SlideShare una empresa de Scribd logo
1 de 13
Descargar para leer sin conexión
Current	
  and	
  future	
  animal	
  vaccine	
  
research	
  ac2vi2es	
  at	
  ILRI	
  
Vaccine	
  Biosciences	
  
Interna.onal	
  Livestock	
  Research	
  Ins.tute	
  
1st	
  July	
  2014	
  
Contact:	
  	
  ilri-­‐vaccines@cgiar.org	
  
ILRI	
  Nairobi	
  campus	
  
A lab in Africa at the foot of Kenya’s Ngong Hills
★	
  
Google’s	
  view	
  of	
  the	
  ILRI	
  campus	
  -­‐	
  
laboratory	
  and	
  farm	
  facili2es	
  
BecA	
  -­‐
ILRI	
  Labs	
  
Secure	
  
Animal	
  
Disease	
  
Facility	
  
Farm	
  and	
  
paddocks	
  
Importance	
  of	
  animal	
  health	
  research	
  in	
  
the	
  developing	
  world	
  
Ø  Livestock	
  offer	
  a	
  powerful	
  pathway	
  out	
  of	
  poverty	
  for	
  ~750	
  million	
  poor	
  farmers	
  in	
  
South	
  Asia	
  and	
  Africa	
  by	
  providing	
  nutri2onal	
  and	
  economic	
  security.	
  
Ø  Infec2ous	
  livestock	
  diseases	
  feature	
  prominently	
  among	
  the	
  constraints	
  faced	
  by	
  
livestock	
  agriculture.	
  
u  Endemic	
  diseases	
  
u  Epidemic/pandemic	
  diseases	
  
u  Trans-­‐boundary	
  diseases	
  
u  Emerging	
  and	
  re-­‐emerging	
  diseases	
  
u  Zoono2c	
  diseases	
  and	
  food	
  safety	
  
	
  
	
  
Ø  Vaccines	
  are	
  the	
  most	
  effec2ve	
  disease	
  interven2on	
  deployed	
  especially	
  in	
  
developing	
  countries	
  but	
  most	
  vaccines	
  if	
  they	
  exist	
  are	
  sub-­‐op2mal.	
  
Ø  For	
  many	
  reasons	
  diseases	
  are	
  neglected	
  problems	
  in	
  affected	
  countries,	
  a	
  situa2on	
  
exacerbated	
  by	
  a	
  general	
  lack	
  of	
  investment,	
  vaccine	
  R	
  &	
  D	
  and	
  manufacturing	
  
capacity.	
  
	
  
List	
  of	
  current	
  ILRI	
  high	
  priority	
  
diseases	
  targeted	
  for	
  control	
  
Ø  African	
  swine	
  fever	
  (ASF)	
  –	
  swine	
  
u  African	
  disease	
  threatens	
  the	
  global	
  $150	
  billion/year	
  pig	
  industry	
  
Ø  Contagious	
  bovine	
  pleuropneumonia	
  (CBPP)	
  –	
  caZle	
  
u  Regional	
  losses	
  to	
  CBPP	
  amount	
  to	
  ~	
  $60	
  million/year	
  
	
  
Ø  East	
  Coast	
  fever	
  (ECF)	
  –	
  caZle	
  
u  Regional	
  losses	
  exceed	
  $300	
  million/year;	
  kills	
  ~	
  1million	
  caZle/year	
  
	
  
Ø  Peste	
  de	
  pe2ts	
  ruminants	
  (PPR)	
  –	
  small	
  ruminants	
  
u  Losses	
  in	
  Kenya	
  alone	
  amount	
  to	
  ~	
  $13	
  million/year	
  	
  
	
  
Ø  Ri_	
  Valley	
  Fever	
  (RVF)	
  –	
  small	
  ruminants,	
  caZle	
  and	
  human	
  
u  2006/7	
  outbreak	
  in	
  Kenya	
  cost	
  ~	
  $30	
  million	
  
o  	
  309	
  human	
  cases	
  in	
  Kenya,	
  Somalia	
  and	
  Tanzania;	
  140	
  deaths	
  
Vaccines	
  save	
  lives	
  and	
  livestock	
  and	
  contribute	
  to	
  food	
  security	
  
and	
  poverty	
  allevia5on	
  
ILRI’s	
  vaccine	
  R	
  &	
  D	
  pathway	
  to	
  impact	
  
Marke&ng)
Market)
assessment)
Proof0of0principle)
laboratory/field)
Clinical)
development)
Manufacturing)
Product)development)partnerships))Research)partnerships)
Disease)selec&on) Lead)vaccine)molecules) Vaccine)op&miza&on) Scaled0up)produc&on) Delivery)
NARS,&Universi.es,&ARIs,&Regional&and&
sub7regional&R&D&organiza.ons,&PPP&&
Target)product)profile) Phase)I,)II,)III)trials) Regulatory)processes) Con&nued)monitoring)
PPP,&Private&sector,&Regional&networks,&FAO,&OIE,&PANVAC,&
AU7IBAR,&NARs,&NGOs&
Ø  ILRI’s	
  compara2ve	
  advantage	
  is	
  mainly	
  in	
  the	
  discovery	
  phase	
  to	
  proof-­‐of-­‐principle	
  
under	
  laboratory	
  and	
  field	
  condi2ons.	
  
Ø  Different	
  entry	
  points	
  in	
  pathway	
  depending	
  on	
  disease	
  targeted	
  for	
  control.	
  
