A presentation prepared by Obura E., Midega C., Zeyaur K., Pickett J. and Masiga D. for the ASARECA/ILRI Workshop on Mitigating the Impact of Napier Grass Smut and Stunt Diseases, Addis Ababa, June 2-3, 2010.
Boost Fertility New Invention Ups Success Rates.pdf
Napier stunt disease is transmitted by a leafhopper vector Maiestas (=Recilia) banda in Western Kenya
1. 1 Obura E, 1 Midega C, 1 Khan ZR, 2 Pickett J and 1 Masiga D 1 ICIPE: International centre of Insect Physiology and Ecology 2 Rothamsted Research, Harpenden, Hertfordshire AL5 2JQ, UK Napier stunt disease is transmitted by a leafhopper vector Maiestas (=Recilia) banda in Western Kenya Presented at the ASARECA/ILRI Workshop on Mitigating the Impact of Napier Grass Smut and Stunt Diseases, Addis Ababa, June 2-3, 2010
2. Model of sustainable small-holder mixed farming at ICIPE, Mbita Organic Manure Non-chemical cereal pest management Enough fodder for livestock Soil conservation Increased maize, milk and meat production
3. Napier stunt disease Which leafhopper species is transmitting Napier stunt disease?
4. ICIPE collected 22 plant sucking Hoppers from Bungoma, Busia, Kitale and Suba areas, Kenya
10. MBS Transmitted phytoplasma formed clade with NGS NGS-E BrGWL BGWL SGGS SCGS SCWL RYD NGS-K NGS-U NGS-Ex NGS-D NGS-Recilia SCYL BD ROL
11. The Genus Maiestas (= Recilia ) 23 Species Afrotropical R. mica: blast disease phytoplasma in oil palm seedlings (WA) R. dorsalis: rice dwarf phytoreovirus, rice gall dwarf phytoreovirus, and rice orange leaf (ROL) phytoplasma (ASIA)
12. ICIPE has Barcoded Recilia banda >Recilia banda COI partial sequence atactttatcttagggagatgaactagaatcttggggatttctttaagaagattaatccgatttgaaatcaattcaatagatacaatctttgaagaaaaaagatcttataatattttaatcacttctcatgcaattattataatcttttttttagtaatacctgtaactataggtggatttggaaattgattagttcctttaatattaataactcctgacatagcttttccacgattaaataatttcaggttttgaattttactaccttctttaataatatttataagaagaataatattaaaaactggtgtaatagcaggatgaacaatttaccctcctttaacattacttaacagccatccagattactcaatagaattaactatttttaggcttcatttagcaggaatttcgtcaattttgagttcaattaattttataacaactacaattaacataagatccgtaaaatttataaaaattccattatttgtatgatcaattaattttactgctattttattaattttaacattgcctgtactagccggagcaattactatattattgtttgatcgaaattttaacacatcattttatgaccctacaggaagaggagatccaaggatgcagag For full details please contact authors
13.
14. Life cycle of NSD in the region Recilia banda (1-3 days) (≥5 mins) (7-10 days)
15. R. Banda survives and breed well on diseased plants The phytoplasma seems to confer survival advantage to the insect
16.
17. There is up to 60% infected insects in nearby healthy plots after Rouging diseased plants by farmers Up to 40% infected insects collected in healthy canopy after a farm activity (walking, weeding) Eggs or Nymphs and adults are disseminated by farmers with Napier grass seed canes R. banda dispersal
18. Loop mediated isothermal amplifcation of DNA for rapid detection of phytoplasma M + - 1 2 3 4 5 6 7 8 M - + 1 2 3 4 5 6 7 8 A: Symptomatic B: Assymptomatic/-PCR M - + 1 2 3 4 5 6 7 8 M + - 1 2 3 4 5 6 7 8 LAMP gene target and Primers Assay Serial dilutions of DNA extracted from test plant Initial DNA 1:10 2 1:10 4 1:10 6 Nested PCR + + - - LAMP + + + -
19. 30 cultivars are being screened for phytoplasma resistance at ICIPE, Mbita
20. 18 cultivars confirmed susceptible Known Germplasm Farmer selected For full data contact the authors For full data contact the authors Variety Name Resistant/Susceptible 1. Kakamega 1 S 2. Kakamega 2 S 3. Kakamega3 S 4. Kakamega5 S 5. Kakamega8 S 6. Ex Bokole S 7. French Cameroon S 8. Pakistan Hybrid S 9. Ex Matuga S 10. Ex-Mariakani S 11. Clone 13 S 12. Congo Kinshasha S 13. Gold Coast ongoing 14. Uganda Border S 15. Uganda L14 S 16. Nigeria 14 S 17. Nairobi L8 ongoing 18. Machakos Hairless S 19. South Africa L3 ongoing 20. Gold Coast Ongoing 21. Malawi Ongoing 22. Bana grass S Variety Name Resistant/Susceptible BV S BFTC Ongoing RT1 Ongoing RT2 Ongoing LO Ongoing OK Ongoing O2 Ongoing JO Ongoing
21. 17 Wild host grasses are being screened for R. banda survival and phytoplasma transmission 1. Cynodon dactylon 2. Digitaria scalarum 3. Echinochloa pyramidalis 4. Cenchrus ciliaris 5. Eragrostis superba 6. Setaria incrisata 7. Sporobolus pyramidalis 8. Eleusine indica 9. Panicum maximum 10. Heteropogon contortus 11. Hyperrhenia rufa 12. Bathrochloa bladhi 13. Bathrochloa insculpta 14. Themeda triandra 15. Dactyloctenium aegyptum 16. Sorghum sudanensis For full data contact the authors
22. Phytoplasma diseased Cynodon dactylon in Busia area, western Kenya (Obura et al., NDR, 2010)
23. C. dactylon is Common/important grass for turf and wild rangeland in eastern Africa
24. MS-Minimal survival (1 week) S&B-Survival and Breeding P-Successful phytoplasma transmission NS-No survival 7 cereals have been screened for R. banda survival and NSD transmission For full data contact the authors Common Name Scientific Name Survival Maize Zea mays NS Sugarcane Sacharum sp MS,P Pearl Millet Pennisetum glaucum S&B, P Rice Oryzae sativa MS,P Wheat Triticum aestivum NS Sorghum Sorghum vulgare NS Finger Millet Eleusine corocana NS
25. 3/12 pearl milet samples infected with phytoplasma M - + 1 2 3 4 5 6 7 8 9 10 11 12 R. Banda breeds and transmit phytoplasma to Pearl millet For full data contact the authors