SlideShare a Scribd company logo
1 of 24
Marker development for
mapping
Ravi Koppolu
RG: Plant Architecture
IPK, Gatersleben
Outline
 Few concepts
 Different types of molecular markers and applications
 Marker development for gene mapping
Exon 1
5‘ 3‘
5‘-UTR
Start codon:
ATG
Intron 1Promoter
3‘-UTR
I 2
Stop codon:
TAG
TAA
TGA
Exon 3
Genomic DNA (gDNA)  mRNA  Protein
Exon 2
genomic DNA
Transcr.
Start
Start:
ATG
Stop:
TAG
TAA
TGA
ORF (open reading frame) coding sequence
Translation
Protein
Poly(A)A..A
mature mRNA
Transcription & Post
transcriptional modification
Slide from Dr. Thorsten Schnurbusch
Polymorphism?
Is the ability to distinguish two or more individuals
The variation shown here is due to four different alleles
at a particular gene.
Molecular markers can identify sequence polymorphisms among two or more
individuals which may result in the change of phenotype.
vrs4.k TGGTTGCAGCGGCCACGACACCGGGGGC-GGGGCGCCGTGCGCTGCGTG :Mutant allele
MFB104 TGGTTGCAGCGGCCACGACACCGGGGGCCGGGGCGCCGTGCGCTGCGTG :Wild allele
2-rowed spike 6-rowed spike
Subsequently, genetic
variation at DNA aroused
due to mutation will cause
variation in protein
Protein
markers
Mutation
Mutation arises genetic
variation at the DNA level
DNA
markers
A sequence of DNA or protein that can be screened to reveal key
attributes of its state or composition and thus used to reveal genetic
variation
Molecular marker
Genomic DNA mutations can be classified into
GATCCGAGTATCGCAATTAGCA
GATCCGAGTGTCGCAATTAGCA
Base substitution
GATCCGAGTATCGCATGCATTAGCA
GATCCGAGTA ̶ ̶ ̶ ̶ ̶ ̶ ̶ ̶ ̶ ATTAGCA
Deletion
GATCCGAGTATCGCAATTAGCA
GATCCGAGTATCGCAGCATTAGCA
Insertion
GATCCGAGTATCGCAATTAGCA
GATCCGAGTATCTCGCAATTAGCA
Duplication
GATCCGAGTATCGCAATTAGCA
GATGCCAGTATCGCAATTAGCA
Inversion
Molecular marker types
Co-dominant marker systems
Restriction Fragment Length Polymorphisms (RFLPs)
Simple sequence repeats (SSRs)
SNP based marker systems
Dominant marker systems
Random amplified polymorphic DNAs (RAPD)
Amplified fragment length polymorphism (AFLP)
Diversity arrays technology (DArT)
Co-dominant vs. Dominant marker systems
Collard et al. 2005; Euphytica
Co-dominant marker Dominant marker
Co-dominant markers follow Mendelian inheritance pattern
Simple sequence repeats (SSRs)
SSRs contain tandem repeated single, double, triple nucleotides several times
Allelic variants differ in terms of number of repeats
Single nucleotide polymorphisms (SNPs)
 A mutation that causes single base change is SNP
 Most of them don't have a phenotypic effect
 SNPs can be alleles of a particular gene
 SNPs are most abundant types of DNA variation found among individuals
of same species
Applications of molecular markers
 Germplasm identification, Classification
 Genetic diversity/Relatedness
 Selection of parents for making wide crosses
 Development of molecular linkage maps
 Marker assisted selection
 Genomic selection
 Map-Based cloning of genes
Synteny enables to recruit markers from related species
Close et al. 2010; BMC Genomics
Mayer et al. 2011, Pl. Cell
BLAST against
barley EST’s
Flank introns/UTRs
with primers
viroBLAST
against barley
contigs
Resequence
SNP
Length
polymorphism
CAPS
dCAPS
Genotyping
on Agarose
Syntenic/Colinear
regions
Marker development procedure at AG PBP
Resources for our Marker development
workshop
Genome Zippers
Provide information on putative linear gene order for ̴86% barley genes based on synteny
with rice, sorghum and Brachypodium.
Mayer et al. Plant Physiol, 2009
Available at
http://mips.helmholtz-muenchen.de/plant/triticeae/barleyDisclaimerGZ.jsp
A snapshot of Genome Zipper
Syntenic cereal sequence databases
http://rice.plantbiology.msu.edu/annotation_pseudo_current.shtml
http://www.brachypodium.org/
Barley viroBLAST
Barley viroBLAST contains sequence data like
1.) 28X Illumina shot gun reads based on Morex
2.) Sequenced BACs
3.) Sorted chromosome sequences
4.) Full length cDNA sequences
http://webblast.ipk-gatersleben.de/barley/index.php
BLAST output with the barley viroBLAST sequence as query against barley EST database
The sequence/s from viroBLAST can be BLASTed against barley ESTs to
identify Exon-Intron boundaries
Primer design
 Primers designed to span boundaries
of two exonic regions or to the UTRs
 Primers can be picked manually or by
using software’s like primer3
 GC content of a primer pair should better be >=30%
 Avoid having multiple A’s or T’s at the 3’end.
 Check whether primers are forming any secondary structures
or dimers
 Better to have overlapping Tm for different primer pairs
 If designed manually don't forget to reverse complement the
reverse primer
Stem loops Dimers
Resequencing of primer pairs
Resequence the primer pairs in the parents of interest to identify sequence
polymorphisms.
Sequence analysis will be demonstrated during the workshop
Snapshot showing SNPs and deletions identified after resequencing in parents
Development of CAPS and dCAPS markers
CAPS: Cleaved Amplified Polymorphic sequence
In principle CAPS is similar to RFLP except that a shorter PCR amplified product with
known SNPs is digested with restriction enzymes instead of whole genomic DNA.
Contd….
dCAPS: Derived Cleaved Amplified Polymorphic sequence
In dCAPS assay mismatches in PCR primers are introduced to create restriction
endonuclease polymorphism based on the target mutation.
BclI recognition site:
CC(N)7GG
Web links for Marker development
Brachypodium database:
http://www.brachypodium.org/
Rice database
http://rice.plantbiology.msu.edu/annotation_pseudo_current.shtml
Rice ID Converter
http://rapdb.dna.affrc.go.jp/tools/converter
Barley viroBLAST
http://webblast.ipk-gatersleben.de/barley/viroblast.php
NCBI BLAST
http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome
IDT manual Primer design
http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/Default.aspx
http://www.basic.northwestern.edu/biotools/oligocalc.html
Primer3
http://frodo.wi.mit.edu/primer3/
Reverse complement generator
http://www.bioinformatics.org/sms/rev_comp.html
Clustalw
http://www.ebi.ac.uk/Tools/msa/clustalw2/
Nebcutter
http://tools.neb.com/NEBcutter2/
dCAPS finder
http://helix.wustl.edu/dcaps/dcaps.html