u  Improvement	
  of	
  exis2ng	
  vaccines	
  
u  Development	
  of	
  subunit	
  vaccines	
  
u  Laboratory	
  and	
  field	
  based	
  diagnos2cs	
  
Vaccines	
  save	
  lives	
  and	
  livestock	
  and	
  contribute	
  to	
  food	
  security	
  
and	
  poverty	
  allevia5on	
  
ILVAC	
  –	
  plan2ng	
  the	
  orchard	
  
BASIC&RESEARCH&
&
Increase&our&knowledge&base&
&
“Knowledge&lays&the&founda>on&
for&science&&&innova>on”&
APPLIED&RESEARCH&!
Develop&new&vaccines&&&diagnos>cs&
!
“Vaccines&are&highly&effec>ve&an>I
disease&interven>ons”&
! Study&hostIpathogen&interac>ons&
&
! Map&immune&responses&to&infec>on&
! Characterize&pathogen&virulence&
! Inves>gate&disease&epidemiology&
! Dissect&pathogen&biology&&&
diversity&
! Iden>fy&candidate&vaccine&and&
diagnos>c&molecules&
! Assess&candidate&vaccine&molecules&
! Assess&aMenuated&pathogens&
! ThermoIstabilize&vaccines&
! Develop&easy&to&use&diagnos>c&tools&
! Assess&different&vaccina>on&
systems&
! Facilitate&transla>on&of&research&
outputs&to&commercial&products&
Vaccines	
  save	
  lives	
  and	
  livestock	
  and	
  contribute	
  to	
  food	
  security	
  
and	
  poverty	
  allevia5on	
  
ILVAC	
  -­‐	
  a	
  vaccine	
  plaeorm	
  
An#body(technologies(
Vaccine(technologies(
Cellular(technologies(
Diagnos#c(technologies(
Genomic(technologies(
Contagious(bovine(
pleuropneumonia((
East(Coast(fever(
African(swine(fever((
Consor#a(for(research(&(product(development(and(capacity(development(
Private(sector(
GALVmed(
CRPs(
NARS(
InterEgov(
agencies(
Improved(vaccines(and(
diagnos#c(tools(
Peste(des(pe##s(ruminants((
RiF(Valley(fever(
Infec#ous(disease(
research:(basic(&(applied(
ILVAC(–(a(vaccine(plaIorm(
A	
  poreolio	
  of	
  innova2on	
  and	
  vaccine	
  
related	
  technology	
  plaeorms	
  
Ø  Op2mizing	
  exis2ng	
  vaccines	
  
u  Thermostabiliza2on	
  of	
  aZenuated	
  viral	
  vaccines	
  
u  Establishing	
  quality	
  control	
  and	
  process	
  improvement	
  
	
  	
  
Ø  Reverse	
  vaccinology	
  and	
  immunology	
  
u  Iden2fica2on	
  of	
  candidate	
  vaccine	
  an2gens	
  
u  Assessing	
  protein	
  and	
  gene-­‐based	
  	
  vaccine	
  formula2ons	
  
	
  	
  
Ø  Pathogen	
  &	
  livestock	
  genomics	
  
u  Host	
  and	
  pathogen	
  gene	
  expression	
  profiles	
  
u  Pathogen	
  popula2on	
  structure	
  
	
  	
  
Ø  Synthe2c	
  genomics	
  
u  Manipula2ng	
  bacterial	
  genomes	
  
u  AZenua2ng	
  viruses	
  by	
  genome	
  engineering	
  
Yeast&with&M.#myc&LC&
genome&
(Delete&puta5ve&&
virulence&factors)&
Less&virulent&M.#myc&LC&
ACTGGTACGTAGGGCATCGA
TCGACATGATAGAGCATATA
GCATGACGATGCGATCGACA
GTCGACAGCTGACAGCTGAG
GGTGACACCAGCTGCCAGCT
GGACCACCATTAGGACAGAT
GACCACACACAAATAGACGA
TTAGGACCAGATGAGCCACA
TTTTAGGAGGACACACACCA
Bioinformatics
tools
Predict gene
sequences and
list candidate
vaccine antigens
Test experimental vaccine
Clone genes of
vaccine interest
(100’s of genes)
Filter genes via
immunological
assays
Pathogen genome mining
(1000’s of genes)
Molecular immunology
tools to assess immune
responses in cattle
(10’s genes)
A	
  research	
  center	
  of	
  excellence	
  -­‐	
  	
  	
  
	
  a	
  vaccine	
  ini2a2ve	
  at	
  ILRI	
  
Ø  Exploit	
  high-­‐end	
  science	
  and	
  technologies	
  to	
  accelerate	
  vaccine	
  development	
  
Ø  Support	
  each	
  disease	
  focus	
  with	
  program	
  level	
  funding	
  
	
  
Ø  Develop	
  global	
  research	
  and	
  product	
  development	
  partnerships	
  
	
  
Ø  Provide	
  fellowships	
  for	
  training	
  and	
  scien2fic	
  leadership	
  in	
  developing	
  countries	
  
Ø  Help	
  build	
  ins2tu2onal	
  capacity	
  for	
  vaccine	
  R	
  &	
  D	
  in	
  developing	
  countries	
  
	
  
Ø  S2mulate	
  learning	
  between	
  veterinary	
  and	
  human	
  vaccine	
  communi2es	
  
	
  
Ø  Provide	
  an	
  incubator	
  type	
  approach	
  to	
  leverage	
  ILRI	
  facili2es	
  
Why	
  ILRI	
  for	
  a	
  vaccine	
  ini2a2ve?	
  
Ø  Modern	
  bio-­‐molecular	
  laboratory	
  facili2es	
  
Ø  	
  Secure	
  animal	
  disease	
  facili2es	
  for	
  large	
  
	
  and	
  small	
  animals	
  
	
  
Ø  	
  Loca2on	
  and	
  access	
  to	
  diverse	
  pathogens	
  
indigenous	
  livestock	
  and	
  wildlife	
  
	
  
Ø  Track	
  record	
  in	
  teaching,	
  training	
  and	
  capacity	
  building	
  
	
  
Ø  Ongoing	
  projects	
  
o  Vaccine	
  development	
  against	
  neglected	
  livestock	
  diseases	
  
o  One	
  Health	
  and	
  agricultural	
  associated	
  human	
  diseases	
  
o  Highly	
  relevant	
  field	
  research	
  
Ø  Networks	
  with	
  academic,	
  na2onal,	
  regional	
  and	
  interna2onal	
  organiza2ons,	
  
including	
  the	
  public,	
  private	
  and	
  development	
  sectors	
  
	
  
The	
  ILRI	
  Vaccine	
  Biosciences	
  group	
  
The	
  presenta.on	
  has	
  a	
  Crea.ve	
  Commons	
  licence.	
  You	
  are	
  free	
  to	
  re-­‐use	
  or	
  distribute	
  this	
  work,	
  provided	
  credit	
  is	
  given	
  to	
  ILRI.	
  
