 
1 1 Flyer
1 1 Flyer1 1 Flyer
1 1 Flyer
 
Las hadas magicas
Las hadas magicasLas hadas magicas
Las hadas magicas
 
Brockmann suzanne tormenta inminente
Brockmann suzanne   tormenta inminenteBrockmann suzanne   tormenta inminente
Brockmann suzanne tormenta inminente
 
Presentacion ing mecanica
Presentacion ing mecanicaPresentacion ing mecanica
Presentacion ing mecanica
 
Resolución 5/ 2014
Resolución 5/ 2014Resolución 5/ 2014
Resolución 5/ 2014
 
Palavra e reflexão
Palavra e reflexãoPalavra e reflexão
Palavra e reflexão
 
Caterna - Spielend sehen lernen. Online Sehübungen bei Amblyobie
Caterna - Spielend sehen lernen. Online Sehübungen bei AmblyobieCaterna - Spielend sehen lernen. Online Sehübungen bei Amblyobie
Caterna - Spielend sehen lernen. Online Sehübungen bei Amblyobie
 
Madrid’s metro system map (2008)
Madrid’s metro system map (2008)Madrid’s metro system map (2008)
Madrid’s metro system map (2008)
 

Similar a Managing Objectionable Events in cGMP Cleanrooms: A Polyphasic Approach.

Advanced Lab Techniques in Avian Medicine
Advanced Lab Techniques in Avian MedicineAdvanced Lab Techniques in Avian Medicine
Advanced Lab Techniques in Avian MedicineJoseph Giambrone
 
Advanced Laboratory Techniques in Poultry Disease Diagnosis
Advanced Laboratory Techniques in Poultry Disease DiagnosisAdvanced Laboratory Techniques in Poultry Disease Diagnosis
Advanced Laboratory Techniques in Poultry Disease DiagnosisJoseph Giambrone
 
Diagn.princ.engl. 2011-ok
Diagn.princ.engl. 2011-okDiagn.princ.engl. 2011-ok
Diagn.princ.engl. 2011-okJasmine John
 
Applications of flow cytometry to clinical microbiology
Applications of flow cytometry to clinical microbiologyApplications of flow cytometry to clinical microbiology
Applications of flow cytometry to clinical microbiologyLAB IDEA
 
BACTERIA IDENTIFICATION FROM MICROSCOPIC MORPHOLOGY USING NAÏVE BAYES
BACTERIA IDENTIFICATION FROM MICROSCOPIC MORPHOLOGY USING NAÏVE BAYESBACTERIA IDENTIFICATION FROM MICROSCOPIC MORPHOLOGY USING NAÏVE BAYES
BACTERIA IDENTIFICATION FROM MICROSCOPIC MORPHOLOGY USING NAÏVE BAYESijcseit
 
Bacteria identification from microscopic morphology using naïve bayes
Bacteria identification from microscopic morphology using naïve bayesBacteria identification from microscopic morphology using naïve bayes
Bacteria identification from microscopic morphology using naïve bayesijcseit
 
presentation on E.coli
presentation on E.colipresentation on E.coli
presentation on E.coliVandana singh
 
Koch's postulates demostration
Koch's postulates demostrationKoch's postulates demostration
Koch's postulates demostrationLaranii
 
Microbiology lecture presentation-1.pptx
Microbiology lecture presentation-1.pptxMicrobiology lecture presentation-1.pptx
Microbiology lecture presentation-1.pptxkitati1
 
Epidemiological marker (serotyping and bacteriocin typing)
Epidemiological marker (serotyping and bacteriocin typing)Epidemiological marker (serotyping and bacteriocin typing)
Epidemiological marker (serotyping and bacteriocin typing)Santosh Kumar Yadav
 
methods of isolation of bacteria
methods of isolation of bacteriamethods of isolation of bacteria
methods of isolation of bacteriadharwad
 
Clinical Bacteriology 1 22 pdf.pdf
Clinical Bacteriology 1 22 pdf.pdfClinical Bacteriology 1 22 pdf.pdf
Clinical Bacteriology 1 22 pdf.pdfHawre Najmaddin
 
Pathema Burkholderia Annotation Jamboree: Introduction to Annotation Jamboree
Pathema Burkholderia Annotation Jamboree: Introduction to Annotation JamboreePathema Burkholderia Annotation Jamboree: Introduction to Annotation Jamboree
Pathema Burkholderia Annotation Jamboree: Introduction to Annotation JamboreePathema
 