More Related Content

What's hot

DNA Markers Techniques for Plant Varietal Identification
DNA Markers Techniques for Plant Varietal Identification DNA Markers Techniques for Plant Varietal Identification
DNA Markers Techniques for Plant Varietal Identification Senthil Natesan
 
Aflp & rflp (bikash kumar singh)
Aflp & rflp (bikash kumar singh)Aflp & rflp (bikash kumar singh)
Aflp & rflp (bikash kumar singh)Bikash Singh
 
Markers: Based on hybridization and PCR
Markers: Based on hybridization and PCRMarkers: Based on hybridization and PCR
Markers: Based on hybridization and PCRSachin Kumar
 
Molecular marker analysis of A few Capsicum annum varieties
Molecular marker analysis of A few Capsicum annum varietiesMolecular marker analysis of A few Capsicum annum varieties
Molecular marker analysis of A few Capsicum annum varietiesAnkitha Hirematha
 
Role of molecular marker for the improvement of Potato (Solanum tuberosum )
Role of molecular marker for the improvement of Potato (Solanum tuberosum )Role of molecular marker for the improvement of Potato (Solanum tuberosum )
Role of molecular marker for the improvement of Potato (Solanum tuberosum )Jaygendrakumar
 
rapd marker, molecular marker by K. K SAHU Sir
rapd marker, molecular marker by K. K SAHU Sirrapd marker, molecular marker by K. K SAHU Sir
rapd marker, molecular marker by K. K SAHU SirKAUSHAL SAHU
 
Biochemical and molecular markers for characterization
Biochemical and molecular markers for characterizationBiochemical and molecular markers for characterization
Biochemical and molecular markers for characterizationmithraa thirumalai
 
Aflp & rflp (bikash kumar singh)
Aflp & rflp (bikash kumar singh)Aflp & rflp (bikash kumar singh)
Aflp & rflp (bikash kumar singh)Bikash Singh
 
marker technology
marker technologymarker technology
marker technologysangita
 
AFLP, RFLP & RAPD
AFLP, RFLP & RAPDAFLP, RFLP & RAPD
AFLP, RFLP & RAPDDOCTOR WHO
 

What's hot (20)

