SlideShare una empresa de Scribd logo
1 de 103
Chromosomes, Crops and
Superdomestication
Pat Heslop-Harrison
phh4@le.ac.uk
www.molcyt.com and www.molcyt.org

Twitter, YouTube and Slideshare: pathh1
17 December 2013 10-12
Outputs
–CROPS
– Fixed energy

Inputs

–Light
–Heat
–Water
–Gasses
–Nutrients
Outputs
–CROPS
– Fixed energy

– Light
– Heat
– Water
– Gasses
– Nutrients
3

Inputs

–Light
–Heat
–Water
–Gasses
–Nutrients
Apollo 17 – The Blue Marble December 7, 1972

NASA
The Blue Marble
Apollo 17 7 Dec 1972
We’ve done that before …
Coming out of ice age at time of recognizably modern
humans 50,000 yrs ago
Coming up to the start of agriculture 10,000 yrs ago
During agricultural clearances 2,000 and 1,000 yrs ago
During better cultivation 150 yrs ago
20th Century: Drainage/fertilization/crop protection

… and nearly every other ‘species’ tries to do it …
goats, pines, viruses
Burren West Ireland
Mediaeval: Peat forest 1500 years of overgrazing
Eroded to bedrock (now a preserved landscape!)
st
21

C: Population increase
higher living standards / health
fossil fuel use
climate change
water …
Life on the edge …

Verge of stability for fire
with 20% oxygen
Water – quality and
quantity
Temperature – too
hot or cold
ABIOTIC FACTORS
11
• Brazil slash and burn
• Malaysian cut out ganoderma plants
Ecosystems anchor slide
Largely
– Self-organizing
– Self-maintained
– Cycling
– Defined scope
– cf University
– Household
– Aircraft
–
13
Outputs
–CROPS
– Fixed energy

– Light
– Heat
– Water
– Gasses
– Nutrients
14

Inputs

–Light
–Heat
–Water
–Gasses
–Nutrients
Outputs
Ecosystem
Services
Water, gasses,
nutrients
”nature’s services, like flood control, water filtration,
waste assimilation”
Ecosystem cycling threatened
by stress and Abiotic
instability
Water
Fire
Wind

Biotic
Virus, bacteria, fungi
Weeds, insects
Nematodes etc.
Alien invasions
16
Rainfall
Distribution
mm/yr

17
18

Occasional ‘extreme inputs’:
Limiting composition of ecosystems
more than ‘mean input’ - Robustness
Water hyacinth – Eichornia: an invasive alien plant from South America, fills water courses (a
surface habitat not used by any native species) in Asia and Africa

20
21

Argenome mexicana: a goat-proof plant from
Mexcio introduced and successful in Africa
Anhalt, Barth, HH
Euphytica 2009 Theor App Gen 200
23
24
50 years of plant breeding progress
4

Maize
Rice
Wheat
Human
Area

3.5

3

Agronomy

2.5

2

1.5

1

0.5

0

1961

1970

1980

1990

2000

2007
27
• 50% of the world's protein needs are
derived from atmospheric nitrogen fixed
by the Haber-Bosch process and its
successors.
• Global consumption of fertilizer
(chemically fixed nitrogen) 80 million
tonnes
• <<200 million tonnes fixed naturally
Outputs

–Crops
(Chemical energy)
– Food
– Feed
– Fuel
– Fibre
– Flowers
– Pharmaceuticals
– Fun
32
50 years of plant breeding progress
4

Maize
Rice
Wheat
Human
Area

Genetics

3.5

3

2.5

2

1.5

1

0.5

0

1961

1970

1980

1990

2000

2007
UK Wheat 1948-2007
52,909 data points, 308 varieties

From Ian Mackay, NIAB, UK. 2009. Re-analyses of historical series of variety trials: lessons from
the past and opportunities for the future. SCRI website.
Conventional Breeding
• Cross the best with the best and hope for something
better

Superdomestication

• Decide what is wanted and then plan how to get it
–
–
–
–
–

Variety crosses
Mutations
Hybrids (sexual or cell-fusion)
Genepool
Transformation
Economic growth
• Separate into increases in inputs
(resources, labour and capital) and
technical progress
• 90% of the growth in US output per
worker is attributable to technical
progress
Robert Solow – Economist
Inputs
–Light
–Heat
–Water
–Gasses
–Nutrients
–STRESSES
38
BIODIVERSITY and genetic resources
Red - AAA
Palayam codan AAB (two bunch yellow, one green)
Peyan ABB (green cooking banana),
Njalipoovan AB (yellow)
Robusta AAA (green ripe)
Nendran AAB
Poovan AAB (one yellow bunch)
Red AAA
Peyan
Varkala, Kerala, India
Genomes and
genomics
Genomics

• Study of the structure, diversity, function and
behaviour of all the DNA in an organism, organelle
or virus

ata clone MuG9, genomic, 73268bp
gaaatccaatcaatccagatcaatattgatcgggttctg
tgacgaagcagtcaaactgatcactaaaattcaatacat
ggagtgctgatttcagaaacttaatcccttctgatagaa
ccaacttacactaattagtcttaaaactcattaaggttg
aataaatgtcatattacccttccaggtcataaacagctt
aatgctgaagctattggcattacacttagtcttaacttc
atttaacgatatgacaatcaataatgagataggcaaata
aaaatgacatttttttgaactctgcagaattagctccta
atcctttagtgaatgcagacaaggaatcagtaaccactg
Triticale: wheat x rye hybrid
Wheat evolution and hybrids

Triticum uratu
2n=2x=14
AA

Aegilops speltoides
relative
2n=2x=14
Triticum tauschii
BB
(Aegilops squarrosa)

Triticum dicoccoides
2n=4x=28
AABB
Einkorn
Triticum monococcum
2n=2x=14
Rye
AA
Secale cereale
2n=2x=14
RR
Durum/Spaghetti
Triticum turgidum ssp durum
2n=4x=28
AABB

2n=2x=14
DD

Bread wheat
Triticum
aestivum
2n=6x=42
AABBDD
Triticale
xTriticosecale
2n=6x=42
AABBRR
Crop standing

Lodging in cereals
Crop fallen
Use of repetitive DNA sequences as
chromosome markers
Satellite DNA probe green
Differences between genomes
Major differences in the nature and amount of
repetitive DNA

• dpTa1 tandem repeat • 45S rDNA
Inheritance of Chromosome 5D

Aegilops ventricosa
DDNN

× Triticum persicum Ac.1510
AABB
ABDN

AABBDDNN

× Marne
AABBDD

VPM1

× Hobbit

CWW1176-4

Rendezvous

dpTa1
pSc119.2
Genomic Ae.ventricosa

Piko

Dwarf A

× Virtue

× {Kraka × (Huntsman × Fruhgold)}

96ST61
Multiple repeat (dpTa1) variants
of each chromosome
e.g. 5DL

Bardsley, Schwarzacher & HH
S

1A L

Multiple dpTa1 variants
of each chromosome

S

2A L
S

e.g. 5DL

3A L
S

4A L
S

5A L
S

6A L
S

7A L

5BS.

