Materialhereditario
Ácidos nucleicos     ADN      ARN
ADN: nucleótidosNúcleo. Los cromosomas están formados por ADN y proteínas                    Grupo fostato                ...
ARN: nucleótidos   Núcleo  Citoplasma. Gen  Proteína  Carácter                 Grupo fostato                       +   ...
ADN Desoxirribosa: C-2 ha  perdido el oxígeno. Enlace entre el grupo      fosfato y ladesoxirribosa por el C-5.
ADN     EnlaceFOSFODIESTER  (unión de 2 nucleótidos): Entre C-3 de unnucleótico y C-5 de otro nucleótido.                 ...
Las diferencias fenotípica respecto a un carácter se debe                       posiblemente a un (o a unos pocos) nucleót...
Secuencia nucleotídica de una región del gen A en                                        distintos individuosIndiv1Secuenc...
•Gen letal y esencial •Un gen que cuando está alterado es letal, es un gen esencial •Gen y del ratón doméstico es un ejemp...
Pleiotropía                                 Ejemplo anemia falciforme       Cambio de un nucleótido        en el DNA del g...
Caracteres determinados por       más de un gen
Tema 4  genes y manipulación genética
Tema 4  genes y manipulación genética
Tema 4  genes y manipulación genética
Tema 4  genes y manipulación genética
Tema 4  genes y manipulación genética
Tema 4  genes y manipulación genética
Tema 4  genes y manipulación genética
Tema 4  genes y manipulación genética
Próxima SlideShare
Cargando en…5
×

Tema 4 genes y manipulación genética

1.039 visualizaciones

Publicado el

Tema 4

0 comentarios
0 recomendaciones
Estadísticas
Notas
  • Sé el primero en comentar

  • Sé el primero en recomendar esto

Sin descargas
Visualizaciones
Visualizaciones totales
1.039
En SlideShare
0
De insertados
0
Número de insertados
277
Acciones
Compartido
0
Descargas
2
Comentarios
0
Recomendaciones
0
Insertados 0
No insertados

No hay notas en la diapositiva.

Tema 4 genes y manipulación genética

  1. 1. Materialhereditario
  2. 2. Ácidos nucleicos ADN ARN
  3. 3. ADN: nucleótidosNúcleo. Los cromosomas están formados por ADN y proteínas Grupo fostato + Nucleósido * Azúcar: desoxirribosa +* Base nitrogenada Púrica: Adenina, Guanina Pirimidínicas: Timina, Citosina
  4. 4. ARN: nucleótidos Núcleo  Citoplasma. Gen  Proteína  Carácter Grupo fostato + Nucleósido * Azúcar: ribosa +* Base nitrogenada Púrica: Adenina, Guanina (2 ANILLOS) Pirimidínicas: Uracilo, Citosina (1 ANILLO)
  5. 5. ADN Desoxirribosa: C-2 ha perdido el oxígeno. Enlace entre el grupo fosfato y ladesoxirribosa por el C-5.
  6. 6. ADN EnlaceFOSFODIESTER (unión de 2 nucleótidos): Entre C-3 de unnucleótico y C-5 de otro nucleótido. APRENDER LA FÓRMULA DE LA CITOSINA
  7. 7. Las diferencias fenotípica respecto a un carácter se debe posiblemente a un (o a unos pocos) nucleótidos. ES IMPORTANTÍSIMO EL ORDEN. Alelo ASecuencia 11 acgtagcatcgtatgcgttagacgggggggtagcaccagtacagSecuencia 22 acgtagcatcgtatgcgttagacggggtggtagcaccagtacagSecuencia 33 acgtagcatcgtatgcgttagacggcggggtagcaccagtacag Alelo aSecuencia 4 acgtagcatcgtttgcgttagacgggggggtagcaccagtacagSecuencia 5 acgtagcatcgtttgcgttagacgggggggtagcaccagtacagSecuencia 6 acgtagcatcgtttgcgttagacggcatggcaccggcagtacagSecuencia 7 7 acgtagcatcgtttgcgttagacggcatggcaccggcagtacagSecuencia 88 acgtagcatcgtttgcgttagacggcatggcaccggcagtacagSecuencia 9 acgtagcatcgtttgcgttagacggcatggcaccggcagtacag
  8. 8. Secuencia nucleotídica de una región del gen A en distintos individuosIndiv1Secuencia 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacagIndiv1Secuencia 2 acgtagcatcgtatgcgttagacggggtggtagcaccagtacag Alelo A = a Genotipo AA = aa -> Fenotipo A Alelo a = tIndiv2Secuencia 1 acgtagcatcgtatgcgttagacgggggggtagcaccagtacagIndiv2Secuencia 2 acgtagcatcgtttgcgttagacgggggggtagcaccagtacag Genotipo Aa = at -> Fenotipo AIndiv3 Secuencia 1acgtagcatcgtttgcgttagacggcatggcaccggcagtacagIndiv3 Secuencia 2acgtagcatcgtttgcgttagacggcatggcaccggcagtacag Genotipo aa = at -> Fenotipo a
  9. 9. •Gen letal y esencial •Un gen que cuando está alterado es letal, es un gen esencial •Gen y del ratón doméstico es un ejemplo Alelo y es dominante para el color amarillo, letal en homocigosis.
  10. 10. Pleiotropía Ejemplo anemia falciforme Cambio de un nucleótido en el DNA del gen de la hemoglobina Rápida destrucción de Problemas Acumulación de células los glóbulos rojos circulatorios falciformes en el bazo Producción de hemoglobina S en lugar de la A Baja concentración de oxígeno en lo tejidos Daño Daños en Daño en Anemia cerebral otros órganos el bazo Agregación de la hemoglobina S paraformar estructuras casi cristalinas en aguja en los glóbulos rojos Debilidad Fallo física cardiaco Parálisis Distorsión de los glóbulos rojos, adquieren forma de hoz (falciforme) Función mental disminuida Fallo renal Neumonía Reumatismo
  11. 11. Caracteres determinados por más de un gen

×