Molecular markers
Molecular markersMolecular markers
Molecular markers
 
DNA Markers Techniques for Plant Varietal Identification
DNA Markers Techniques for Plant Varietal Identification DNA Markers Techniques for Plant Varietal Identification
DNA Markers Techniques for Plant Varietal Identification
 
Aflp & rflp (bikash kumar singh)
Aflp & rflp (bikash kumar singh)Aflp & rflp (bikash kumar singh)
Aflp & rflp (bikash kumar singh)
 
Markers: Based on hybridization and PCR
Markers: Based on hybridization and PCRMarkers: Based on hybridization and PCR
Markers: Based on hybridization and PCR
 
RFLP & RAPD
RFLP & RAPDRFLP & RAPD
RFLP & RAPD
 
Molecular marker analysis of A few Capsicum annum varieties
Molecular marker analysis of A few Capsicum annum varietiesMolecular marker analysis of A few Capsicum annum varieties
Molecular marker analysis of A few Capsicum annum varieties
 
Role of molecular marker for the improvement of Potato (Solanum tuberosum )
Role of molecular marker for the improvement of Potato (Solanum tuberosum )Role of molecular marker for the improvement of Potato (Solanum tuberosum )
Role of molecular marker for the improvement of Potato (Solanum tuberosum )
 
rapd marker, molecular marker by K. K SAHU Sir
rapd marker, molecular marker by K. K SAHU Sirrapd marker, molecular marker by K. K SAHU Sir
rapd marker, molecular marker by K. K SAHU Sir
 
RAPD
RAPDRAPD
RAPD
 
markers and their role
markers and their rolemarkers and their role
markers and their role
 
Biochemical and molecular markers for characterization
Biochemical and molecular markers for characterizationBiochemical and molecular markers for characterization
Biochemical and molecular markers for characterization
 
Molecular markers
Molecular markersMolecular markers
Molecular markers
 
SCoT and RAPD
SCoT and RAPDSCoT and RAPD
SCoT and RAPD
 
Molecular Markers as a Diagnostic Tool
Molecular Markers as a Diagnostic ToolMolecular Markers as a Diagnostic Tool
Molecular Markers as a Diagnostic Tool
 
Microsatelit
MicrosatelitMicrosatelit
Microsatelit
 
Aflp & rflp (bikash kumar singh)
Aflp & rflp (bikash kumar singh)Aflp & rflp (bikash kumar singh)
Aflp & rflp (bikash kumar singh)
 
Molecular Markers
Molecular MarkersMolecular Markers
Molecular Markers
 
marker technology
marker technologymarker technology
marker technology
 
Molecular markers
Molecular markersMolecular markers
Molecular markers
 
AFLP, RFLP & RAPD
AFLP, RFLP & RAPDAFLP, RFLP & RAPD
AFLP, RFLP & RAPD
 

Viewers also liked

Molecular marker technology in studies on plant genetic diversity
Molecular marker technology in studies on plant genetic diversityMolecular marker technology in studies on plant genetic diversity
Molecular marker technology in studies on plant genetic diversityChanakya P
 
Molecular Breeding in Plants is an introduction to the fundamental techniques...
Molecular Breeding in Plants is an introduction to the fundamental techniques...Molecular Breeding in Plants is an introduction to the fundamental techniques...
Molecular Breeding in Plants is an introduction to the fundamental techniques...UNIVERSITI MALAYSIA SABAH
 
Molecular marker and its application to genome mapping and molecular breeding
Molecular marker and its application to genome mapping and molecular breedingMolecular marker and its application to genome mapping and molecular breeding
Molecular marker and its application to genome mapping and molecular breedingFOODCROPS
 
Chromosome walking
Chromosome walkingChromosome walking
Chromosome walkingAleena Khan
 
SyMAP Master's Thesis Presentation
SyMAP Master's Thesis PresentationSyMAP Master's Thesis Presentation
SyMAP Master's Thesis Presentationaustinps
 
Comparative Genomics and Visualisation - Part 1
Comparative Genomics and Visualisation - Part 1Comparative Genomics and Visualisation - Part 1
Comparative Genomics and Visualisation - Part 1Leighton Pritchard
 
Smart breeding final
Smart breeding finalSmart breeding final
Smart breeding finalPavan R
 
Comparative Genomics and Visualisation BS32010
Comparative Genomics and Visualisation BS32010Comparative Genomics and Visualisation BS32010
Comparative Genomics and Visualisation BS32010Leighton Pritchard
 
New York City Day 2, January 2015 - Narrative Development with Story Grammar ...
New York City Day 2, January 2015 - Narrative Development with Story Grammar ...New York City Day 2, January 2015 - Narrative Development with Story Grammar ...
New York City Day 2, January 2015 - Narrative Development with Story Grammar ...MindWing Concepts, Inc.
 