5BL.

7BS

7BL

Bardsley, Schwarzacher & HH
Proportion of chromosome arms with
identical in situ signal

Correlation between genetic relationships and
similarity of dpTa1 hybridization
0.9
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
0
0

0.1

0.2

0.3

0.4

0.5

0.6

Coefficient of parentage

0.7

0.8

0.9

1
•
•
•
•

Tandem Repeats

Where each arrow is a single unit of a repeat –
- often a multiple of 180 bp but up to 10kb long
Head-to-tail organization
TCGCTAGA TCGCTAGA TCGCTAGA TCGCTAGA
TCGCTAGA TCGCTAGT TCGCTAGA TCGCTAGA
ancestral

High-copy number
A

High-copy number
B

Low-copy number

High-copy number
C

High-copy number
D

Low-copy number

High copy spp: homogenized, amplification from a limited number of master
copies
Low copy spp: much variation
Kuhn, Schwarzacher, PHH
Use of repetitive DNA sequences as
chromosome markers
Wheat Streak Mosaic Virus in North America
Bob Graybosch, USDA
Wsm-1: only highly effective source of resistance to WSMV
Mace wheat
Graybosch et al. 2009
In situ: Niaz Ali & Schwarzacher
Retroelements
Sequences which amplify through an RNA intermediate

•50% of all the DNA!
Retroelement Markers
Insertion
LTR

Retrotransposon

LTR

IRAP – InterRetroelement PCR

LTR

LTR

Retrotransposon

Retrotransposon

LTR

LTR

LTR

LTR

LTR

Retrotransposon

Retrotransposon

LTR

Retrotransposon

LTR

LTR
UPGMA dendrograms of the relationships based on IRAP analysis of (A) accessions of Ae.
tauschii subsp

Copyright restrictions may apply.

Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042
Retroelements

•Homologous BAC sequences from Calcutta 4
Homologous over the full length
•except for a 5kb insert
•a Ty1-copia retroelement
Musa balbisiana (MBP 81C12)

hAT 1
1676 TE
Musa acuminata (MA4 82I11)

384 bp TE + 781 MITE

Microsatellite (AT)

hAT 2

Transposed Element

621 bp MBT

hAT 3

4192 bp TE

Sr. No.

Primer Pairs

Product Size
(bp)

Sequence
hAT 4

1.

hAT18486
hAT19037

560

ACCCACCTGGCTCTTGTGTC
AGCGAATGTGTTTTGACCAC
Microsatellite (AT)

MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs.69
16/12/2013
1KB
800
600
400
200

HP-1

1

2 3 4 5

6

7 8 9 10 11 12 13 14 15 16

17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48

hAT1 insertion sites in Musa diversity collection
hAT486F and hAT037R
Top bands (560-bp) amplified hAT element and lower bands amplifying the flanking
16/12/2013
70
sequences only – Menzel, Nouroz, Schmidt, Schwarzacher, Heslop-Harrison 2013/14
Size and
location of
chromosome
regions from
radish
(Raphanus
sativus)
carrying the
fertility
restorer
Rfk1 gene
and transfer
to spring
turnip rape
(Brassica
rapa)
Chromosome
and genome
engineering
Cell fusion
hybrid of two
4x tetraploid
tobacco
species

Patel, Badakshi, HH, Dav
ey et al 2011 Annals of
Botany
Nicotiana
hybrid
4x + 4x
cell fusions
Each of 4
chromosome
sets has
distinctive
repetitive
DNA when
probed with
genomic DNA
Patel et al
Ann Bot 2011
Diploid 2n=2x=22 Musa / banana metaphase probed red with transposable element
Teo & Schwarzacher
Six-way Venn diagram showing the distribution of shared gene
families (sequence clusters) among M. acuminata, P. dactylifera,
Arabidopsis thaliana, Oryza sativa, Sorghum bicolor and Brachypodium
distachyon genomes.

A D’Hont et al. Nature 000, 1-5 (2012)
doi:10.1038/nature11241
A D’Hont et al. Nature 2012 doi:10.1038/nature11241
Whole-genome duplication events.

A D’Hont et al. Nature 000, 1-5 (2012)
doi:10.1038/nature11241
A D’Hont et al. Nature 2012
doi:10.1038/nature11241
Arachis hypogaea - Peanut
Tetraploid of recent
origin, ancestors separated only 3
My ago

Ana Claudia Araujo, David Bertioli, TS & PHH EMBRAPA, Brasília. Annals of Botany 2013
Retroelement abundance and
diversity in barley

Gypsy elements are present in 25% of all BAC clones

Barley gypsy: Vershinin, Druka, Kleinhofs, HH: PMB 2002; cf Brassica Alix & HH PM
 Bertioli et al. Annals of Botany 2013

•Arachis hypogea 2n=4x=40 probed with
•(green) A. duranensis; (red) A. ipaënsis
Oscillations: noise and stability

• Stochastic fluctuations
– preserve stable oscillations
– ensure robustness of the oscillations to cell-to-cell variations

• Robustness analysis requires stochastic simulation
JongRae Kim et al. Stochastic noise and synchronisation during Dictyostelium
aggregation make cAMP oscillations robust. PLoS Computational Biology 2007
Weak

Stronger
Coupling

Kim J-R, Shin D, Jung SH, Heslop-Harrison P, Cho K-H. 2010. A design principle underlying the
synchronization of oscillations in cellular systems. Journal of Cell Science 123(4): 537-543
• Dynamic interactions between dependent modules
•
•

Valeyev et al. Mol Biosyst 2009 5: 612
Kim J-R, Kim J, Kwon Y-K, Lee H-Y, Heslop-Harrison P, Cho K-H. 2011. Reduction of complex signaling
networks to a representative kernel. Science Signaling 4, ra35. doi: 10.1126/scisignal.2001390
• Stable cAMP oscillations in the
cells with other
molecules/ions

Valeyev et al. Mol Biosyst 2009
•
•
•
•

“Biochemistry explains biology”
“Chemistry explains biochemistry”
“Physics explains chemistry”
“Mathematics explains physics”
From Chromosome to Nucleus

Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
Outputs

–Crops
(Chemical energy)
– Food
– Feed
– Fuel
– Fibre
– Flowers
– Pharmaceuticals
– Fun
90
The genepool has the diversity to
address these challenges …
New methods to exploit and
characterize germplasm let use make
better and sustainable use of the
genepool