Escherichia Coli Case Study
Escherichia Coli Case StudyEscherichia Coli Case Study
Escherichia Coli Case StudyClaudia Brown
 
Characterization of shiga toxin in escherichia coli during
Characterization of shiga toxin in escherichia coli duringCharacterization of shiga toxin in escherichia coli during
Characterization of shiga toxin in escherichia coli duringLuz Marie
 
Bacteriophages & Its classification, cycles, therapy, and applications
Bacteriophages & Its classification, cycles, therapy, and applicationsBacteriophages & Its classification, cycles, therapy, and applications
Bacteriophages & Its classification, cycles, therapy, and applicationsZoqiaTariq
 
recent development in culture od Cestode
recent development in culture od Cestoderecent development in culture od Cestode
recent development in culture od CestodeAbdullah Jan
 
Escherichia Coli Related Cystitis Prevalence And...
Escherichia Coli Related Cystitis Prevalence And...Escherichia Coli Related Cystitis Prevalence And...
Escherichia Coli Related Cystitis Prevalence And...Samantha Jones
 
Master Thesis Anja Sander
Master Thesis Anja SanderMaster Thesis Anja Sander
Master Thesis Anja SanderWishofnight13
 

Similar a Managing Objectionable Events in cGMP Cleanrooms: A Polyphasic Approach. (20)

Advanced Lab Techniques in Avian Medicine
Advanced Lab Techniques in Avian MedicineAdvanced Lab Techniques in Avian Medicine
Advanced Lab Techniques in Avian Medicine
 
Advanced Laboratory Techniques in Poultry Disease Diagnosis
Advanced Laboratory Techniques in Poultry Disease DiagnosisAdvanced Laboratory Techniques in Poultry Disease Diagnosis
Advanced Laboratory Techniques in Poultry Disease Diagnosis
 
Diagn.princ.engl. 2011-ok
Diagn.princ.engl. 2011-okDiagn.princ.engl. 2011-ok
Diagn.princ.engl. 2011-ok
 
Applications of flow cytometry to clinical microbiology
Applications of flow cytometry to clinical microbiologyApplications of flow cytometry to clinical microbiology
Applications of flow cytometry to clinical microbiology
 
BACTERIA IDENTIFICATION FROM MICROSCOPIC MORPHOLOGY USING NAÏVE BAYES
BACTERIA IDENTIFICATION FROM MICROSCOPIC MORPHOLOGY USING NAÏVE BAYESBACTERIA IDENTIFICATION FROM MICROSCOPIC MORPHOLOGY USING NAÏVE BAYES
BACTERIA IDENTIFICATION FROM MICROSCOPIC MORPHOLOGY USING NAÏVE BAYES
 
Bacteria identification from microscopic morphology using naïve bayes
Bacteria identification from microscopic morphology using naïve bayesBacteria identification from microscopic morphology using naïve bayes
Bacteria identification from microscopic morphology using naïve bayes
 
presentation on E.coli
presentation on E.colipresentation on E.coli
presentation on E.coli
 
Koch's postulates demostration
Koch's postulates demostrationKoch's postulates demostration
Koch's postulates demostration
 
Microbiology lecture presentation-1.pptx
Microbiology lecture presentation-1.pptxMicrobiology lecture presentation-1.pptx
Microbiology lecture presentation-1.pptx
 
Epidemiological marker (serotyping and bacteriocin typing)
Epidemiological marker (serotyping and bacteriocin typing)Epidemiological marker (serotyping and bacteriocin typing)
Epidemiological marker (serotyping and bacteriocin typing)
 
methods of isolation of bacteria
methods of isolation of bacteriamethods of isolation of bacteria
methods of isolation of bacteria
 
rdna guidelines
rdna guidelinesrdna guidelines
rdna guidelines
 
Clinical Bacteriology 1 22 pdf.pdf
Clinical Bacteriology 1 22 pdf.pdfClinical Bacteriology 1 22 pdf.pdf
Clinical Bacteriology 1 22 pdf.pdf
 
Pathema Burkholderia Annotation Jamboree: Introduction to Annotation Jamboree
Pathema Burkholderia Annotation Jamboree: Introduction to Annotation JamboreePathema Burkholderia Annotation Jamboree: Introduction to Annotation Jamboree
Pathema Burkholderia Annotation Jamboree: Introduction to Annotation Jamboree
 
Escherichia Coli Case Study
Escherichia Coli Case StudyEscherichia Coli Case Study
Escherichia Coli Case Study
 