Marker free transgenic development
Marker free transgenic developmentMarker free transgenic development
Marker free transgenic developmentArpita Mahobia
 
2 introduction molecular markers patocchi andrea
2 introduction molecular markers patocchi andrea2 introduction molecular markers patocchi andrea
2 introduction molecular markers patocchi andreafruitbreedomics
 
Marker assisted selection lecture
Marker assisted selection lectureMarker assisted selection lecture
Marker assisted selection lectureBruno Mmassy
 
Molecular markers used in biotechnology
Molecular markers used in biotechnology Molecular markers used in biotechnology
Molecular markers used in biotechnology sana sana
 
Dna markers lecture
Dna markers lectureDna markers lecture
Dna markers lectureBruno Mmassy
 
Marker Assisted Selection in Crop Breeding
 Marker Assisted Selection in Crop Breeding Marker Assisted Selection in Crop Breeding
Marker Assisted Selection in Crop BreedingPawan Chauhan
 
Marker assissted selection
Marker assissted selectionMarker assissted selection
Marker assissted selectionmuzamil ahmad
 

Viewers also liked (20)

Molecular marker technology in studies on plant genetic diversity
Molecular marker technology in studies on plant genetic diversityMolecular marker technology in studies on plant genetic diversity
Molecular marker technology in studies on plant genetic diversity
 
Molecular Breeding in Plants is an introduction to the fundamental techniques...
Molecular Breeding in Plants is an introduction to the fundamental techniques...Molecular Breeding in Plants is an introduction to the fundamental techniques...
Molecular Breeding in Plants is an introduction to the fundamental techniques...
 
Molecular marker and its application to genome mapping and molecular breeding
Molecular marker and its application to genome mapping and molecular breedingMolecular marker and its application to genome mapping and molecular breeding
Molecular marker and its application to genome mapping and molecular breeding
 
Molecular marker
Molecular markerMolecular marker
Molecular marker
 
Chromosome walking
Chromosome walkingChromosome walking
Chromosome walking
 
SyMAP Master's Thesis Presentation
SyMAP Master's Thesis PresentationSyMAP Master's Thesis Presentation
SyMAP Master's Thesis Presentation
 
Comparative Genomics and Visualisation - Part 1
Comparative Genomics and Visualisation - Part 1Comparative Genomics and Visualisation - Part 1
Comparative Genomics and Visualisation - Part 1
 
Smart breeding final
Smart breeding finalSmart breeding final
Smart breeding final
 
Comparative Genomics and Visualisation BS32010
Comparative Genomics and Visualisation BS32010Comparative Genomics and Visualisation BS32010
Comparative Genomics and Visualisation BS32010
 
New York City Day 2, January 2015 - Narrative Development with Story Grammar ...
New York City Day 2, January 2015 - Narrative Development with Story Grammar ...New York City Day 2, January 2015 - Narrative Development with Story Grammar ...
New York City Day 2, January 2015 - Narrative Development with Story Grammar ...
 
genomic comparison
genomic comparison genomic comparison
genomic comparison
 
Marker free transgenic development
Marker free transgenic developmentMarker free transgenic development
Marker free transgenic development
 
2 introduction molecular markers patocchi andrea
2 introduction molecular markers patocchi andrea2 introduction molecular markers patocchi andrea
2 introduction molecular markers patocchi andrea
 
Molecular markers
Molecular markersMolecular markers
Molecular markers
 
Marker assisted selection lecture
Marker assisted selection lectureMarker assisted selection lecture
Marker assisted selection lecture
 
Molecular markers used in biotechnology
Molecular markers used in biotechnology Molecular markers used in biotechnology
Molecular markers used in biotechnology
 
Dna markers lecture
Dna markers lectureDna markers lecture
Dna markers lecture
 
Marker Assisted Selection in Crop Breeding
 Marker Assisted Selection in Crop Breeding Marker Assisted Selection in Crop Breeding
Marker Assisted Selection in Crop Breeding
 
Marker assissted selection
Marker assissted selectionMarker assissted selection
Marker assissted selection
 
Genetic polymorphism
Genetic polymorphismGenetic polymorphism
Genetic polymorphism
 

Similar to Marker devt. workshop 27022012

Present status and recent developments on available molecular marker.pptx
Present status and recent developments on available molecular marker.pptxPresent status and recent developments on available molecular marker.pptx
Present status and recent developments on available molecular marker.pptxPrabhatSingh628463
 