Molecular cytogenetics …
How to use diversity

• Cross two varieties

• Genome manipulations
•
Cross two species and make a new one
•
Cell fusion hybrids
• Chromosome manipulation
•
Backcross a new species
• Generate recombinants
•
Chromosome recombinations

• Transgenic approaches
• Use a new species
Are there many candidates?
•
•
•
•

250,000 plants
4,629 mammals
9,200 birds
10,000,000 insects

• But only 200 plants, 15 mammals, 5 birds
and 2 insects are domesticated!
Nothing special about crop genomes?
Crop

Genome size

2n

Ploidy

Food

Rice

400 Mb

24

2

3x endosperm

Wheat

17,000 Mbp

42

6

3x endosperm

Maize

950 Mbp

10

4 (palaeo-tetraploid)

3x endosperm

Rapeseed B.
napus

1125 Mbp

38

4

Cotyledon oil/protein

Sugar beet

758 Mbp

18

2

Modified root

Cassava

770 Mbp

36

2

Tuber

Soybean

1,100 Mbp

40

4

Seed cotyledon

Oil palm

3,400 Mbp

32

2

Fruit mesocarp

Banana

500 Mbp

33

3

Fruit mesocarp

Heslop-Harrison & Schwarzacher 2012. Genetics and genomics of crop
domestication. In Altman & Hasegawa Plant Biotech & Agriculture. 10.1016/B9780-12-381466-1.00001-8
Tinyurl.com/domest
Rules for successful domestication
• There aren’t any!
• Crops come from anywhere (new/old world;
temperate/tropical; dry/humid)
• They might be grown worldwide
• Polyploids and diploids (big genomes-small
genomes, many chromosomes-few
chromosomes)
• Seeds, stems, tubers, fruits, leaves
Probably not many more
(at least for plants)

• Spread of the few species
• Little change since early agriculture
• Repeated domestication of these species
(sometimes)

• But wider use of current species with suitable
genetic changes, or of newly created hybrids
• A few species where wild-collections must be
replaced sustainably
• New needs – biofuels, neutraceuticals
50 years of plant breeding progress
GM maize

4

Maize
Rice
Wheat
Human
Area

Genetics

3.5

3

Agronomy

2.5

2

1.5

1

0.5

0

1961

1970

1980

1990

2000

2007
United Nations Millennium Development Goals-MDGs
• Goal 1 – Eradicate extreme
poverty and hunger
•

Goal 2 – Achieve universal primary education

• Goal 3 – Promote gender equity
and empower women
• Goal 4 – Reduce child mortality
• Goal 5 – Improve maternal health
• Goal 6- Combat
HIV/AIDS, malaria and other
diseases
• Goal 7 - Ensure environmental
sustainability
• Goal 8 - Develop a global
partnership for development
Chromosomes, Crops and
Superdomestication
Pat Heslop-Harrison
phh4@le.ac.uk
www.molcyt.com and www.molcyt.org

Twitter, YouTube and Slideshare: pathh1
17 December 2013 10-12
Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia

Más contenido relacionado

La actualidad más candente

Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-HarrisonMolecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...
Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...
Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...Pat (JS) Heslop-Harrison
 
Genetic markers in characterization2
Genetic markers in characterization2Genetic markers in characterization2
Genetic markers in characterization2Bruno Mmassy
 
Genome projects and their Contributions
Genome projects and their ContributionsGenome projects and their Contributions
Genome projects and their ContributionsAlbertPaul18
 
Content of the genome
Content of the genomeContent of the genome
Content of the genomeKiran Modi
 
Transgenic animal production and its application
Transgenic animal  production and its applicationTransgenic animal  production and its application
Transgenic animal production and its applicationkishoreGupta17
 
Chloroplast genomics and biotechnology
Chloroplast genomics and biotechnologyChloroplast genomics and biotechnology
Chloroplast genomics and biotechnologyNidhi Singh
 
Cytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineeringCytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineeringSANJAY KUMAR SANADYA
 
Role of Biotechnology in Improving Productivity for Rice Producers in Asia fr...
Role of Biotechnology in Improving Productivity for Rice Producers in Asia fr...Role of Biotechnology in Improving Productivity for Rice Producers in Asia fr...
Role of Biotechnology in Improving Productivity for Rice Producers in Asia fr...apaari
 
Transgenic animals- Sharmista
Transgenic animals- SharmistaTransgenic animals- Sharmista
Transgenic animals- SharmistaSharmistaChaitali
 
Genetic engineering in animal
Genetic engineering in animalGenetic engineering in animal
Genetic engineering in animalTaikiat Kiat
 
Genetic requirement for transgenic fish development
Genetic requirement for transgenic fish developmentGenetic requirement for transgenic fish development
Genetic requirement for transgenic fish developmentHina Zamir Noori
 
Next generation genomics for chickpea (Cicer arietinum L.) improvement
Next generation genomics for chickpea (Cicer arietinum L.) improvementNext generation genomics for chickpea (Cicer arietinum L.) improvement
Next generation genomics for chickpea (Cicer arietinum L.) improvementICRISAT
 
The Origin of Ashkenazi Levites
The Origin of Ashkenazi Levites The Origin of Ashkenazi Levites
The Origin of Ashkenazi Levites Family Tree DNA
 
SAB presentation to Jim narrated
SAB presentation to Jim narratedSAB presentation to Jim narrated
SAB presentation to Jim narratedguestba7bf7
 

La actualidad más candente (20)

Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-HarrisonMolecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
Molecular Cytogenetics Research Group Dec 2016 Pat Heslop-Harrison
 
Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...
Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...
Polyploids and Chromosomes Lecture Japanese Genetics Society Heslop-Harrison ...
 
Genetic markers in characterization2
Genetic markers in characterization2Genetic markers in characterization2
Genetic markers in characterization2
 
Genome projects and their Contributions
Genome projects and their ContributionsGenome projects and their Contributions
Genome projects and their Contributions
 
Content of the genome
Content of the genomeContent of the genome
Content of the genome
 
Transgenic animal production and its application
Transgenic animal  production and its applicationTransgenic animal  production and its application
Transgenic animal production and its application
 
Chloroplast genomics and biotechnology
Chloroplast genomics and biotechnologyChloroplast genomics and biotechnology
Chloroplast genomics and biotechnology
 
Cytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineeringCytoplasmic inheritance and Chloroplast engineering
Cytoplasmic inheritance and Chloroplast engineering
 
Presentation gmo
Presentation gmoPresentation gmo
Presentation gmo
 
Genetic engineering in animal cells
Genetic engineering in animal cellsGenetic engineering in animal cells
Genetic engineering in animal cells
 
Transgenic technology
Transgenic technologyTransgenic technology
Transgenic technology
 
Role of Biotechnology in Improving Productivity for Rice Producers in Asia fr...
Role of Biotechnology in Improving Productivity for Rice Producers in Asia fr...Role of Biotechnology in Improving Productivity for Rice Producers in Asia fr...
Role of Biotechnology in Improving Productivity for Rice Producers in Asia fr...
 