Characterization of shiga toxin in escherichia coli during
Characterization of shiga toxin in escherichia coli duringCharacterization of shiga toxin in escherichia coli during
Characterization of shiga toxin in escherichia coli during
 
Bacteriophages & Its classification, cycles, therapy, and applications
Bacteriophages & Its classification, cycles, therapy, and applicationsBacteriophages & Its classification, cycles, therapy, and applications
Bacteriophages & Its classification, cycles, therapy, and applications
 
recent development in culture od Cestode
recent development in culture od Cestoderecent development in culture od Cestode
recent development in culture od Cestode
 
Escherichia Coli Related Cystitis Prevalence And...
Escherichia Coli Related Cystitis Prevalence And...Escherichia Coli Related Cystitis Prevalence And...
Escherichia Coli Related Cystitis Prevalence And...
 
Master Thesis Anja Sander
Master Thesis Anja SanderMaster Thesis Anja Sander
Master Thesis Anja Sander
 

Más de Ajinomoto Althea

Frustrated with Protein Expression?
Frustrated with Protein Expression?Frustrated with Protein Expression?
Frustrated with Protein Expression?Ajinomoto Althea
 
Tackling Transfection Tasks - Niel McKenna
Tackling Transfection Tasks - Niel McKennaTackling Transfection Tasks - Niel McKenna
Tackling Transfection Tasks - Niel McKennaAjinomoto Althea
 
Fostering the Quality Based CMO-Sponsor Relationship
Fostering the Quality Based CMO-Sponsor RelationshipFostering the Quality Based CMO-Sponsor Relationship
Fostering the Quality Based CMO-Sponsor RelationshipAjinomoto Althea
 
Prefilled Syringes - A Container of Choice for Pharma
Prefilled Syringes - A Container of Choice for PharmaPrefilled Syringes - A Container of Choice for Pharma
Prefilled Syringes - A Container of Choice for PharmaAjinomoto Althea
 
China's Rising Tide - Nature Biotech
China's Rising Tide - Nature BiotechChina's Rising Tide - Nature Biotech
China's Rising Tide - Nature BiotechAjinomoto Althea
 
Timing Is Everything In Protein Formulation by Angelo DePalma, Ph.D.
Timing Is Everything In Protein Formulation by Angelo DePalma, Ph.D.Timing Is Everything In Protein Formulation by Angelo DePalma, Ph.D.
Timing Is Everything In Protein Formulation by Angelo DePalma, Ph.D.Ajinomoto Althea
 
DNA Vaccines 2011 - Talk by Rick Hancock
DNA Vaccines 2011 - Talk by Rick HancockDNA Vaccines 2011 - Talk by Rick Hancock
DNA Vaccines 2011 - Talk by Rick HancockAjinomoto Althea
 
DNA Vaccine Technology by Magda Marquet
DNA Vaccine Technology by Magda MarquetDNA Vaccine Technology by Magda Marquet
DNA Vaccine Technology by Magda MarquetAjinomoto Althea
 

Más de Ajinomoto Althea (9)

Frustrated with Protein Expression?
Frustrated with Protein Expression?Frustrated with Protein Expression?
Frustrated with Protein Expression?
 
Tackling Transfection Tasks - Niel McKenna
Tackling Transfection Tasks - Niel McKennaTackling Transfection Tasks - Niel McKenna
Tackling Transfection Tasks - Niel McKenna
 
Fostering the Quality Based CMO-Sponsor Relationship
Fostering the Quality Based CMO-Sponsor RelationshipFostering the Quality Based CMO-Sponsor Relationship
Fostering the Quality Based CMO-Sponsor Relationship
 
Prefilled Syringes - A Container of Choice for Pharma
Prefilled Syringes - A Container of Choice for PharmaPrefilled Syringes - A Container of Choice for Pharma
Prefilled Syringes - A Container of Choice for Pharma
 
Tradeshow Speed Dating
Tradeshow Speed DatingTradeshow Speed Dating
Tradeshow Speed Dating
 
China's Rising Tide - Nature Biotech
China's Rising Tide - Nature BiotechChina's Rising Tide - Nature Biotech
China's Rising Tide - Nature Biotech
 
Timing Is Everything In Protein Formulation by Angelo DePalma, Ph.D.
Timing Is Everything In Protein Formulation by Angelo DePalma, Ph.D.Timing Is Everything In Protein Formulation by Angelo DePalma, Ph.D.
Timing Is Everything In Protein Formulation by Angelo DePalma, Ph.D.
 