Pathema Burkholderia Annotation Jamboree: Prokaryotic Annotation Overview
Pathema Burkholderia Annotation Jamboree: Prokaryotic Annotation OverviewPathema Burkholderia Annotation Jamboree: Prokaryotic Annotation Overview
Pathema Burkholderia Annotation Jamboree: Prokaryotic Annotation OverviewPathema
 
SAGE- Serial Analysis of Gene Expression
SAGE- Serial Analysis of Gene ExpressionSAGE- Serial Analysis of Gene Expression
SAGE- Serial Analysis of Gene ExpressionAashish Patel
 
Fruit breedomics workshop wp6 from marker assisted breeding to genomics assis...
Fruit breedomics workshop wp6 from marker assisted breeding to genomics assis...Fruit breedomics workshop wp6 from marker assisted breeding to genomics assis...
Fruit breedomics workshop wp6 from marker assisted breeding to genomics assis...fruitbreedomics
 
Molecular markers by tahura mariyam ansari
Molecular markers by tahura mariyam ansariMolecular markers by tahura mariyam ansari
Molecular markers by tahura mariyam ansariTahura Mariyam Ansari
 
genome Mapping by pcr
genome Mapping by pcrgenome Mapping by pcr
genome Mapping by pcrPravin Sapate
 
Genetic mapping and sequencing
Genetic mapping and sequencingGenetic mapping and sequencing
Genetic mapping and sequencingAamna Tabassum
 
Molecular marker by anil bl gather
Molecular marker by anil bl gatherMolecular marker by anil bl gather
Molecular marker by anil bl gatherANIL BL GATHER
 
Lecture bioinformatics Part2.next generation
Lecture bioinformatics Part2.next generationLecture bioinformatics Part2.next generation
Lecture bioinformatics Part2.next generationMohamedHasan816582
 
Apollo Introduction for the Chestnut Research Community
Apollo Introduction for the Chestnut Research CommunityApollo Introduction for the Chestnut Research Community
Apollo Introduction for the Chestnut Research CommunityMonica Munoz-Torres
 
Restriction mapping
Restriction mappingRestriction mapping
Restriction mappingArdraArdra1
 
Bio305 genome analysis and annotation 2012
Bio305 genome analysis and annotation 2012Bio305 genome analysis and annotation 2012
Bio305 genome analysis and annotation 2012Mark Pallen
 

Similar to Marker devt. workshop 27022012 (20)

Present status and recent developments on available molecular marker.pptx
Present status and recent developments on available molecular marker.pptxPresent status and recent developments on available molecular marker.pptx
Present status and recent developments on available molecular marker.pptx
 
Pathema Burkholderia Annotation Jamboree: Prokaryotic Annotation Overview
Pathema Burkholderia Annotation Jamboree: Prokaryotic Annotation OverviewPathema Burkholderia Annotation Jamboree: Prokaryotic Annotation Overview
Pathema Burkholderia Annotation Jamboree: Prokaryotic Annotation Overview
 
SAGE- Serial Analysis of Gene Expression
SAGE- Serial Analysis of Gene ExpressionSAGE- Serial Analysis of Gene Expression
SAGE- Serial Analysis of Gene Expression
 
Fruit breedomics workshop wp6 from marker assisted breeding to genomics assis...
Fruit breedomics workshop wp6 from marker assisted breeding to genomics assis...Fruit breedomics workshop wp6 from marker assisted breeding to genomics assis...
Fruit breedomics workshop wp6 from marker assisted breeding to genomics assis...
 
Molecular markers by tahura mariyam ansari
Molecular markers by tahura mariyam ansariMolecular markers by tahura mariyam ansari
Molecular markers by tahura mariyam ansari
 
Mapping by pcr
Mapping by pcrMapping by pcr
Mapping by pcr
 
genome Mapping by pcr
genome Mapping by pcrgenome Mapping by pcr
genome Mapping by pcr
 
2015 12-09 nmdd
2015 12-09 nmdd2015 12-09 nmdd
2015 12-09 nmdd
 
Shahbaz Str
Shahbaz StrShahbaz Str
Shahbaz Str
 
Shahbaz Str
Shahbaz StrShahbaz Str
Shahbaz Str
 
Genetic mapping and sequencing
Genetic mapping and sequencingGenetic mapping and sequencing
Genetic mapping and sequencing
 
Molecular marker by anil bl gather
Molecular marker by anil bl gatherMolecular marker by anil bl gather
Molecular marker by anil bl gather
 