ilri.org
Box 30709, Nairobi 00100, Kenya
Phone: + 254 20 422 3000
Fax: +254 20 422 3001
Email: ILRI-Kenya@cgiar.org
Box 5689,Addis Ababa, Ethiopia
Phone: +251 11 617 2000
Fax: +251 11 617 2001
Email: ILRI-Ethiopia@cgiar.org
other offices
China • India • Mali
Mozambique • Nigeria • Tanzania
Thailand • Uganda • Vietnam
Better lives through livestock
ILRI is a member of the CGIAR Consortium
BeKer	
  lives	
  through	
  livestock	
  
ilri.org	
  

Más contenido relacionado

La actualidad más candente

The use of Innovation Platforms to increase vaccination coverage against ende...
The use of Innovation Platforms to increase vaccination coverage against ende...The use of Innovation Platforms to increase vaccination coverage against ende...
The use of Innovation Platforms to increase vaccination coverage against ende...ILRI
 
The future of food safety in Africa: Research perspective
The future of food safety in Africa: Research perspectiveThe future of food safety in Africa: Research perspective
The future of food safety in Africa: Research perspectiveILRI
 
Mapping the interface of poverty, emerging markets and zoonoses
Mapping the interface of poverty, emerging markets and zoonosesMapping the interface of poverty, emerging markets and zoonoses
Mapping the interface of poverty, emerging markets and zoonosesILRI
 
Human health risks at the animal-human interface
Human health risks at the animal-human interface Human health risks at the animal-human interface
Human health risks at the animal-human interface ILRI
 
Sustainable Agricultural Development for Food Security and Nutrition: What Ro...
Sustainable Agricultural Development for Food Security and Nutrition: What Ro...Sustainable Agricultural Development for Food Security and Nutrition: What Ro...
Sustainable Agricultural Development for Food Security and Nutrition: What Ro...ILRI
 
Value chain actors’ practices associated with the spread of African swine fev...
Value chain actors’ practices associated with the spread of African swine fev...Value chain actors’ practices associated with the spread of African swine fev...
Value chain actors’ practices associated with the spread of African swine fev...ILRI
 
Small ruminant value chain development in Horro, Ethiopia
Small ruminant value chain development in Horro, EthiopiaSmall ruminant value chain development in Horro, Ethiopia
Small ruminant value chain development in Horro, EthiopiaILRI
 
Catalysing emerging smallholder pig value chains in Uganda to increase rural ...
Catalysing emerging smallholder pig value chains in Uganda to increase rural ...Catalysing emerging smallholder pig value chains in Uganda to increase rural ...
Catalysing emerging smallholder pig value chains in Uganda to increase rural ...ILRI
 
Index-Based Livestock Insurance: Protecting pastoralists against drought-rela...
Index-Based Livestock Insurance: Protecting pastoralists against drought-rela...Index-Based Livestock Insurance: Protecting pastoralists against drought-rela...
Index-Based Livestock Insurance: Protecting pastoralists against drought-rela...ILRI
 
People, their livestock, livelihood and diseases: complexity of interrelation...
People, their livestock, livelihood and diseases: complexity of interrelation...People, their livestock, livelihood and diseases: complexity of interrelation...
People, their livestock, livelihood and diseases: complexity of interrelation...African Dairy Conference and Exhibition
 
Epidemiology for strategic control of neglected zoonoses
Epidemiology for strategic control of neglected zoonosesEpidemiology for strategic control of neglected zoonoses
Epidemiology for strategic control of neglected zoonosesILRI
 
Food safety in the era of COVID-19: Ensuring consumers’ trust
Food safety in the era of COVID-19: Ensuring consumers’ trustFood safety in the era of COVID-19: Ensuring consumers’ trust
Food safety in the era of COVID-19: Ensuring consumers’ trustILRI
 
Current and future animal vaccine research activities at ILRI
Current and future animal vaccine research activities at ILRICurrent and future animal vaccine research activities at ILRI
Current and future animal vaccine research activities at ILRIILRI
 
Knowledge to Action: ILRI’s Role in a Changing World
Knowledge to Action: ILRI’s Role in a Changing WorldKnowledge to Action: ILRI’s Role in a Changing World
Knowledge to Action: ILRI’s Role in a Changing WorldILRI
 
Knowledge to Action: ILRI’s Role in a Changing World
Knowledge to Action: ILRI’s Role in a Changing WorldKnowledge to Action: ILRI’s Role in a Changing World
Knowledge to Action: ILRI’s Role in a Changing WorldILRI
 
Global Burden of Animal Diseases: Ethiopia case study
Global Burden of Animal Diseases: Ethiopia case studyGlobal Burden of Animal Diseases: Ethiopia case study
Global Burden of Animal Diseases: Ethiopia case studyILRI
 
Centre for Tropical Livestock Genetics and Health (CTLGH)
Centre for Tropical Livestock Genetics and Health (CTLGH)Centre for Tropical Livestock Genetics and Health (CTLGH)
Centre for Tropical Livestock Genetics and Health (CTLGH)ILRI
 
Behavioural obstacles to vaccinations in livestock – Examples from sub-Sahara...
Behavioural obstacles to vaccinations in livestock – Examples from sub-Sahara...Behavioural obstacles to vaccinations in livestock – Examples from sub-Sahara...
Behavioural obstacles to vaccinations in livestock – Examples from sub-Sahara...ILRI
 

La actualidad más candente (20)

The use of Innovation Platforms to increase vaccination coverage against ende...
The use of Innovation Platforms to increase vaccination coverage against ende...The use of Innovation Platforms to increase vaccination coverage against ende...
The use of Innovation Platforms to increase vaccination coverage against ende...
 
The future of food safety in Africa: Research perspective
The future of food safety in Africa: Research perspectiveThe future of food safety in Africa: Research perspective
The future of food safety in Africa: Research perspective
 
Mapping the interface of poverty, emerging markets and zoonoses
Mapping the interface of poverty, emerging markets and zoonosesMapping the interface of poverty, emerging markets and zoonoses
Mapping the interface of poverty, emerging markets and zoonoses
 
Human health risks at the animal-human interface
Human health risks at the animal-human interface Human health risks at the animal-human interface
Human health risks at the animal-human interface
 
2 fara presentationghana raina
2 fara presentationghana raina2 fara presentationghana raina
2 fara presentationghana raina
 
Sustainable Agricultural Development for Food Security and Nutrition: What Ro...
Sustainable Agricultural Development for Food Security and Nutrition: What Ro...Sustainable Agricultural Development for Food Security and Nutrition: What Ro...
Sustainable Agricultural Development for Food Security and Nutrition: What Ro...
 