Transgenic animals- Sharmista
Transgenic animals- SharmistaTransgenic animals- Sharmista
Transgenic animals- Sharmista
 
Genetic engineering in animal
Genetic engineering in animalGenetic engineering in animal
Genetic engineering in animal
 
Transgenenics animals
Transgenenics animalsTransgenenics animals
Transgenenics animals
 
Transgenic animals
Transgenic animalsTransgenic animals
Transgenic animals
 
Genetic requirement for transgenic fish development
Genetic requirement for transgenic fish developmentGenetic requirement for transgenic fish development
Genetic requirement for transgenic fish development
 
Next generation genomics for chickpea (Cicer arietinum L.) improvement
Next generation genomics for chickpea (Cicer arietinum L.) improvementNext generation genomics for chickpea (Cicer arietinum L.) improvement
Next generation genomics for chickpea (Cicer arietinum L.) improvement
 
The Origin of Ashkenazi Levites
The Origin of Ashkenazi Levites The Origin of Ashkenazi Levites
The Origin of Ashkenazi Levites
 
SAB presentation to Jim narrated
SAB presentation to Jim narratedSAB presentation to Jim narrated
SAB presentation to Jim narrated
 

Destacado

Genome evolution - tales of scales DNA to crops,months to billions of years, ...
Genome evolution - tales of scales DNA to crops,months to billions of years, ...Genome evolution - tales of scales DNA to crops,months to billions of years, ...
Genome evolution - tales of scales DNA to crops,months to billions of years, ...Pat (JS) Heslop-Harrison
 
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...Pat (JS) Heslop-Harrison
 
Fruit And Veg Assembly
Fruit And Veg AssemblyFruit And Veg Assembly
Fruit And Veg AssemblyNitin Kumar
 
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...Pat (JS) Heslop-Harrison
 
21 lecture genome_and_evolution
21 lecture genome_and_evolution21 lecture genome_and_evolution
21 lecture genome_and_evolutionveneethmathew
 
Fluorescent in-situ Hybridization (FISH)
Fluorescent in-situ Hybridization (FISH)Fluorescent in-situ Hybridization (FISH)
Fluorescent in-situ Hybridization (FISH)BioGenex
 
Fish(flourescent in-situ hybridization)
Fish(flourescent in-situ hybridization)Fish(flourescent in-situ hybridization)
Fish(flourescent in-situ hybridization)naren
 

Destacado (7)

Genome evolution - tales of scales DNA to crops,months to billions of years, ...
Genome evolution - tales of scales DNA to crops,months to billions of years, ...Genome evolution - tales of scales DNA to crops,months to billions of years, ...
Genome evolution - tales of scales DNA to crops,months to billions of years, ...
 
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
Banana, Ensete and Boesenbergia Genomics - Schwarzacher, Heslop-Harrison, Har...
 
Fruit And Veg Assembly
Fruit And Veg AssemblyFruit And Veg Assembly
Fruit And Veg Assembly
 
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
Chromosomes and molecular cytogenetics of oil palm: impact for breeding and g...
 
21 lecture genome_and_evolution
21 lecture genome_and_evolution21 lecture genome_and_evolution
21 lecture genome_and_evolution
 
Fluorescent in-situ Hybridization (FISH)
Fluorescent in-situ Hybridization (FISH)Fluorescent in-situ Hybridization (FISH)
Fluorescent in-situ Hybridization (FISH)
 
Fish(flourescent in-situ hybridization)
Fish(flourescent in-situ hybridization)Fish(flourescent in-situ hybridization)
Fish(flourescent in-situ hybridization)
 

Similar a Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia

Technical Research Paper-04242013_DSN-1-final
Technical Research Paper-04242013_DSN-1-finalTechnical Research Paper-04242013_DSN-1-final
Technical Research Paper-04242013_DSN-1-finalDanielle Nisan
 
Intro to aDNA and bioarchaeology
Intro to aDNA and bioarchaeologyIntro to aDNA and bioarchaeology
Intro to aDNA and bioarchaeologykwopschall
 
wheat genome project.pptx
wheat genome project.pptxwheat genome project.pptx
wheat genome project.pptxBhagya246626
 
Michel digital nomenclature-gna-zoobank-2014-co-namesconfv2
Michel digital nomenclature-gna-zoobank-2014-co-namesconfv2Michel digital nomenclature-gna-zoobank-2014-co-namesconfv2
Michel digital nomenclature-gna-zoobank-2014-co-namesconfv2Ellinor Michel
 
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison DelhiMolecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison DelhiPat (JS) Heslop-Harrison
 
Communications
CommunicationsCommunications
Communicationssomasushma
 
In situ hybridization results and examples for course Trude Schwarzacher
In situ hybridization results and examples for course Trude SchwarzacherIn situ hybridization results and examples for course Trude Schwarzacher
In situ hybridization results and examples for course Trude SchwarzacherPat (JS) Heslop-Harrison
 
Comparing the Amount and Quality of Information from Different Sequencing Str...
Comparing the Amount and Quality of Information from Different Sequencing Str...Comparing the Amount and Quality of Information from Different Sequencing Str...
Comparing the Amount and Quality of Information from Different Sequencing Str...jembrown
 
10 rapid molecular evolution in a living fossil
10 rapid molecular evolution in a living fossil10 rapid molecular evolution in a living fossil
10 rapid molecular evolution in a living fossilJoão Soares
 
Overview on arabidopsis and rice genome
Overview on arabidopsis and rice genomeOverview on arabidopsis and rice genome
Overview on arabidopsis and rice genomeGopal Singh
 
Effects of density on spacing patterns and habitat associations of a Neotropi...
Effects of density on spacing patterns and habitat associations of a Neotropi...Effects of density on spacing patterns and habitat associations of a Neotropi...
Effects of density on spacing patterns and habitat associations of a Neotropi...Nicole Angeli
 

Similar a Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia (20)

Technical Research Paper-04242013_DSN-1-final
Technical Research Paper-04242013_DSN-1-finalTechnical Research Paper-04242013_DSN-1-final
Technical Research Paper-04242013_DSN-1-final
 
CSHL
CSHLCSHL
CSHL
 
Intro to aDNA and bioarchaeology
Intro to aDNA and bioarchaeologyIntro to aDNA and bioarchaeology
Intro to aDNA and bioarchaeology
 
wheat genome project.pptx
wheat genome project.pptxwheat genome project.pptx
wheat genome project.pptx
 
Michel digital nomenclature-gna-zoobank-2014-co-namesconfv2
Michel digital nomenclature-gna-zoobank-2014-co-namesconfv2Michel digital nomenclature-gna-zoobank-2014-co-namesconfv2
Michel digital nomenclature-gna-zoobank-2014-co-namesconfv2
 
Langebio 2015
Langebio 2015Langebio 2015
Langebio 2015
 
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison DelhiMolecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
Molecular Cytogenetics - HYM Mohan Ram Heslop-Harrison Delhi
 
Communications
CommunicationsCommunications
Communications
 
In situ hybridization results and examples for course Trude Schwarzacher
In situ hybridization results and examples for course Trude SchwarzacherIn situ hybridization results and examples for course Trude Schwarzacher
In situ hybridization results and examples for course Trude Schwarzacher
 
Ecogen2013
Ecogen2013Ecogen2013
Ecogen2013
 
Comparing the Amount and Quality of Information from Different Sequencing Str...
Comparing the Amount and Quality of Information from Different Sequencing Str...Comparing the Amount and Quality of Information from Different Sequencing Str...
Comparing the Amount and Quality of Information from Different Sequencing Str...
 