DNA Vaccines 2011 - Talk by Rick Hancock
DNA Vaccines 2011 - Talk by Rick HancockDNA Vaccines 2011 - Talk by Rick Hancock
DNA Vaccines 2011 - Talk by Rick Hancock
 
DNA Vaccine Technology by Magda Marquet
DNA Vaccine Technology by Magda MarquetDNA Vaccine Technology by Magda Marquet
DNA Vaccine Technology by Magda Marquet
 

Último

Basic Building Blocks of Internet of Things.
Basic Building Blocks of Internet of Things.Basic Building Blocks of Internet of Things.
Basic Building Blocks of Internet of Things.YounusS2
 
Empowering Africa's Next Generation: The AI Leadership Blueprint
Empowering Africa's Next Generation: The AI Leadership BlueprintEmpowering Africa's Next Generation: The AI Leadership Blueprint
Empowering Africa's Next Generation: The AI Leadership BlueprintMahmoud Rabie
 
Artificial Intelligence & SEO Trends for 2024
Artificial Intelligence & SEO Trends for 2024Artificial Intelligence & SEO Trends for 2024
Artificial Intelligence & SEO Trends for 2024D Cloud Solutions
 
Crea il tuo assistente AI con lo Stregatto (open source python framework)
Crea il tuo assistente AI con lo Stregatto (open source python framework)Crea il tuo assistente AI con lo Stregatto (open source python framework)
Crea il tuo assistente AI con lo Stregatto (open source python framework)Commit University
 
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPA
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPAAnypoint Code Builder , Google Pub sub connector and MuleSoft RPA
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPAshyamraj55
 
Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...
Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...
Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...Will Schroeder
 
Comparing Sidecar-less Service Mesh from Cilium and Istio
Comparing Sidecar-less Service Mesh from Cilium and IstioComparing Sidecar-less Service Mesh from Cilium and Istio
Comparing Sidecar-less Service Mesh from Cilium and IstioChristian Posta
 
ADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDE
ADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDEADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDE
ADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDELiveplex
 
Machine Learning Model Validation (Aijun Zhang 2024).pdf
Machine Learning Model Validation (Aijun Zhang 2024).pdfMachine Learning Model Validation (Aijun Zhang 2024).pdf
Machine Learning Model Validation (Aijun Zhang 2024).pdfAijun Zhang
 
NIST Cybersecurity Framework (CSF) 2.0 Workshop
NIST Cybersecurity Framework (CSF) 2.0 WorkshopNIST Cybersecurity Framework (CSF) 2.0 Workshop
NIST Cybersecurity Framework (CSF) 2.0 WorkshopBachir Benyammi
 
UiPath Solutions Management Preview - Northern CA Chapter - March 22.pdf
UiPath Solutions Management Preview - Northern CA Chapter - March 22.pdfUiPath Solutions Management Preview - Northern CA Chapter - March 22.pdf
UiPath Solutions Management Preview - Northern CA Chapter - March 22.pdfDianaGray10
 
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...UbiTrack UK
 
9 Steps For Building Winning Founding Team
9 Steps For Building Winning Founding Team9 Steps For Building Winning Founding Team
9 Steps For Building Winning Founding TeamAdam Moalla
 
How Accurate are Carbon Emissions Projections?
How Accurate are Carbon Emissions Projections?How Accurate are Carbon Emissions Projections?
How Accurate are Carbon Emissions Projections?IES VE
 
Igniting Next Level Productivity with AI-Infused Data Integration Workflows
Igniting Next Level Productivity with AI-Infused Data Integration WorkflowsIgniting Next Level Productivity with AI-Infused Data Integration Workflows
Igniting Next Level Productivity with AI-Infused Data Integration WorkflowsSafe Software
 
Bird eye's view on Camunda open source ecosystem
Bird eye's view on Camunda open source ecosystemBird eye's view on Camunda open source ecosystem
Bird eye's view on Camunda open source ecosystemAsko Soukka
 
COMPUTER 10 Lesson 8 - Building a Website
COMPUTER 10 Lesson 8 - Building a WebsiteCOMPUTER 10 Lesson 8 - Building a Website
COMPUTER 10 Lesson 8 - Building a Websitedgelyza
 
Linked Data in Production: Moving Beyond Ontologies
Linked Data in Production: Moving Beyond OntologiesLinked Data in Production: Moving Beyond Ontologies
Linked Data in Production: Moving Beyond OntologiesDavid Newbury
 

Último (20)

Basic Building Blocks of Internet of Things.
Basic Building Blocks of Internet of Things.Basic Building Blocks of Internet of Things.
Basic Building Blocks of Internet of Things.
 