Value chain actors’ practices associated with the spread of African swine fev...
Value chain actors’ practices associated with the spread of African swine fev...Value chain actors’ practices associated with the spread of African swine fev...
Value chain actors’ practices associated with the spread of African swine fev...
 
Small ruminant value chain development in Horro, Ethiopia
Small ruminant value chain development in Horro, EthiopiaSmall ruminant value chain development in Horro, Ethiopia
Small ruminant value chain development in Horro, Ethiopia
 
Catalysing emerging smallholder pig value chains in Uganda to increase rural ...
Catalysing emerging smallholder pig value chains in Uganda to increase rural ...Catalysing emerging smallholder pig value chains in Uganda to increase rural ...
Catalysing emerging smallholder pig value chains in Uganda to increase rural ...
 
Index-Based Livestock Insurance: Protecting pastoralists against drought-rela...
Index-Based Livestock Insurance: Protecting pastoralists against drought-rela...Index-Based Livestock Insurance: Protecting pastoralists against drought-rela...
Index-Based Livestock Insurance: Protecting pastoralists against drought-rela...
 
People, their livestock, livelihood and diseases: complexity of interrelation...
People, their livestock, livelihood and diseases: complexity of interrelation...People, their livestock, livelihood and diseases: complexity of interrelation...
People, their livestock, livelihood and diseases: complexity of interrelation...
 
Epidemiology for strategic control of neglected zoonoses
Epidemiology for strategic control of neglected zoonosesEpidemiology for strategic control of neglected zoonoses
Epidemiology for strategic control of neglected zoonoses
 
Food safety in the era of COVID-19: Ensuring consumers’ trust
Food safety in the era of COVID-19: Ensuring consumers’ trustFood safety in the era of COVID-19: Ensuring consumers’ trust
Food safety in the era of COVID-19: Ensuring consumers’ trust
 
Current and future animal vaccine research activities at ILRI
Current and future animal vaccine research activities at ILRICurrent and future animal vaccine research activities at ILRI
Current and future animal vaccine research activities at ILRI
 
Knowledge to Action: ILRI’s Role in a Changing World
Knowledge to Action: ILRI’s Role in a Changing WorldKnowledge to Action: ILRI’s Role in a Changing World
Knowledge to Action: ILRI’s Role in a Changing World
 
Knowledge to Action: ILRI’s Role in a Changing World
Knowledge to Action: ILRI’s Role in a Changing WorldKnowledge to Action: ILRI’s Role in a Changing World
Knowledge to Action: ILRI’s Role in a Changing World
 
Global Burden of Animal Diseases: Ethiopia case study
Global Burden of Animal Diseases: Ethiopia case studyGlobal Burden of Animal Diseases: Ethiopia case study
Global Burden of Animal Diseases: Ethiopia case study
 
Centre for Tropical Livestock Genetics and Health (CTLGH)
Centre for Tropical Livestock Genetics and Health (CTLGH)Centre for Tropical Livestock Genetics and Health (CTLGH)
Centre for Tropical Livestock Genetics and Health (CTLGH)
 
Livestock value chains
Livestock value chains Livestock value chains
Livestock value chains
 
Behavioural obstacles to vaccinations in livestock – Examples from sub-Sahara...
Behavioural obstacles to vaccinations in livestock – Examples from sub-Sahara...Behavioural obstacles to vaccinations in livestock – Examples from sub-Sahara...
Behavioural obstacles to vaccinations in livestock – Examples from sub-Sahara...
 

Destacado (7)

Mumps
MumpsMumps
Mumps
 
Mumps
MumpsMumps
Mumps
 
Impact of Meat Industry on Dairy Industry
Impact of Meat Industry on Dairy IndustryImpact of Meat Industry on Dairy Industry
Impact of Meat Industry on Dairy Industry
 
Mumps
MumpsMumps
Mumps
 
Conventional methods of animal vaccine production
Conventional methods of animal vaccine productionConventional methods of animal vaccine production
Conventional methods of animal vaccine production
 
Mumps
MumpsMumps
Mumps
 
Viral vaccines 2
Viral vaccines 2Viral vaccines 2
Viral vaccines 2
 

Similar a Current and future animal vaccine research activities at ILRI

One Health and zoonoses projects at the International Livestock Research Inst...
One Health and zoonoses projects at the International Livestock Research Inst...One Health and zoonoses projects at the International Livestock Research Inst...
One Health and zoonoses projects at the International Livestock Research Inst...ILRI
 
One Health approach to address zoonotic and emerging infectious diseases and ...
One Health approach to address zoonotic and emerging infectious diseases and ...One Health approach to address zoonotic and emerging infectious diseases and ...
One Health approach to address zoonotic and emerging infectious diseases and ...ILRI
 
The One Health research-for-development agenda: Enhance holistic health of pe...
The One Health research-for-development agenda: Enhance holistic health of pe...The One Health research-for-development agenda: Enhance holistic health of pe...
The One Health research-for-development agenda: Enhance holistic health of pe...ILRI
 
The roles of livestock and farmed wildlife in preventing the next pandemic: C...
The roles of livestock and farmed wildlife in preventing the next pandemic: C...The roles of livestock and farmed wildlife in preventing the next pandemic: C...
The roles of livestock and farmed wildlife in preventing the next pandemic: C...ILRI
 
Vaccines and diagnostics—The case for regional One Health centres of excellence
Vaccines and diagnostics—The case for regional One Health centres of excellence Vaccines and diagnostics—The case for regional One Health centres of excellence
Vaccines and diagnostics—The case for regional One Health centres of excellence ILRI
 
ILRI’s key programs to address infectious diseases, areas requiring internati...
ILRI’s key programs to address infectious diseases, areas requiring internati...ILRI’s key programs to address infectious diseases, areas requiring internati...
ILRI’s key programs to address infectious diseases, areas requiring internati...ILRI
 
One Health and livestock: Capacity building and operationalization in the glo...
One Health and livestock: Capacity building and operationalization in the glo...One Health and livestock: Capacity building and operationalization in the glo...
One Health and livestock: Capacity building and operationalization in the glo...ILRI
 