Big data nebraska
Big data nebraskaBig data nebraska
Big data nebraska
 
Chromosomes cymbidoidae
Chromosomes cymbidoidaeChromosomes cymbidoidae
Chromosomes cymbidoidae
 
Big data nebraska
Big data nebraskaBig data nebraska
Big data nebraska
 
10 rapid molecular evolution in a living fossil
10 rapid molecular evolution in a living fossil10 rapid molecular evolution in a living fossil
10 rapid molecular evolution in a living fossil
 
Overview on arabidopsis and rice genome
Overview on arabidopsis and rice genomeOverview on arabidopsis and rice genome
Overview on arabidopsis and rice genome
 
Toronto 2015
Toronto 2015Toronto 2015
Toronto 2015
 
Danforth 2015
Danforth 2015Danforth 2015
Danforth 2015
 
U1 and U2 Exam Review from 28May
U1 and U2 Exam Review from 28MayU1 and U2 Exam Review from 28May
U1 and U2 Exam Review from 28May
 
Effects of density on spacing patterns and habitat associations of a Neotropi...
Effects of density on spacing patterns and habitat associations of a Neotropi...Effects of density on spacing patterns and habitat associations of a Neotropi...
Effects of density on spacing patterns and habitat associations of a Neotropi...
 

Más de Pat (JS) Heslop-Harrison

Saffron Crocus Genetics and Genomics - University of California Davis Seminar
Saffron Crocus Genetics and Genomics - University of California Davis SeminarSaffron Crocus Genetics and Genomics - University of California Davis Seminar
Saffron Crocus Genetics and Genomics - University of California Davis SeminarPat (JS) Heslop-Harrison
 
Evolution, biodiversity and the banana pangenome
Evolution, biodiversity and the banana pangenomeEvolution, biodiversity and the banana pangenome
Evolution, biodiversity and the banana pangenomePat (JS) Heslop-Harrison
 
Biodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-HarrisonBiodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
Heslop harrison dessalegnethiopiafeb2020withmeetingtitle
Heslop harrison dessalegnethiopiafeb2020withmeetingtitleHeslop harrison dessalegnethiopiafeb2020withmeetingtitle
Heslop harrison dessalegnethiopiafeb2020withmeetingtitlePat (JS) Heslop-Harrison
 
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...Pat (JS) Heslop-Harrison
 
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...Pat (JS) Heslop-Harrison
 
In situ hybridization methods and techniques course slides Pat Heslop-Harrison
In situ hybridization methods and techniques course slides Pat Heslop-HarrisonIn situ hybridization methods and techniques course slides Pat Heslop-Harrison
In situ hybridization methods and techniques course slides Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal CytogeneticsTandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal CytogeneticsPat (JS) Heslop-Harrison
 
BS1003: The transition to flowering. Pat Heslop-Harrison
BS1003: The transition to flowering. Pat Heslop-HarrisonBS1003: The transition to flowering. Pat Heslop-Harrison
BS1003: The transition to flowering. Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
BS1003 - Light and plant development lecture
BS1003 - Light and plant development lectureBS1003 - Light and plant development lecture
BS1003 - Light and plant development lecturePat (JS) Heslop-Harrison
 
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory TalkHeslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory TalkPat (JS) Heslop-Harrison
 
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-HarrisonDomestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-HarrisonPat (JS) Heslop-Harrison
 
Heslop-Harrison Plant development and meristems BS1003
Heslop-Harrison Plant development and meristems BS1003Heslop-Harrison Plant development and meristems BS1003
Heslop-Harrison Plant development and meristems BS1003Pat (JS) Heslop-Harrison
 
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...Pat (JS) Heslop-Harrison
 

Más de Pat (JS) Heslop-Harrison (15)

HeslopHarrisonDurhamFlax.pptx
HeslopHarrisonDurhamFlax.pptxHeslopHarrisonDurhamFlax.pptx
HeslopHarrisonDurhamFlax.pptx
 
Saffron Crocus Genetics and Genomics - University of California Davis Seminar
Saffron Crocus Genetics and Genomics - University of California Davis SeminarSaffron Crocus Genetics and Genomics - University of California Davis Seminar
Saffron Crocus Genetics and Genomics - University of California Davis Seminar
 
Evolution, biodiversity and the banana pangenome
Evolution, biodiversity and the banana pangenomeEvolution, biodiversity and the banana pangenome
Evolution, biodiversity and the banana pangenome
 
Biodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-HarrisonBiodiversity and Super Domestication Seminar Pat Heslop-Harrison
Biodiversity and Super Domestication Seminar Pat Heslop-Harrison
 
Heslop harrison dessalegnethiopiafeb2020withmeetingtitle
Heslop harrison dessalegnethiopiafeb2020withmeetingtitleHeslop harrison dessalegnethiopiafeb2020withmeetingtitle
Heslop harrison dessalegnethiopiafeb2020withmeetingtitle
 
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
Genomics, mutation breeding and society - IAEA Coffee & Banana meeting - Schw...
 
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
Trude Schwarzacher: #ECA2015 European Cytogenetics Conference plenary talk:15...
 
In situ hybridization methods and techniques course slides Pat Heslop-Harrison
In situ hybridization methods and techniques course slides Pat Heslop-HarrisonIn situ hybridization methods and techniques course slides Pat Heslop-Harrison
In situ hybridization methods and techniques course slides Pat Heslop-Harrison
 
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal CytogeneticsTandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
Tandem Repeats and Satellite DNA in Bovideae - Colloquium on Animal Cytogenetics
 
BS1003: The transition to flowering. Pat Heslop-Harrison
BS1003: The transition to flowering. Pat Heslop-HarrisonBS1003: The transition to flowering. Pat Heslop-Harrison
BS1003: The transition to flowering. Pat Heslop-Harrison
 
BS1003 - Light and plant development lecture
BS1003 - Light and plant development lectureBS1003 - Light and plant development lecture
BS1003 - Light and plant development lecture
 
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory TalkHeslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
Heslop-Harrison Stochastic Modelling in Ecosystems - Introductory Talk
 
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-HarrisonDomestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
Domestication, Diversity and Molecular Cytogenetics Pat Heslop-Harrison
 
Heslop-Harrison Plant development and meristems BS1003
Heslop-Harrison Plant development and meristems BS1003Heslop-Harrison Plant development and meristems BS1003
Heslop-Harrison Plant development and meristems BS1003
 
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
Biology: First lecture for Cell and Developmental Biology #bs1003 bs1003 Leic...
 