20150722 - AGV
20150722 - AGV20150722 - AGV
20150722 - AGV
 
Empowering Africa's Next Generation: The AI Leadership Blueprint
Empowering Africa's Next Generation: The AI Leadership BlueprintEmpowering Africa's Next Generation: The AI Leadership Blueprint
Empowering Africa's Next Generation: The AI Leadership Blueprint
 
Artificial Intelligence & SEO Trends for 2024
Artificial Intelligence & SEO Trends for 2024Artificial Intelligence & SEO Trends for 2024
Artificial Intelligence & SEO Trends for 2024
 
Crea il tuo assistente AI con lo Stregatto (open source python framework)
Crea il tuo assistente AI con lo Stregatto (open source python framework)Crea il tuo assistente AI con lo Stregatto (open source python framework)
Crea il tuo assistente AI con lo Stregatto (open source python framework)
 
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPA
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPAAnypoint Code Builder , Google Pub sub connector and MuleSoft RPA
Anypoint Code Builder , Google Pub sub connector and MuleSoft RPA
 
Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...
Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...
Apres-Cyber - The Data Dilemma: Bridging Offensive Operations and Machine Lea...
 
Comparing Sidecar-less Service Mesh from Cilium and Istio
Comparing Sidecar-less Service Mesh from Cilium and IstioComparing Sidecar-less Service Mesh from Cilium and Istio
Comparing Sidecar-less Service Mesh from Cilium and Istio
 
ADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDE
ADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDEADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDE
ADOPTING WEB 3 FOR YOUR BUSINESS: A STEP-BY-STEP GUIDE
 
20230104 - machine vision
20230104 - machine vision20230104 - machine vision
20230104 - machine vision
 
Machine Learning Model Validation (Aijun Zhang 2024).pdf
Machine Learning Model Validation (Aijun Zhang 2024).pdfMachine Learning Model Validation (Aijun Zhang 2024).pdf
Machine Learning Model Validation (Aijun Zhang 2024).pdf
 
NIST Cybersecurity Framework (CSF) 2.0 Workshop
NIST Cybersecurity Framework (CSF) 2.0 WorkshopNIST Cybersecurity Framework (CSF) 2.0 Workshop
NIST Cybersecurity Framework (CSF) 2.0 Workshop
 
UiPath Solutions Management Preview - Northern CA Chapter - March 22.pdf
UiPath Solutions Management Preview - Northern CA Chapter - March 22.pdfUiPath Solutions Management Preview - Northern CA Chapter - March 22.pdf
UiPath Solutions Management Preview - Northern CA Chapter - March 22.pdf
 
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...
UWB Technology for Enhanced Indoor and Outdoor Positioning in Physiological M...
 
9 Steps For Building Winning Founding Team
9 Steps For Building Winning Founding Team9 Steps For Building Winning Founding Team
9 Steps For Building Winning Founding Team
 
How Accurate are Carbon Emissions Projections?
How Accurate are Carbon Emissions Projections?How Accurate are Carbon Emissions Projections?
How Accurate are Carbon Emissions Projections?
 
Igniting Next Level Productivity with AI-Infused Data Integration Workflows
Igniting Next Level Productivity with AI-Infused Data Integration WorkflowsIgniting Next Level Productivity with AI-Infused Data Integration Workflows
Igniting Next Level Productivity with AI-Infused Data Integration Workflows
 
Bird eye's view on Camunda open source ecosystem
Bird eye's view on Camunda open source ecosystemBird eye's view on Camunda open source ecosystem
Bird eye's view on Camunda open source ecosystem
 
COMPUTER 10 Lesson 8 - Building a Website
COMPUTER 10 Lesson 8 - Building a WebsiteCOMPUTER 10 Lesson 8 - Building a Website
COMPUTER 10 Lesson 8 - Building a Website
 
Linked Data in Production: Moving Beyond Ontologies
Linked Data in Production: Moving Beyond OntologiesLinked Data in Production: Moving Beyond Ontologies
Linked Data in Production: Moving Beyond Ontologies
 

Managing Objectionable Events in cGMP Cleanrooms: A Polyphasic Approach.