The Global Plant Health Centre: Building a Surveillance and Knowledge System
The Global Plant Health Centre: Building a Surveillance and Knowledge SystemThe Global Plant Health Centre: Building a Surveillance and Knowledge System
The Global Plant Health Centre: Building a Surveillance and Knowledge SystemIAALD Community
 
International perspectives on One Health
International perspectives on One HealthInternational perspectives on One Health
International perspectives on One HealthILRI
 
Food safety policy in 9 African countries
Food safety policy in 9 African countriesFood safety policy in 9 African countries
Food safety policy in 9 African countriesILRI
 
Livestock in developing countries: Animal health challenges and opportunities
Livestock in developing countries: Animal health challenges and opportunities Livestock in developing countries: Animal health challenges and opportunities
Livestock in developing countries: Animal health challenges and opportunities ILRI
 
Aflatoxins: serious threat to food safety and food security But is it relate...
Aflatoxins: serious threat to food safety and food security  But is it relate...Aflatoxins: serious threat to food safety and food security  But is it relate...
Aflatoxins: serious threat to food safety and food security But is it relate...ILRI
 
Managing the health risks associated with agriculture: An overview of researc...
Managing the health risks associated with agriculture: An overview of researc...Managing the health risks associated with agriculture: An overview of researc...
Managing the health risks associated with agriculture: An overview of researc...ILRI
 
Innovations and incentives in agricultural research for poor countries
Innovations and incentives in agricultural research for poor countries Innovations and incentives in agricultural research for poor countries
Innovations and incentives in agricultural research for poor countries ILRI
 
Knowledge to Action: ILRI’s role in pro-poor livestock research for development
Knowledge to Action: ILRI’s role in pro-poor livestock research for developmentKnowledge to Action: ILRI’s role in pro-poor livestock research for development
Knowledge to Action: ILRI’s role in pro-poor livestock research for developmentILRI
 
Reducing the impact of infectious disease on poultry production in Ethiopia
Reducing the impact of infectious disease on poultry production in EthiopiaReducing the impact of infectious disease on poultry production in Ethiopia
Reducing the impact of infectious disease on poultry production in EthiopiaILRI
 
CGIAR research to combat mycotoxin impact in Africa
CGIAR research to combat mycotoxin impact in AfricaCGIAR research to combat mycotoxin impact in Africa
CGIAR research to combat mycotoxin impact in AfricaILRI
 
Livestock vaccines: Development and market access
Livestock vaccines: Development and market accessLivestock vaccines: Development and market access
Livestock vaccines: Development and market accessExternalEvents
 
African Swine Fever (ASF) control: An entry point for enhancing human welfare...
African Swine Fever (ASF) control: An entry point for enhancing human welfare...African Swine Fever (ASF) control: An entry point for enhancing human welfare...
African Swine Fever (ASF) control: An entry point for enhancing human welfare...ILRI
 
Foot and mouth disease preventive and epidemiological aspects
Foot and mouth disease preventive and epidemiological aspectsFoot and mouth disease preventive and epidemiological aspects
Foot and mouth disease preventive and epidemiological aspectsBhoj Raj Singh
 

Similar a Current and future animal vaccine research activities at ILRI (20)

One Health and zoonoses projects at the International Livestock Research Inst...
One Health and zoonoses projects at the International Livestock Research Inst...One Health and zoonoses projects at the International Livestock Research Inst...
One Health and zoonoses projects at the International Livestock Research Inst...
 
One Health approach to address zoonotic and emerging infectious diseases and ...
One Health approach to address zoonotic and emerging infectious diseases and ...One Health approach to address zoonotic and emerging infectious diseases and ...
One Health approach to address zoonotic and emerging infectious diseases and ...
 
The One Health research-for-development agenda: Enhance holistic health of pe...
The One Health research-for-development agenda: Enhance holistic health of pe...The One Health research-for-development agenda: Enhance holistic health of pe...
The One Health research-for-development agenda: Enhance holistic health of pe...
 
The roles of livestock and farmed wildlife in preventing the next pandemic: C...
The roles of livestock and farmed wildlife in preventing the next pandemic: C...The roles of livestock and farmed wildlife in preventing the next pandemic: C...
The roles of livestock and farmed wildlife in preventing the next pandemic: C...
 
Vaccines and diagnostics—The case for regional One Health centres of excellence
Vaccines and diagnostics—The case for regional One Health centres of excellence Vaccines and diagnostics—The case for regional One Health centres of excellence
Vaccines and diagnostics—The case for regional One Health centres of excellence
 
ILRI’s key programs to address infectious diseases, areas requiring internati...
ILRI’s key programs to address infectious diseases, areas requiring internati...ILRI’s key programs to address infectious diseases, areas requiring internati...
ILRI’s key programs to address infectious diseases, areas requiring internati...
 
One Health and livestock: Capacity building and operationalization in the glo...
One Health and livestock: Capacity building and operationalization in the glo...One Health and livestock: Capacity building and operationalization in the glo...
One Health and livestock: Capacity building and operationalization in the glo...
 
The Global Plant Health Centre: Building a Surveillance and Knowledge System
The Global Plant Health Centre: Building a Surveillance and Knowledge SystemThe Global Plant Health Centre: Building a Surveillance and Knowledge System
The Global Plant Health Centre: Building a Surveillance and Knowledge System
 
International perspectives on One Health
International perspectives on One HealthInternational perspectives on One Health
International perspectives on One Health
 
Food safety policy in 9 African countries
Food safety policy in 9 African countriesFood safety policy in 9 African countries
Food safety policy in 9 African countries
 
Livestock in developing countries: Animal health challenges and opportunities
Livestock in developing countries: Animal health challenges and opportunities Livestock in developing countries: Animal health challenges and opportunities
Livestock in developing countries: Animal health challenges and opportunities
 
Aflatoxins: serious threat to food safety and food security But is it relate...
Aflatoxins: serious threat to food safety and food security  But is it relate...Aflatoxins: serious threat to food safety and food security  But is it relate...
Aflatoxins: serious threat to food safety and food security But is it relate...
 
Managing the health risks associated with agriculture: An overview of researc...
Managing the health risks associated with agriculture: An overview of researc...Managing the health risks associated with agriculture: An overview of researc...
Managing the health risks associated with agriculture: An overview of researc...
 