Lecture bioinformatics Part2.next generation
Lecture bioinformatics Part2.next generationLecture bioinformatics Part2.next generation
Lecture bioinformatics Part2.next generation
 
Transcriptomics approaches
Transcriptomics approachesTranscriptomics approaches
Transcriptomics approaches
 
Apollo Introduction for the Chestnut Research Community
Apollo Introduction for the Chestnut Research CommunityApollo Introduction for the Chestnut Research Community
Apollo Introduction for the Chestnut Research Community
 
A f l p
A f l pA f l p
A f l p
 
Restriction mapping
Restriction mappingRestriction mapping
Restriction mapping
 
Molecular markers
Molecular markersMolecular markers
Molecular markers
 
Microsatellites Markers
Microsatellites  MarkersMicrosatellites  Markers
Microsatellites Markers
 
Bio305 genome analysis and annotation 2012
Bio305 genome analysis and annotation 2012Bio305 genome analysis and annotation 2012
Bio305 genome analysis and annotation 2012
 

Recently uploaded

Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 365
Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 365Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 365
Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 3652toLead Limited
 
Salesforce Community Group Quito, Salesforce 101
Salesforce Community Group Quito, Salesforce 101Salesforce Community Group Quito, Salesforce 101
Salesforce Community Group Quito, Salesforce 101Paola De la Torre
 
How to Remove Document Management Hurdles with X-Docs?
How to Remove Document Management Hurdles with X-Docs?How to Remove Document Management Hurdles with X-Docs?
How to Remove Document Management Hurdles with X-Docs?XfilesPro
 
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking MenDelhi Call girls
 
FULL ENJOY 🔝 8264348440 🔝 Call Girls in Diplomatic Enclave | Delhi
FULL ENJOY 🔝 8264348440 🔝 Call Girls in Diplomatic Enclave | DelhiFULL ENJOY 🔝 8264348440 🔝 Call Girls in Diplomatic Enclave | Delhi
FULL ENJOY 🔝 8264348440 🔝 Call Girls in Diplomatic Enclave | Delhisoniya singh
 
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmaticsKotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmaticscarlostorres15106
 
Transforming Data Streams with Kafka Connect: An Introduction to Single Messa...
Transforming Data Streams with Kafka Connect: An Introduction to Single Messa...Transforming Data Streams with Kafka Connect: An Introduction to Single Messa...
Transforming Data Streams with Kafka Connect: An Introduction to Single Messa...HostedbyConfluent
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationRadu Cotescu
 
SIEMENS: RAPUNZEL – A Tale About Knowledge Graph
SIEMENS: RAPUNZEL – A Tale About Knowledge GraphSIEMENS: RAPUNZEL – A Tale About Knowledge Graph
SIEMENS: RAPUNZEL – A Tale About Knowledge GraphNeo4j
 
AI as an Interface for Commercial Buildings
AI as an Interface for Commercial BuildingsAI as an Interface for Commercial Buildings
AI as an Interface for Commercial BuildingsMemoori
 
Maximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptxMaximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptxOnBoard
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreternaman860154
 
08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking Men08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking MenDelhi Call girls
 
Unblocking The Main Thread Solving ANRs and Frozen Frames
Unblocking The Main Thread Solving ANRs and Frozen FramesUnblocking The Main Thread Solving ANRs and Frozen Frames
Unblocking The Main Thread Solving ANRs and Frozen FramesSinan KOZAK
 
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...Patryk Bandurski
 
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure serviceWhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure servicePooja Nehwal
 
[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdfhans926745
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationSafe Software
 
Understanding the Laravel MVC Architecture
Understanding the Laravel MVC ArchitectureUnderstanding the Laravel MVC Architecture
Understanding the Laravel MVC ArchitecturePixlogix Infotech
 
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...Neo4j
 

Recently uploaded (20)

Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 365
Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 365Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 365
Tech-Forward - Achieving Business Readiness For Copilot in Microsoft 365
 
Salesforce Community Group Quito, Salesforce 101
Salesforce Community Group Quito, Salesforce 101Salesforce Community Group Quito, Salesforce 101
Salesforce Community Group Quito, Salesforce 101
 
How to Remove Document Management Hurdles with X-Docs?
How to Remove Document Management Hurdles with X-Docs?How to Remove Document Management Hurdles with X-Docs?
How to Remove Document Management Hurdles with X-Docs?
 