  • 1. E N V I R O N M E N TA L M O N I T O R I N G BY J.S. SIDHU, C.T. TYLER, G. MA, AND M. SAMADPOUR, MOLECULAR EPIDEMIOLOGY, INC., AND E.J. BRANDRETH, ALTHEA TECHNOLOGIES IN BIOPHARMACEUTICAL manufacturing, an ac- manufacturers to take more rational and manageable curate and comprehensive knowledge of the entire process approaches to environmental montioring. flow is a critical part of a thorough cGMP microbial We recommend a polyphasic approach, one that control program. The goal is to have precise data highlight- makes use of key characteristics or properties of a ing where incursion points may exist, and control those particular unknown organism in tandem with its points to limit or prevent migration into the process flow. genetic information. Such an approach provides a more Historically, the identification of cleanroom environmental definitive taxonomic identification; it also avoids the monitoring (EM) isolates has been limited to the genus or group level for most organisms, with some ability to pro- Genetic ID vide species level identification only if absolutely required. Comparisons to genetically similar microorganisms Recently, rapid technologies have become Genetic Distance Genus Species available, especially DNA-sequencing based systems, to more quickly identify microorganisms. These 0.000 Shigella sonnei techniques can help manufacturers to understand and 0.000 Shigella flexneri investigate potential physical and temporal sources 0.000 Escherichia coli of contamination. However, while such genetic-based 0.000 Shigella boydii systems may be rapid, they are still inherently limited by their inability to discriminate between species and 0.000 Escherichia sp. some genera in some critical categories. Additionally, 0.007 Enterobacter hormaechei an identification match is only possible if the organism 0.0019 Shigella dysenteriae and its reference are adequately differentiated and in 0.0022 Enterobacter sp. the manufacturers’ database. Thus, with this increase in technology comes the likelihood of identifying 0.0031 Cronobacter sakazakii a far greater number of potentially “objectionable” 0.0081 Citrobacter freundii environmental organisms (e.g., coliforms, pathogens) 0.0090 Enterobacter dissolvens than ever before, as well as challenges in knowing what to do with the additional data. 0.0100 Kiebsiella oxytoca It’s important, therefore, that new tools and the data Microbial ID Family: Enterobacteriaceae they produce not take precedence over the practical Conclusion application of good microbiological practices. If Figure 1. Genetic-based identification reported the unknown isolate as anything, these technologies increase the necessity for “Family: Enterobacteriaceae.”
  • 2. E N V I R O N M E N TA L M O N I T O R I N G Since the polyphasic determination presented the EM isolate as belonging to the same genus and species as the MCB and was a potentially objectionable organism (coliform), further analysis of its potential for pathogenicity was required. The process included targeted PCR analysis of toxins as well as attachment factors associated with recognized pathogenic forms, such as Enterotoxigenic E. coli (ETEC), Shiga-toxin producing E. coli (STEC), Enterohemorrhagic E. coli (EHEC), and Enteropathogenic E. coli (EPEC), or closely related species such as Shigella spp. Figure 2. Polyphasic Microbial Identification (PMID) identified the isolate as Escherichia coli. The following organisms were used for Quality Control purposes in the Identities = 416/418 (99%), Gaps = 1/418 (0%) various analytical tests performed: E. coli ATCC 8739, Shigella sonnei E. coli O157 23 ATCC 25931, Klebsiella pneumoniae ACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACAC 82 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| E. coli K-12 213094 ACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACAC 213035 ATCC 10031, and Klebsiella oxytoca E. coli O157 83 GCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGT 142 E. coli K-12 213034 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| GCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGT 212975 ATCC 43863. These were obtained E. coli O157 143 AGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGG 202 as lyophilized cultures, reconstituted E. coli K-12 212974 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| AGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGG 212915 and sub-cultured as recommended E. coli O157 203 ATCGTCGCCTAGGTGAGCCGTTACCCCACCTACTAGCTAATCCCATCTGGGCACATCCGA 262 for isolated colonies. The study |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| E. coli K-12 212914 ATCGTCGCCTAGGTGAGCCGTTACCCCACCTACTAGCTAATCCCATCTGGGCACATCCGA 212855 was further supplemented with E. coli O157 263 TGGCAAGAGGCCCGAAGGTCCCCCTCTTTGGTCTTGCGACGTTATGCGGTATTAGCTACC |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 322 ATCC-derived strains, Enterobacter E. coli K-12 212854 TGGCAAGAGGCCCGAAGGTCCCCCTCTTTGGTCTTGCGACGTTATGCGGTATTAGCTACC 212795 cloacae ATCC 23355, Pseudomonas E. coli O157 323 GTTTCCAGTAGTTATCCCNNCTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGC |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| 382 aeruginosa ATCC 9027, E. coli ATCC E. coli K-12 212794 GTTTCCAGTAGTTATCCCC-CTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGC 212736 25922 and E. coli O157:H7 ATCC E. coli O157 383 CACTCGTCAGCAAAGAAGCAAGCTTCTTCCTGTTACCGTTCGACTTGCATGTGTTAGG 440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 35150, from MEI’s QC collection as E. coli K-12 212735 CACTCGTCAGCAAAGAAGCAAGCTTCTTCCTGTTACCGTTCGACTTGCATGTGTTAGG 212678 well as two additional E. coli strains Figure 3. Alignment comparison of partial 16S rRNA genetic sequence from platform strain E. coli from lab and environmental sources. K-12 with genetic sequence from pathogenic strain E. coli O157:H7. Note that >99 percent homol- Additionally, Althea submitted ogy at this sequence length is considered as indistinguishable. an isolate of the Master Cell Bank platform strain used in processing. pitfalls of potentially misidentifying combining a genetic-based microbial Representative cultures of each organisms due to the limitations ID assay (16S rRNA sequencing) with microorganism were subjected to of various commercial phenotypic a broad spectrum for phenotypic and 16S rRNA sequencing, colonial, and genotypic microbial ID systems biochemical analyses, to accurately morphological, biochemical (Vitek and their databases. This article identify a potentially objectionable GNI, bioMérieux) observations and will detail such an approach taken environmental organism submitted DNA fingerprinting using pulsed recently during work at facilities of by Althea. The organism of con- field gel electrophoresis (PFGE Althea Technologies in San Diego. cern was recovered during routine analysis—with restriction enzymes environmental monitoring, while XbaI, AvrII and SpeI). Analysis of AN ORGANISM OF CONCERN aliquoting in a tissue culture hood. toxigenic and pathogenic potential In the current study, Molecular The procedure involved a biofermen- was conducted using a proprietary Epidemiology Inc. (MEI) used a tation Master Cell Bank (MCB), with polymerase chain reaction (PCR) polyphasic identification approach, Escherichia coli as the platform. method (MEI, 2010) to determine the 44 MAY 2012
  • 3. E N V I R O N M E N TA L M O N I T O R I N G Figure 4. PCR results for various targeted marker genes: upper image shows recovery of genomic DNA (lane 8, negative, is buffer control); middle image shows GAPDH target specific to members of Enterobacteriaceae (note lane 5, negative, is Pseudomonas aeru- ginosa); lower image shows recovery of target toxin and attachment genes in control strain E. coli O157:H7 (lane 7); lane 2 is study strain. presence or absence of toxin markers and pathogenicity factors in the reference and subject strains. CONFIRMING IDENTIFICATION An initial isolate recovered from a cleanroom sanitary fill operation (aliquoting of MCB) was received for identification by 16S rRNA genetic Figures 5a, 5b, 5c. A comparison of genetic sub-typing patterns of entire genomes by pulsed field sequencing. The isolate was reported gel electrophoresis showing distinctly different patterns between EM isolate (Althea Tech.) and as a member of the Family Entero- other E. coli, pathogenic forms of E. coli and other selected pathogens and non-pathogens in Fam- bacteriaceae (Figure 1)—consistent ily Enterobacteriaceae. Note the indistinguishable patterns of EM isolate and Platform E. coli under with the industry and federally conditions of three different restriction enzymatic digests: XbaI, AvrII, and SpeI. recognized guidelines (CLSI, 2008) for genetic sequencing techniques culture of E. coli O157:H7 ATCC (PCR) analyses for specifically for identification. Further taxonomic 35150. Furthermore, sequence targeted toxigenic and pathogenic classification was required, and the alignment data (Figure 3) indicate markers demonstrated the absence application of a polyphasic micro- the indistinguishable similarity of these markers in the submitted biological ID (PMID) method clearly in the 16S rRNA gene sequence organism (Figure 4, lane 2) when differentiated and reported the associated with the pathogenic compared to the control organisms isolate as E. coli (Figure 2). species. Therefore, reliance on (Figure 4, lane 7). Further comparisons with related genetic-based ID or even a microbial Subsequent to the PMID of the EM strains with pathogenic potential ID conclusion would not rule out the isolate as E. coli, DNA Fingerprinting differentiated and confirmed this possibility of a frank pathogen. comparison of the entire genome identification (data not shown). Of To confirm that the EM isolate by PFGE analysis (employing three concern was the equally identical had not acquired any pathogenic distinct restriction enzyme digests) taxonomic ID presented by the QC potential, polymerase chain reaction demonstrated the differences in