Innovations and incentives in agricultural research for poor countries
Innovations and incentives in agricultural research for poor countries Innovations and incentives in agricultural research for poor countries
Innovations and incentives in agricultural research for poor countries
 
Knowledge to Action: ILRI’s role in pro-poor livestock research for development
Knowledge to Action: ILRI’s role in pro-poor livestock research for developmentKnowledge to Action: ILRI’s role in pro-poor livestock research for development
Knowledge to Action: ILRI’s role in pro-poor livestock research for development
 
Reducing the impact of infectious disease on poultry production in Ethiopia
Reducing the impact of infectious disease on poultry production in EthiopiaReducing the impact of infectious disease on poultry production in Ethiopia
Reducing the impact of infectious disease on poultry production in Ethiopia
 
CGIAR research to combat mycotoxin impact in Africa
CGIAR research to combat mycotoxin impact in AfricaCGIAR research to combat mycotoxin impact in Africa
CGIAR research to combat mycotoxin impact in Africa
 
Livestock vaccines: Development and market access
Livestock vaccines: Development and market accessLivestock vaccines: Development and market access
Livestock vaccines: Development and market access
 
African Swine Fever (ASF) control: An entry point for enhancing human welfare...
African Swine Fever (ASF) control: An entry point for enhancing human welfare...African Swine Fever (ASF) control: An entry point for enhancing human welfare...
African Swine Fever (ASF) control: An entry point for enhancing human welfare...
 
Foot and mouth disease preventive and epidemiological aspects
Foot and mouth disease preventive and epidemiological aspectsFoot and mouth disease preventive and epidemiological aspects
Foot and mouth disease preventive and epidemiological aspects
 

Más de ILRI

How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...ILRI
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...ILRI
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...ILRI
 
A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...ILRI
 
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...ILRI
 
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseasesPreventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseasesILRI
 
Preventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne diseasePreventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne diseaseILRI
 
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistancePreventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistanceILRI
 
Food safety research in low- and middle-income countries
Food safety research in low- and middle-income countriesFood safety research in low- and middle-income countries
Food safety research in low- and middle-income countriesILRI
 
Food safety research LMIC
Food safety research LMICFood safety research LMIC
Food safety research LMICILRI
 
The application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern AfricaThe application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern AfricaILRI
 
One Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the fieldOne Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the fieldILRI
 
Reservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in UgandaReservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in UgandaILRI
 
Minyoo ya mbwa
Minyoo ya mbwaMinyoo ya mbwa
Minyoo ya mbwaILRI
 
Parasites in dogs
Parasites in dogsParasites in dogs
Parasites in dogsILRI
 
Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...ILRI
 
Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...ILRI
 
Livestock in the agrifood systems transformation
Livestock in the agrifood systems transformationLivestock in the agrifood systems transformation
Livestock in the agrifood systems transformationILRI
 
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...ILRI
 
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farmsPractices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farmsILRI
 

Más de ILRI (20)

How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
 
A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...
 
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
 
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseasesPreventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
 
Preventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne diseasePreventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne disease
 
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistancePreventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
 
Food safety research in low- and middle-income countries
Food safety research in low- and middle-income countriesFood safety research in low- and middle-income countries
Food safety research in low- and middle-income countries
 
Food safety research LMIC
Food safety research LMICFood safety research LMIC
Food safety research LMIC
 
The application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern AfricaThe application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern Africa
 
One Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the fieldOne Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the field
 
Reservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in UgandaReservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in Uganda
 
Minyoo ya mbwa
Minyoo ya mbwaMinyoo ya mbwa
Minyoo ya mbwa
 
Parasites in dogs
Parasites in dogsParasites in dogs
Parasites in dogs
 
Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...
 
Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...
 
Livestock in the agrifood systems transformation
Livestock in the agrifood systems transformationLivestock in the agrifood systems transformation
Livestock in the agrifood systems transformation
 
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
 
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farmsPractices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
 

Último

VIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C PVIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C PPRINCE C P
 
Spermiogenesis or Spermateleosis or metamorphosis of spermatid
Spermiogenesis or Spermateleosis or metamorphosis of spermatidSpermiogenesis or Spermateleosis or metamorphosis of spermatid
Spermiogenesis or Spermateleosis or metamorphosis of spermatidSarthak Sekhar Mondal
 
DIFFERENCE IN BACK CROSS AND TEST CROSS
DIFFERENCE IN  BACK CROSS AND TEST CROSSDIFFERENCE IN  BACK CROSS AND TEST CROSS
DIFFERENCE IN BACK CROSS AND TEST CROSSLeenakshiTyagi
 
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls Agency
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls AgencyHire 💕 9907093804 Hooghly Call Girls Service Call Girls Agency
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls AgencySheetal Arora
 
Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )aarthirajkumar25
 
Chemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdfChemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdfSumit Kumar yadav
 
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Sérgio Sacani
 
Botany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdfBotany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdfSumit Kumar yadav
 
STERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCE
STERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCESTERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCE
STERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCEPRINCE C P
 
Orientation, design and principles of polyhouse
Orientation, design and principles of polyhouseOrientation, design and principles of polyhouse
Orientation, design and principles of polyhousejana861314
 
Disentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTDisentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTSérgio Sacani
 
Chromatin Structure | EUCHROMATIN | HETEROCHROMATIN
Chromatin Structure | EUCHROMATIN | HETEROCHROMATINChromatin Structure | EUCHROMATIN | HETEROCHROMATIN
Chromatin Structure | EUCHROMATIN | HETEROCHROMATINsankalpkumarsahoo174
 
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRStunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRDelhi Call girls
 
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...Sérgio Sacani
 
Broad bean, Lima Bean, Jack bean, Ullucus.pptx
Broad bean, Lima Bean, Jack bean, Ullucus.pptxBroad bean, Lima Bean, Jack bean, Ullucus.pptx
Broad bean, Lima Bean, Jack bean, Ullucus.pptxjana861314
 
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPirithiRaju
 
9654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 6000
9654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 60009654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 6000
9654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 6000Sapana Sha
 

Último (20)

VIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C PVIRUSES structure and classification ppt by Dr.Prince C P
VIRUSES structure and classification ppt by Dr.Prince C P
 
Spermiogenesis or Spermateleosis or metamorphosis of spermatid
Spermiogenesis or Spermateleosis or metamorphosis of spermatidSpermiogenesis or Spermateleosis or metamorphosis of spermatid
Spermiogenesis or Spermateleosis or metamorphosis of spermatid
 