Último

Sanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdfSanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdfsanyamsingh5019
 
fourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingfourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingTeacherCyreneCayanan
 
Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)eniolaolutunde
 
Web & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfWeb & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfJayanti Pande
 
social pharmacy d-pharm 1st year by Pragati K. Mahajan
social pharmacy d-pharm 1st year by Pragati K. Mahajansocial pharmacy d-pharm 1st year by Pragati K. Mahajan
social pharmacy d-pharm 1st year by Pragati K. Mahajanpragatimahajan3
 
Activity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfActivity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfciinovamais
 
Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Disha Kariya
 
9548086042 for call girls in Indira Nagar with room service
9548086042  for call girls in Indira Nagar  with room service9548086042  for call girls in Indira Nagar  with room service
9548086042 for call girls in Indira Nagar with room servicediscovermytutordmt
 
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...PsychoTech Services
 
Interactive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communicationInteractive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communicationnomboosow
 
Disha NEET Physics Guide for classes 11 and 12.pdf
Disha NEET Physics Guide for classes 11 and 12.pdfDisha NEET Physics Guide for classes 11 and 12.pdf
Disha NEET Physics Guide for classes 11 and 12.pdfchloefrazer622
 
Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxVishalSingh1417
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhikauryashika82
 
Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111Sapana Sha
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...christianmathematics
 
Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104misteraugie
 
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...fonyou31
 

Último (20)

Sanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdfSanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdf
 
Código Creativo y Arte de Software | Unidad 1
Código Creativo y Arte de Software | Unidad 1Código Creativo y Arte de Software | Unidad 1
Código Creativo y Arte de Software | Unidad 1
 
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptxINDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
 
fourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingfourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writing
 
Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)
 
Web & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdfWeb & Social Media Analytics Previous Year Question Paper.pdf
Web & Social Media Analytics Previous Year Question Paper.pdf
 
social pharmacy d-pharm 1st year by Pragati K. Mahajan
social pharmacy d-pharm 1st year by Pragati K. Mahajansocial pharmacy d-pharm 1st year by Pragati K. Mahajan
social pharmacy d-pharm 1st year by Pragati K. Mahajan
 
Activity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfActivity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdf
 
Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..
 
9548086042 for call girls in Indira Nagar with room service
9548086042  for call girls in Indira Nagar  with room service9548086042  for call girls in Indira Nagar  with room service
9548086042 for call girls in Indira Nagar with room service
 
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
 
Interactive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communicationInteractive Powerpoint_How to Master effective communication
Interactive Powerpoint_How to Master effective communication
 
Mattingly "AI & Prompt Design: The Basics of Prompt Design"
Mattingly "AI & Prompt Design: The Basics of Prompt Design"Mattingly "AI & Prompt Design: The Basics of Prompt Design"
Mattingly "AI & Prompt Design: The Basics of Prompt Design"
 
Disha NEET Physics Guide for classes 11 and 12.pdf
Disha NEET Physics Guide for classes 11 and 12.pdfDisha NEET Physics Guide for classes 11 and 12.pdf
Disha NEET Physics Guide for classes 11 and 12.pdf
 
Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptx
 
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in DelhiRussian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
Russian Escort Service in Delhi 11k Hotel Foreigner Russian Call Girls in Delhi
 
Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104Nutritional Needs Presentation - HLTH 104
Nutritional Needs Presentation - HLTH 104
 