  • 4. E N V I R O N M E N TA L M O N I T O R I N G Coliform in Classified Area the facility is verified to be operating with suitable environmental control Microbial Identification regarding the detection of coliforms. Polyphasic Microbial ID Genetic ID EM AND EXCURSION RESPONSE A company should have an estab- Species Level ID: E. coli Family Level Output: lished SOP which clearly identifies Enterobacteriaceae the actions to be taken, including Strain Characterization Toxigenicity and clear directions if and when regula- Species/Strains of Note by PFGE Pathogenicity analysis by PCR tory notification (FDA, USDA, CDC, etc.) would be required. In many cas- Match to Platform Strain No toxin or pathogen Shigella sonnei E. coli O157:H7 (and other es, the detection of an enteric organ- markers detected pathogenic serotypes) ism or a frank pathogen may include No Risk Undefined Risk the determination of non-pathoge- nicity, or absence of virulence factors and potential for toxigenicity, which Figure 6. MEI’s proprietary Polyphasic System Approach CAPA allows the manufacturer to better (PSA) towards the investigation of a potential “objection- manage associated risk. The key is to able” organism. understand the process and potential incursion points, and to complement genetic profiles from other similarly demonstrated to be unequivocally them with Corrective Action/Preven- named control and environmental non-pathogenic and non-toxigenic tive Action, based on the potential strains (Figures 5a, 5b, 5c). by PCR analysis of pathogenic and toxigenicity or pathogenicity of The isolate under investigation toxigenic potential. The entire pro- the organism. This, coupled with a is identified in the dendrograms cess using a thorough science-based science-based Risk Assessment, al- and its genomic pattern is clearly evaluation is illustrated in Figure 6. lows for a more rigorous evaluation distinguishable from the other As such, this isolate was not of potential EM excursions. strains and yet indistinguishable an “objectionable” organism. The from the Master Cell Bank platform manipulation of the fermentation References strain. This, having already strain—sampling, pipetting with 1. Clinical Laboratory Standards Institute. demonstrated the strain’s lack of expected minute aspirations, etc.— Interpretive Criteria for Identification associated pathogenicity, confirms its can lead to isolated incidents of of Bacteria and Fungi by DNA Target clonal relationship with the MCB. detection of the bioprocess strain Sequencing: Approved Guideline. CLSI in any well-controlled facility. document MM18-A. Wayne, PA, 2008. BIOPROCESS STRAIN: A SCI- The results presented here show 2. Molecular Epidemiology, Inc. dba IEH ENCE-BASED EVALUATION the benefits of polyphasic ID Laboratories & Consulting Group. IEH In our study, the detection of an E. and the limitations of genetic or E. coli O157, Stx-producing E. coli, (STEC) coli recovered during environmen- phenotypic (rapid) microbial ID with Intiman and Salmonella Test System. tal/production monitoring in the methods when used individually. AOAC-RI PTM 100701, AOAC Research tissue culture hood was cause for Incorrect, incomplete or inadequate Institute, Gaithersburg, MD, USA, 2010. thorough and appropriate investiga- identification and characterization tion. Through the use of a detailed of strains of E. coli cannot exclude About the Authors polyphasic analysis approach, the potential pathogenic forms such as Jaspreet S. Sidhu, Ph.D. (VP, Business Devel- isolate was verified to be the same specific pathogenic serotypes (e.g., opment and Pharmaceutical Microbiology), taxonomic genus and species as the O157; O104), Enterohemorrhagic Connor Tyler (Scientist), Greg Ma (Director bioprocess strain. Further testing via strains (EHEC) as well as E. coli of General Microbiology), and Mansour Sa- DNA fingerprinting by pulsed field subtypes STEC, ETEC, and EPEC, madpour, Ph.D. (President, CEO) represent gel electrophoresis demonstrated respectively. By detailed polyphasic Molecular Epidemiology, Inc. in Lake Forest that this was indeed the exact same analysis and demonstrating that any Park, Washington. E.J. Brandreth is VP of strain as used in the fermentation isolate of E. coli is linked directly to Quality and Regulatory Affairs for Althea process. In addition, the strain was the upstream production process, Technologies, San Diego. 46 MAY 2012