DIFFERENCE IN BACK CROSS AND TEST CROSS
DIFFERENCE IN  BACK CROSS AND TEST CROSSDIFFERENCE IN  BACK CROSS AND TEST CROSS
DIFFERENCE IN BACK CROSS AND TEST CROSS
 
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls Agency
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls AgencyHire 💕 9907093804 Hooghly Call Girls Service Call Girls Agency
Hire 💕 9907093804 Hooghly Call Girls Service Call Girls Agency
 
Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )Recombination DNA Technology (Nucleic Acid Hybridization )
Recombination DNA Technology (Nucleic Acid Hybridization )
 
The Philosophy of Science
The Philosophy of ScienceThe Philosophy of Science
The Philosophy of Science
 
Chemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdfChemistry 4th semester series (krishna).pdf
Chemistry 4th semester series (krishna).pdf
 
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
Discovery of an Accretion Streamer and a Slow Wide-angle Outflow around FUOri...
 
Botany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdfBotany 4th semester series (krishna).pdf
Botany 4th semester series (krishna).pdf
 
STERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCE
STERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCESTERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCE
STERILITY TESTING OF PHARMACEUTICALS ppt by DR.C.P.PRINCE
 
Orientation, design and principles of polyhouse
Orientation, design and principles of polyhouseOrientation, design and principles of polyhouse
Orientation, design and principles of polyhouse
 
Disentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOSTDisentangling the origin of chemical differences using GHOST
Disentangling the origin of chemical differences using GHOST
 
Chromatin Structure | EUCHROMATIN | HETEROCHROMATIN
Chromatin Structure | EUCHROMATIN | HETEROCHROMATINChromatin Structure | EUCHROMATIN | HETEROCHROMATIN
Chromatin Structure | EUCHROMATIN | HETEROCHROMATIN
 
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCRStunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
Stunning ➥8448380779▻ Call Girls In Panchshil Enclave Delhi NCR
 
9953056974 Young Call Girls In Mahavir enclave Indian Quality Escort service
9953056974 Young Call Girls In Mahavir enclave Indian Quality Escort service9953056974 Young Call Girls In Mahavir enclave Indian Quality Escort service
9953056974 Young Call Girls In Mahavir enclave Indian Quality Escort service
 
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
All-domain Anomaly Resolution Office U.S. Department of Defense (U) Case: “Eg...
 
Broad bean, Lima Bean, Jack bean, Ullucus.pptx
Broad bean, Lima Bean, Jack bean, Ullucus.pptxBroad bean, Lima Bean, Jack bean, Ullucus.pptx
Broad bean, Lima Bean, Jack bean, Ullucus.pptx
 
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdfPests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
Pests of cotton_Borer_Pests_Binomics_Dr.UPR.pdf
 
CELL -Structural and Functional unit of life.pdf
CELL -Structural and Functional unit of life.pdfCELL -Structural and Functional unit of life.pdf
CELL -Structural and Functional unit of life.pdf
 
9654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 6000
9654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 60009654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 6000
9654467111 Call Girls In Raj Nagar Delhi Short 1500 Night 6000
 