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
 
FULL ENJOY 🔝 8264348440 🔝 Call Girls in Diplomatic Enclave | Delhi
FULL ENJOY 🔝 8264348440 🔝 Call Girls in Diplomatic Enclave | DelhiFULL ENJOY 🔝 8264348440 🔝 Call Girls in Diplomatic Enclave | Delhi
FULL ENJOY 🔝 8264348440 🔝 Call Girls in Diplomatic Enclave | Delhi
 
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmaticsKotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
 
Transforming Data Streams with Kafka Connect: An Introduction to Single Messa...
Transforming Data Streams with Kafka Connect: An Introduction to Single Messa...Transforming Data Streams with Kafka Connect: An Introduction to Single Messa...
Transforming Data Streams with Kafka Connect: An Introduction to Single Messa...
 
Scaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organizationScaling API-first – The story of a global engineering organization
Scaling API-first – The story of a global engineering organization
 
SIEMENS: RAPUNZEL – A Tale About Knowledge Graph
SIEMENS: RAPUNZEL – A Tale About Knowledge GraphSIEMENS: RAPUNZEL – A Tale About Knowledge Graph
SIEMENS: RAPUNZEL – A Tale About Knowledge Graph
 
AI as an Interface for Commercial Buildings
AI as an Interface for Commercial BuildingsAI as an Interface for Commercial Buildings
AI as an Interface for Commercial Buildings
 
Maximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptxMaximizing Board Effectiveness 2024 Webinar.pptx
Maximizing Board Effectiveness 2024 Webinar.pptx
 
Presentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreterPresentation on how to chat with PDF using ChatGPT code interpreter
Presentation on how to chat with PDF using ChatGPT code interpreter
 
08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking Men08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking Men
 
Unblocking The Main Thread Solving ANRs and Frozen Frames
Unblocking The Main Thread Solving ANRs and Frozen FramesUnblocking The Main Thread Solving ANRs and Frozen Frames
Unblocking The Main Thread Solving ANRs and Frozen Frames
 
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
 
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure serviceWhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
WhatsApp 9892124323 ✓Call Girls In Kalyan ( Mumbai ) secure service
 
[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf[2024]Digital Global Overview Report 2024 Meltwater.pdf
[2024]Digital Global Overview Report 2024 Meltwater.pdf
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
 
Understanding the Laravel MVC Architecture
Understanding the Laravel MVC ArchitectureUnderstanding the Laravel MVC Architecture
Understanding the Laravel MVC Architecture
 
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
Neo4j - How KGs are shaping the future of Generative AI at AWS Summit London ...
 