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
 

Chromosomes, Crops and Superdomestication - Pat Heslop-Harrison Malaysia

  • 1. Chromosomes, Crops and Superdomestication Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com and www.molcyt.org Twitter, YouTube and Slideshare: pathh1 17 December 2013 10-12
  • 3. Outputs –CROPS – Fixed energy – Light – Heat – Water – Gasses – Nutrients 3 Inputs –Light –Heat –Water –Gasses –Nutrients
  • 4.
  • 5. Apollo 17 – The Blue Marble December 7, 1972 NASA The Blue Marble Apollo 17 7 Dec 1972
  • 6. We’ve done that before … Coming out of ice age at time of recognizably modern humans 50,000 yrs ago Coming up to the start of agriculture 10,000 yrs ago During agricultural clearances 2,000 and 1,000 yrs ago During better cultivation 150 yrs ago 20th Century: Drainage/fertilization/crop protection … and nearly every other ‘species’ tries to do it … goats, pines, viruses
  • 7. Burren West Ireland Mediaeval: Peat forest 1500 years of overgrazing Eroded to bedrock (now a preserved landscape!)
  • 8. st 21 C: Population increase higher living standards / health fossil fuel use climate change water …
  • 9. Life on the edge … Verge of stability for fire with 20% oxygen Water – quality and quantity Temperature – too hot or cold ABIOTIC FACTORS
  • 10.
  • 11. 11
  • 12. • Brazil slash and burn • Malaysian cut out ganoderma plants
  • 13. Ecosystems anchor slide Largely – Self-organizing – Self-maintained – Cycling – Defined scope – cf University – Household – Aircraft – 13
  • 14. Outputs –CROPS – Fixed energy – Light – Heat – Water – Gasses – Nutrients 14 Inputs –Light –Heat –Water –Gasses –Nutrients
  • 15. Outputs Ecosystem Services Water, gasses, nutrients ”nature’s services, like flood control, water filtration, waste assimilation”
  • 16. Ecosystem cycling threatened by stress and Abiotic instability Water Fire Wind Biotic Virus, bacteria, fungi Weeds, insects Nematodes etc. Alien invasions 16
  • 18. 18 Occasional ‘extreme inputs’: Limiting composition of ecosystems more than ‘mean input’ - Robustness
  • 19.
  • 20. Water hyacinth – Eichornia: an invasive alien plant from South America, fills water courses (a surface habitat not used by any native species) in Asia and Africa 20
  • 21. 21 Argenome mexicana: a goat-proof plant from Mexcio introduced and successful in Africa
  • 22. Anhalt, Barth, HH Euphytica 2009 Theor App Gen 200
  • 23. 23
  • 24. 24
  • 25.
  • 26. 50 years of plant breeding progress 4 Maize Rice Wheat Human Area 3.5 3 Agronomy 2.5 2 1.5 1 0.5 0 1961 1970 1980 1990 2000 2007
  • 27. 27
  • 28.
  • 29. • 50% of the world's protein needs are derived from atmospheric nitrogen fixed by the Haber-Bosch process and its successors. • Global consumption of fertilizer (chemically fixed nitrogen) 80 million tonnes • <<200 million tonnes fixed naturally
  • 30.
  • 31.
  • 32. Outputs –Crops (Chemical energy) – Food – Feed – Fuel – Fibre – Flowers – Pharmaceuticals – Fun 32
  • 33. 50 years of plant breeding progress 4 Maize Rice Wheat Human Area Genetics 3.5 3 2.5 2 1.5 1 0.5 0 1961 1970 1980 1990 2000 2007
  • 34. UK Wheat 1948-2007 52,909 data points, 308 varieties From Ian Mackay, NIAB, UK. 2009. Re-analyses of historical series of variety trials: lessons from the past and opportunities for the future. SCRI website.
  • 35. Conventional Breeding • Cross the best with the best and hope for something better Superdomestication • Decide what is wanted and then plan how to get it – – – – – Variety crosses Mutations Hybrids (sexual or cell-fusion) Genepool Transformation
  • 36. Economic growth • Separate into increases in inputs (resources, labour and capital) and technical progress • 90% of the growth in US output per worker is attributable to technical progress Robert Solow – Economist
  • 37.
  • 39.
  • 40. BIODIVERSITY and genetic resources Red - AAA Palayam codan AAB (two bunch yellow, one green) Peyan ABB (green cooking banana), Njalipoovan AB (yellow) Robusta AAA (green ripe) Nendran AAB Poovan AAB (one yellow bunch) Red AAA Peyan Varkala, Kerala, India
  • 41.
  • 43. Genomics • Study of the structure, diversity, function and behaviour of all the DNA in an organism, organelle or virus ata clone MuG9, genomic, 73268bp gaaatccaatcaatccagatcaatattgatcgggttctg tgacgaagcagtcaaactgatcactaaaattcaatacat ggagtgctgatttcagaaacttaatcccttctgatagaa ccaacttacactaattagtcttaaaactcattaaggttg aataaatgtcatattacccttccaggtcataaacagctt aatgctgaagctattggcattacacttagtcttaacttc atttaacgatatgacaatcaataatgagataggcaaata aaaatgacatttttttgaactctgcagaattagctccta atcctttagtgaatgcagacaaggaatcagtaaccactg
  • 44.
  • 45. Triticale: wheat x rye hybrid
  • 46. Wheat evolution and hybrids Triticum uratu 2n=2x=14 AA Aegilops speltoides relative 2n=2x=14 Triticum tauschii BB (Aegilops squarrosa) Triticum dicoccoides 2n=4x=28 AABB Einkorn Triticum monococcum 2n=2x=14 Rye AA Secale cereale 2n=2x=14 RR Durum/Spaghetti Triticum turgidum ssp durum 2n=4x=28 AABB 2n=2x=14 DD Bread wheat Triticum aestivum 2n=6x=42 AABBDD Triticale xTriticosecale 2n=6x=42 AABBRR
  • 47. Crop standing Lodging in cereals Crop fallen
  • 48. Use of repetitive DNA sequences as chromosome markers
  • 50.
  • 51. Differences between genomes Major differences in the nature and amount of repetitive DNA • dpTa1 tandem repeat • 45S rDNA
  • 52. Inheritance of Chromosome 5D Aegilops ventricosa DDNN × Triticum persicum Ac.1510 AABB ABDN AABBDDNN × Marne AABBDD VPM1 × Hobbit CWW1176-4 Rendezvous dpTa1 pSc119.2 Genomic Ae.ventricosa Piko Dwarf A × Virtue × {Kraka × (Huntsman × Fruhgold)} 96ST61
  • 53. Multiple repeat (dpTa1) variants of each chromosome e.g. 5DL Bardsley, Schwarzacher & HH
  • 54. S 1A L Multiple dpTa1 variants of each chromosome S 2A L S e.g. 5DL 3A L S 4A L S 5A L S 6A L S 7A L 5BS. 5BL. 7BS 7BL Bardsley, Schwarzacher & HH
  • 55. Proportion of chromosome arms with identical in situ signal Correlation between genetic relationships and similarity of dpTa1 hybridization 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0 0 0.1 0.2 0.3 0.4 0.5 0.6 Coefficient of parentage 0.7 0.8 0.9 1
  • 56. • • • • Tandem Repeats Where each arrow is a single unit of a repeat – - often a multiple of 180 bp but up to 10kb long Head-to-tail organization TCGCTAGA TCGCTAGA TCGCTAGA TCGCTAGA TCGCTAGA TCGCTAGT TCGCTAGA TCGCTAGA
  • 57. ancestral High-copy number A High-copy number B Low-copy number High-copy number C High-copy number D Low-copy number High copy spp: homogenized, amplification from a limited number of master copies Low copy spp: much variation Kuhn, Schwarzacher, PHH
  • 58. Use of repetitive DNA sequences as chromosome markers
  • 59. Wheat Streak Mosaic Virus in North America Bob Graybosch, USDA
  • 60. Wsm-1: only highly effective source of resistance to WSMV
  • 61. Mace wheat Graybosch et al. 2009 In situ: Niaz Ali & Schwarzacher
  • 62.
  • 63.
  • 64. Retroelements Sequences which amplify through an RNA intermediate •50% of all the DNA!