Current and future animal vaccine research activities at ILRI

  • 1. Current  and  future  animal  vaccine   research  ac2vi2es  at  ILRI   Vaccine  Biosciences   Interna.onal  Livestock  Research  Ins.tute   1st  July  2014   Contact:    ilri-­‐vaccines@cgiar.org  
  • 2. ILRI  Nairobi  campus   A lab in Africa at the foot of Kenya’s Ngong Hills ★  
  • 3. Google’s  view  of  the  ILRI  campus  -­‐   laboratory  and  farm  facili2es   BecA  -­‐ ILRI  Labs   Secure   Animal   Disease   Facility   Farm  and   paddocks  
  • 4. Importance  of  animal  health  research  in   the  developing  world   Ø  Livestock  offer  a  powerful  pathway  out  of  poverty  for  ~750  million  poor  farmers  in   South  Asia  and  Africa  by  providing  nutri2onal  and  economic  security.   Ø  Infec2ous  livestock  diseases  feature  prominently  among  the  constraints  faced  by   livestock  agriculture.   u  Endemic  diseases   u  Epidemic/pandemic  diseases   u  Trans-­‐boundary  diseases   u  Emerging  and  re-­‐emerging  diseases   u  Zoono2c  diseases  and  food  safety       Ø  Vaccines  are  the  most  effec2ve  disease  interven2on  deployed  especially  in   developing  countries  but  most  vaccines  if  they  exist  are  sub-­‐op2mal.   Ø  For  many  reasons  diseases  are  neglected  problems  in  affected  countries,  a  situa2on   exacerbated  by  a  general  lack  of  investment,  vaccine  R  &  D  and  manufacturing   capacity.    
  • 5. List  of  current  ILRI  high  priority   diseases  targeted  for  control   Ø  African  swine  fever  (ASF)  –  swine   u  African  disease  threatens  the  global  $150  billion/year  pig  industry   Ø  Contagious  bovine  pleuropneumonia  (CBPP)  –  caZle   u  Regional  losses  to  CBPP  amount  to  ~  $60  million/year     Ø  East  Coast  fever  (ECF)  –  caZle   u  Regional  losses  exceed  $300  million/year;  kills  ~  1million  caZle/year     Ø  Peste  de  pe2ts  ruminants  (PPR)  –  small  ruminants   u  Losses  in  Kenya  alone  amount  to  ~  $13  million/year       Ø  Ri_  Valley  Fever  (RVF)  –  small  ruminants,  caZle  and  human   u  2006/7  outbreak  in  Kenya  cost  ~  $30  million   o   309  human  cases  in  Kenya,  Somalia  and  Tanzania;  140  deaths   Vaccines  save  lives  and  livestock  and  contribute  to  food  security   and  poverty  allevia5on  
  • 6. ILRI’s  vaccine  R  &  D  pathway  to  impact   Marke&ng) Market) assessment) Proof0of0principle) laboratory/field) Clinical) development) Manufacturing) Product)development)partnerships))Research)partnerships) Disease)selec&on) Lead)vaccine)molecules) Vaccine)op&miza&on) Scaled0up)produc&on) Delivery) NARS,&Universi.es,&ARIs,&Regional&and& sub7regional&R&D&organiza.ons,&PPP&& Target)product)profile) Phase)I,)II,)III)trials) Regulatory)processes) Con&nued)monitoring) PPP,&Private&sector,&Regional&networks,&FAO,&OIE,&PANVAC,& AU7IBAR,&NARs,&NGOs& Ø  ILRI’s  compara2ve  advantage  is  mainly  in  the  discovery  phase  to  proof-­‐of-­‐principle   under  laboratory  and  field  condi2ons.   Ø  Different  entry  points  in  pathway  depending  on  disease  targeted  for  control.   u  Improvement  of  exis2ng  vaccines   u  Development  of  subunit  vaccines   u  Laboratory  and  field  based  diagnos2cs  
  • 7. Vaccines  save  lives  and  livestock  and  contribute  to  food  security   and  poverty  allevia5on   ILVAC  –  plan2ng  the  orchard   BASIC&RESEARCH& & Increase&our&knowledge&base& & “Knowledge&lays&the&founda>on& for&science&&&innova>on”& APPLIED&RESEARCH&! Develop&new&vaccines&&&diagnos>cs& ! “Vaccines&are&highly&effec>ve&an>I disease&interven>ons”& ! Study&hostIpathogen&interac>ons& & ! Map&immune&responses&to&infec>on& ! Characterize&pathogen&virulence& ! Inves>gate&disease&epidemiology& ! Dissect&pathogen&biology&&& diversity& ! Iden>fy&candidate&vaccine&and& diagnos>c&molecules& ! Assess&candidate&vaccine&molecules& ! Assess&aMenuated&pathogens& ! ThermoIstabilize&vaccines& ! Develop&easy&to&use&diagnos>c&tools& ! Assess&different&vaccina>on& systems& ! Facilitate&transla>on&of&research& outputs&to&commercial&products&
  • 8. Vaccines  save  lives  and  livestock  and  contribute  to  food  security   and  poverty  allevia5on   ILVAC  -­‐  a  vaccine  plaeorm   An#body(technologies( Vaccine(technologies( Cellular(technologies( Diagnos#c(technologies( Genomic(technologies( Contagious(bovine( pleuropneumonia(( East(Coast(fever( African(swine(fever(( Consor#a(for(research(&(product(development(and(capacity(development( Private(sector( GALVmed( CRPs( NARS( InterEgov( agencies( Improved(vaccines(and( diagnos#c(tools( Peste(des(pe##s(ruminants(( RiF(Valley(fever( Infec#ous(disease( research:(basic(&(applied( ILVAC(–(a(vaccine(plaIorm(
  • 9. A  poreolio  of  innova2on  and  vaccine   related  technology  plaeorms   Ø  Op2mizing  exis2ng  vaccines   u  Thermostabiliza2on  of  aZenuated  viral  vaccines   u  Establishing  quality  control  and  process  improvement       Ø  Reverse  vaccinology  and  immunology   u  Iden2fica2on  of  candidate  vaccine  an2gens   u  Assessing  protein  and  gene-­‐based    vaccine  formula2ons       Ø  Pathogen  &  livestock  genomics   u  Host  and  pathogen  gene  expression  profiles   u  Pathogen  popula2on  structure       Ø  Synthe2c  genomics   u  Manipula2ng  bacterial  genomes   u  AZenua2ng  viruses  by  genome  engineering   Yeast&with&M.#myc&LC& genome& (Delete&puta5ve&& virulence&factors)& Less&virulent&M.#myc&LC& ACTGGTACGTAGGGCATCGA TCGACATGATAGAGCATATA GCATGACGATGCGATCGACA GTCGACAGCTGACAGCTGAG GGTGACACCAGCTGCCAGCT GGACCACCATTAGGACAGAT GACCACACACAAATAGACGA TTAGGACCAGATGAGCCACA TTTTAGGAGGACACACACCA Bioinformatics tools Predict gene sequences and list candidate vaccine antigens Test experimental vaccine Clone genes of vaccine interest (100’s of genes) Filter genes via immunological assays Pathogen genome mining (1000’s of genes) Molecular immunology tools to assess immune responses in cattle (10’s genes)
  • 10. A  research  center  of  excellence  -­‐        a  vaccine  ini2a2ve  at  ILRI   Ø  Exploit  high-­‐end  science  and  technologies  to  accelerate  vaccine  development   Ø  Support  each  disease  focus  with  program  level  funding     Ø  Develop  global  research  and  product  development  partnerships     Ø  Provide  fellowships  for  training  and  scien2fic  leadership  in  developing  countries   Ø  Help  build  ins2tu2onal  capacity  for  vaccine  R  &  D  in  developing  countries     Ø  S2mulate  learning  between  veterinary  and  human  vaccine  communi2es     Ø  Provide  an  incubator  type  approach  to  leverage  ILRI  facili2es  
  • 11. Why  ILRI  for  a  vaccine  ini2a2ve?   Ø  Modern  bio-­‐molecular  laboratory  facili2es   Ø   Secure  animal  disease  facili2es  for  large    and  small  animals     Ø   Loca2on  and  access  to  diverse  pathogens   indigenous  livestock  and  wildlife     Ø  Track  record  in  teaching,  training  and  capacity  building     Ø  Ongoing  projects   o  Vaccine  development  against  neglected  livestock  diseases   o  One  Health  and  agricultural  associated  human  diseases   o  Highly  relevant  field  research   Ø  Networks  with  academic,  na2onal,  regional  and  interna2onal  organiza2ons,   including  the  public,  private  and  development  sectors    
  • 12. The  ILRI  Vaccine  Biosciences  group  
  • 13. The  presenta.on  has  a  Crea.ve  Commons  licence.  You  are  free  to  re-­‐use  or  distribute  this  work,  provided  credit  is  given  to  ILRI.   ilri.org Box 30709, Nairobi 00100, Kenya Phone: + 254 20 422 3000 Fax: +254 20 422 3001 Email: ILRI-Kenya@cgiar.org Box 5689,Addis Ababa, Ethiopia Phone: +251 11 617 2000 Fax: +251 11 617 2001 Email: ILRI-Ethiopia@cgiar.org other offices China • India • Mali Mozambique • Nigeria • Tanzania Thailand • Uganda • Vietnam Better lives through livestock ILRI is a member of the CGIAR Consortium BeKer  lives  through  livestock   ilri.org