Marker devt. workshop 27022012

  • 1. Marker development for mapping Ravi Koppolu RG: Plant Architecture IPK, Gatersleben
  • 2. Outline  Few concepts  Different types of molecular markers and applications  Marker development for gene mapping
  • 3. Exon 1 5‘ 3‘ 5‘-UTR Start codon: ATG Intron 1Promoter 3‘-UTR I 2 Stop codon: TAG TAA TGA Exon 3 Genomic DNA (gDNA)  mRNA  Protein Exon 2 genomic DNA Transcr. Start Start: ATG Stop: TAG TAA TGA ORF (open reading frame) coding sequence Translation Protein Poly(A)A..A mature mRNA Transcription & Post transcriptional modification Slide from Dr. Thorsten Schnurbusch
  • 4. Polymorphism? Is the ability to distinguish two or more individuals The variation shown here is due to four different alleles at a particular gene. Molecular markers can identify sequence polymorphisms among two or more individuals which may result in the change of phenotype. vrs4.k TGGTTGCAGCGGCCACGACACCGGGGGC-GGGGCGCCGTGCGCTGCGTG :Mutant allele MFB104 TGGTTGCAGCGGCCACGACACCGGGGGCCGGGGCGCCGTGCGCTGCGTG :Wild allele 2-rowed spike 6-rowed spike
  • 5. Subsequently, genetic variation at DNA aroused due to mutation will cause variation in protein Protein markers Mutation Mutation arises genetic variation at the DNA level DNA markers A sequence of DNA or protein that can be screened to reveal key attributes of its state or composition and thus used to reveal genetic variation Molecular marker
  • 6. Genomic DNA mutations can be classified into GATCCGAGTATCGCAATTAGCA GATCCGAGTGTCGCAATTAGCA Base substitution GATCCGAGTATCGCATGCATTAGCA GATCCGAGTA ̶ ̶ ̶ ̶ ̶ ̶ ̶ ̶ ̶ ATTAGCA Deletion GATCCGAGTATCGCAATTAGCA GATCCGAGTATCGCAGCATTAGCA Insertion GATCCGAGTATCGCAATTAGCA GATCCGAGTATCTCGCAATTAGCA Duplication GATCCGAGTATCGCAATTAGCA GATGCCAGTATCGCAATTAGCA Inversion
  • 7. Molecular marker types Co-dominant marker systems Restriction Fragment Length Polymorphisms (RFLPs) Simple sequence repeats (SSRs) SNP based marker systems Dominant marker systems Random amplified polymorphic DNAs (RAPD) Amplified fragment length polymorphism (AFLP) Diversity arrays technology (DArT)
  • 8. Co-dominant vs. Dominant marker systems Collard et al. 2005; Euphytica Co-dominant marker Dominant marker Co-dominant markers follow Mendelian inheritance pattern
  • 9.
  • 10. Simple sequence repeats (SSRs) SSRs contain tandem repeated single, double, triple nucleotides several times Allelic variants differ in terms of number of repeats
  • 11. Single nucleotide polymorphisms (SNPs)  A mutation that causes single base change is SNP  Most of them don't have a phenotypic effect  SNPs can be alleles of a particular gene  SNPs are most abundant types of DNA variation found among individuals of same species
  • 12. Applications of molecular markers  Germplasm identification, Classification  Genetic diversity/Relatedness  Selection of parents for making wide crosses  Development of molecular linkage maps  Marker assisted selection  Genomic selection  Map-Based cloning of genes
  • 13. Synteny enables to recruit markers from related species Close et al. 2010; BMC Genomics Mayer et al. 2011, Pl. Cell
  • 14. BLAST against barley EST’s Flank introns/UTRs with primers viroBLAST against barley contigs Resequence SNP Length polymorphism CAPS dCAPS Genotyping on Agarose Syntenic/Colinear regions Marker development procedure at AG PBP
  • 15. Resources for our Marker development workshop
  • 16. Genome Zippers Provide information on putative linear gene order for ̴86% barley genes based on synteny with rice, sorghum and Brachypodium. Mayer et al. Plant Physiol, 2009 Available at http://mips.helmholtz-muenchen.de/plant/triticeae/barleyDisclaimerGZ.jsp A snapshot of Genome Zipper
  • 17. Syntenic cereal sequence databases http://rice.plantbiology.msu.edu/annotation_pseudo_current.shtml http://www.brachypodium.org/
  • 18. Barley viroBLAST Barley viroBLAST contains sequence data like 1.) 28X Illumina shot gun reads based on Morex 2.) Sequenced BACs 3.) Sorted chromosome sequences 4.) Full length cDNA sequences http://webblast.ipk-gatersleben.de/barley/index.php
  • 19. BLAST output with the barley viroBLAST sequence as query against barley EST database The sequence/s from viroBLAST can be BLASTed against barley ESTs to identify Exon-Intron boundaries
  • 20. Primer design  Primers designed to span boundaries of two exonic regions or to the UTRs  Primers can be picked manually or by using software’s like primer3  GC content of a primer pair should better be >=30%  Avoid having multiple A’s or T’s at the 3’end.  Check whether primers are forming any secondary structures or dimers  Better to have overlapping Tm for different primer pairs  If designed manually don't forget to reverse complement the reverse primer Stem loops Dimers
  • 21. Resequencing of primer pairs Resequence the primer pairs in the parents of interest to identify sequence polymorphisms. Sequence analysis will be demonstrated during the workshop Snapshot showing SNPs and deletions identified after resequencing in parents
  • 22. Development of CAPS and dCAPS markers CAPS: Cleaved Amplified Polymorphic sequence In principle CAPS is similar to RFLP except that a shorter PCR amplified product with known SNPs is digested with restriction enzymes instead of whole genomic DNA. Contd….
  • 23. dCAPS: Derived Cleaved Amplified Polymorphic sequence In dCAPS assay mismatches in PCR primers are introduced to create restriction endonuclease polymorphism based on the target mutation. BclI recognition site: CC(N)7GG
  • 24. Web links for Marker development Brachypodium database: http://www.brachypodium.org/ Rice database http://rice.plantbiology.msu.edu/annotation_pseudo_current.shtml Rice ID Converter http://rapdb.dna.affrc.go.jp/tools/converter Barley viroBLAST http://webblast.ipk-gatersleben.de/barley/viroblast.php NCBI BLAST http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome IDT manual Primer design http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/Default.aspx http://www.basic.northwestern.edu/biotools/oligocalc.html Primer3 http://frodo.wi.mit.edu/primer3/ Reverse complement generator http://www.bioinformatics.org/sms/rev_comp.html Clustalw http://www.ebi.ac.uk/Tools/msa/clustalw2/ Nebcutter http://tools.neb.com/NEBcutter2/ dCAPS finder http://helix.wustl.edu/dcaps/dcaps.html