  • 65. Retroelement Markers Insertion LTR Retrotransposon LTR IRAP – InterRetroelement PCR LTR LTR Retrotransposon Retrotransposon LTR LTR LTR LTR LTR Retrotransposon Retrotransposon LTR Retrotransposon LTR LTR
  • 66. UPGMA dendrograms of the relationships based on IRAP analysis of (A) accessions of Ae. tauschii subsp Copyright restrictions may apply. Saeidi, H. et al. Ann Bot 2008 101:855-861; doi:10.1093/aob/mcn042
  • 67.
  • 68. Retroelements •Homologous BAC sequences from Calcutta 4 Homologous over the full length •except for a 5kb insert •a Ty1-copia retroelement
  • 69. Musa balbisiana (MBP 81C12) hAT 1 1676 TE Musa acuminata (MA4 82I11) 384 bp TE + 781 MITE Microsatellite (AT) hAT 2 Transposed Element 621 bp MBT hAT 3 4192 bp TE Sr. No. Primer Pairs Product Size (bp) Sequence hAT 4 1. hAT18486 hAT19037 560 ACCCACCTGGCTCTTGTGTC AGCGAATGTGTTTTGACCAC Microsatellite (AT) MBP 81C12 (M. balbisiana) x MA4 82I11 (M. acuminata) BACs.69 16/12/2013
  • 70. 1KB 800 600 400 200 HP-1 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 hAT1 insertion sites in Musa diversity collection hAT486F and hAT037R Top bands (560-bp) amplified hAT element and lower bands amplifying the flanking 16/12/2013 70 sequences only – Menzel, Nouroz, Schmidt, Schwarzacher, Heslop-Harrison 2013/14
  • 71. Size and location of chromosome regions from radish (Raphanus sativus) carrying the fertility restorer Rfk1 gene and transfer to spring turnip rape (Brassica rapa)
  • 72. Chromosome and genome engineering Cell fusion hybrid of two 4x tetraploid tobacco species Patel, Badakshi, HH, Dav ey et al 2011 Annals of Botany
  • 73. Nicotiana hybrid 4x + 4x cell fusions Each of 4 chromosome sets has distinctive repetitive DNA when probed with genomic DNA Patel et al Ann Bot 2011
  • 74. Diploid 2n=2x=22 Musa / banana metaphase probed red with transposable element Teo & Schwarzacher
  • 75.
  • 76. Six-way Venn diagram showing the distribution of shared gene families (sequence clusters) among M. acuminata, P. dactylifera, Arabidopsis thaliana, Oryza sativa, Sorghum bicolor and Brachypodium distachyon genomes. A D’Hont et al. Nature 000, 1-5 (2012) doi:10.1038/nature11241 A D’Hont et al. Nature 2012 doi:10.1038/nature11241
  • 77.
  • 78. Whole-genome duplication events. A D’Hont et al. Nature 000, 1-5 (2012) doi:10.1038/nature11241
  • 79. A D’Hont et al. Nature 2012 doi:10.1038/nature11241
  • 80.
  • 81. Arachis hypogaea - Peanut Tetraploid of recent origin, ancestors separated only 3 My ago Ana Claudia Araujo, David Bertioli, TS & PHH EMBRAPA, Brasília. Annals of Botany 2013
  • 82. Retroelement abundance and diversity in barley Gypsy elements are present in 25% of all BAC clones Barley gypsy: Vershinin, Druka, Kleinhofs, HH: PMB 2002; cf Brassica Alix & HH PM
  • 83.  Bertioli et al. Annals of Botany 2013 •Arachis hypogea 2n=4x=40 probed with •(green) A. duranensis; (red) A. ipaënsis
  • 84. Oscillations: noise and stability • Stochastic fluctuations – preserve stable oscillations – ensure robustness of the oscillations to cell-to-cell variations • Robustness analysis requires stochastic simulation JongRae Kim et al. Stochastic noise and synchronisation during Dictyostelium aggregation make cAMP oscillations robust. PLoS Computational Biology 2007
  • 85. Weak Stronger Coupling Kim J-R, Shin D, Jung SH, Heslop-Harrison P, Cho K-H. 2010. A design principle underlying the synchronization of oscillations in cellular systems. Journal of Cell Science 123(4): 537-543
  • 86. • Dynamic interactions between dependent modules • • Valeyev et al. Mol Biosyst 2009 5: 612 Kim J-R, Kim J, Kwon Y-K, Lee H-Y, Heslop-Harrison P, Cho K-H. 2011. Reduction of complex signaling networks to a representative kernel. Science Signaling 4, ra35. doi: 10.1126/scisignal.2001390
  • 87. • Stable cAMP oscillations in the cells with other molecules/ions Valeyev et al. Mol Biosyst 2009
  • 88. • • • • “Biochemistry explains biology” “Chemistry explains biochemistry” “Physics explains chemistry” “Mathematics explains physics”
  • 89. From Chromosome to Nucleus Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com
  • 90. Outputs –Crops (Chemical energy) – Food – Feed – Fuel – Fibre – Flowers – Pharmaceuticals – Fun 90
  • 91. The genepool has the diversity to address these challenges … New methods to exploit and characterize germplasm let use make better and sustainable use of the genepool Molecular cytogenetics …
  • 92. How to use diversity • Cross two varieties • Genome manipulations • Cross two species and make a new one • Cell fusion hybrids • Chromosome manipulation • Backcross a new species • Generate recombinants • Chromosome recombinations • Transgenic approaches • Use a new species
  • 93. Are there many candidates? • • • • 250,000 plants 4,629 mammals 9,200 birds 10,000,000 insects • But only 200 plants, 15 mammals, 5 birds and 2 insects are domesticated!
  • 94. Nothing special about crop genomes? Crop Genome size 2n Ploidy Food Rice 400 Mb 24 2 3x endosperm Wheat 17,000 Mbp 42 6 3x endosperm Maize 950 Mbp 10 4 (palaeo-tetraploid) 3x endosperm Rapeseed B. napus 1125 Mbp 38 4 Cotyledon oil/protein Sugar beet 758 Mbp 18 2 Modified root Cassava 770 Mbp 36 2 Tuber Soybean 1,100 Mbp 40 4 Seed cotyledon Oil palm 3,400 Mbp 32 2 Fruit mesocarp Banana 500 Mbp 33 3 Fruit mesocarp Heslop-Harrison & Schwarzacher 2012. Genetics and genomics of crop domestication. In Altman & Hasegawa Plant Biotech & Agriculture. 10.1016/B9780-12-381466-1.00001-8 Tinyurl.com/domest
  • 95. Rules for successful domestication • There aren’t any! • Crops come from anywhere (new/old world; temperate/tropical; dry/humid) • They might be grown worldwide • Polyploids and diploids (big genomes-small genomes, many chromosomes-few chromosomes) • Seeds, stems, tubers, fruits, leaves
  • 96. Probably not many more (at least for plants) • Spread of the few species • Little change since early agriculture • Repeated domestication of these species (sometimes) • But wider use of current species with suitable genetic changes, or of newly created hybrids • A few species where wild-collections must be replaced sustainably • New needs – biofuels, neutraceuticals
  • 97. 50 years of plant breeding progress GM maize 4 Maize Rice Wheat Human Area Genetics 3.5 3 Agronomy 2.5 2 1.5 1 0.5 0 1961 1970 1980 1990 2000 2007
  • 98.
  • 99.
  • 100.
  • 101. United Nations Millennium Development Goals-MDGs • Goal 1 – Eradicate extreme poverty and hunger • Goal 2 – Achieve universal primary education • Goal 3 – Promote gender equity and empower women • Goal 4 – Reduce child mortality • Goal 5 – Improve maternal health • Goal 6- Combat HIV/AIDS, malaria and other diseases • Goal 7 - Ensure environmental sustainability • Goal 8 - Develop a global partnership for development
  • 102. Chromosomes, Crops and Superdomestication Pat Heslop-Harrison phh4@le.ac.uk www.molcyt.com and www.molcyt.org Twitter, YouTube and Slideshare: pathh1 17 December 2013 10-12