SlideShare una empresa de Scribd logo
1 de 25
Co-opting the Genetic
Code
DNA Binary Encoding Protocol
Amit Snyderman, ITP Design Frontiers, 2010
Genetic Code
The genetic code is the set of rules by which
information encoded in genetic material is translated
into proteins by living cells.
DNA
Deoxyribonucleic acid (DNA) contains the genetic
instructions used in the development and functioning
of all known living organisms. The main role of DNA
molecules is the long-term storage of information.
Units of the Code
Adenosine (A)
Cytosine (C)
Guanine (G)
Thymine (T)
Codons
Mapping between nucleotide triplets and amino acids
43 combinations = 64 possible codons

http://upload.wikimedia.org/wikipedia/en/d/d6/GeneticCode21-
version-2.svg
Amino Acids
20 amino acids

Just as the letters of the alphabet can be combined to
form an almost endless variety of words, amino acids
can be linked together in varying sequences to form a
vast variety of proteins.

http://upload.wikimedia.org/wikipedia/commons/3/37/Aa.svg
Proteins
Every protein is chemically defined by its unique
sequence of amino acid residues, which in turn define
the three-dimensional structure of the protein.
MIME Base64
Encoding scheme that encodes binary data by treating
it numerically and translating it into a base 64
representation.
      TEXT              M         a         n
     ASCII              77        97       110
   BIT PATTERN    010011010110000101101110
     INDEX          19       22        5        46
 BASE64-ENCODED     T        W         F        u
Remap
Rather than mapping to a character, map to a codon.
VALUE   CHARACTE   CODON     AMINO ACID      VALUE   CHARACTE   CODON    AMINO ACID     VALUE   CHARACTE   CODON     AMINO ACID
           R                                            R                                          R
 0         A       AAA       Lysine (K)       22        W       CCG      Proline (P)     43        r       GGT       Glycine (G)

 1         B       AAC     Asparagine (N)     23        X       CCT      Proline (P)     44        s       GTA       Valine (V)

 2         C       AAG       Lysine (K)       24        Y       CGA     Arginine (R)     45        t       GTC       Valine (V)

 3         D       AAT     Asparagine (N)     25        Z       CGC     Arginine (R)     46        u       GTG       Valine (V)

 4         E       ACA     Threonine (T)      26        a       CGG     Arginine (R)     47        v       GTT       Valine (V)

 5         F       ACC     Threonine (T)      27        b       CGT     Arginine (R)     48        w       TAA         STOP

 6         G       ACG     Threonine (T)      28        c       CTA      Leucine (L)     49        x       TAC      Tyrosine (Y)

 7         H       ACT     Threonine (T)      29        d       CTC      Leucine (L)     50        y       TAG         STOP

 8         I       AGA      Arginine (R)      30        e       CTG      Leucine (L)     51        z       TAT      Tyrosine (Y)

 9         J       AGC       Serine (S)       31        f       CTT      Leucine (L)     52        0       TCA       Serine (S)

 10        K       AGG      Arginine (R)      32        g       GAA     Glutamate (E)    53        1       TCC       Serine (S)

 11        L       AGT       Serine (S)       33        h       GAC     Aspartate (D)    54        2       TCG       Serine (S)

 12        M       ATA      Isoleucine (I)    34        i       GAG     Glutamate (E)    55        3       TCT       Serine (S)

 13        N       ATC      Isoleucine (I)    35        j       GAT     Aspartate (D)    56        4       TGA         STOP

 14        O       ATG     Methionine (M)     36        k       GCA      Alanine (A)     57        5       TGC       Cystine (C)

 15        P       ATT      Isoleucine (I)    37        l       GCC      Alanine (A)     58        6       TGG     Tryptophan (W)

 16        Q       CAA     Glutamine (Q)      38        m       GCG      Alanine (A)     59        7       TGT       Cystine (C)

 17        R       CAC      Histidine (H)     39        n       GCT      Alanine (A)     60        8       TTA       Leucine (L)

 18        S       CAG     Glutamine (Q)      40        o       GGA      Glycine (G)     61        9       TTC     Phenylalanine
                                                                                                                        (F)
 19        T       CAT      Histidine (H)     41        p       GGC      Glycine (G)     62        +       TTG      Leucine (L)

 20        U       CCA       Proline (P)      42        q       GGG      Glycine (G)     63        /       TTT     Phenylalanine
                                                                                                                        (F)
 21        V       CCC       Proline (P)
Example: Hello,
world!
    BASE64       SGVsbG8sIHdvcmxkIQo=
  BASE64 INDEX   18 6 21 44 27 6 60 44 8 7 29 47 28 38 49 36 8 16 40
     DNA         CAGACGCCCGTACGTACGTTAGTAAGAACTCTCGTTCTAGCGTACGCAAG
                 ACAAGGA
    PROTEIN      QTPVRTLVRTLVLAYARQG


Any binary data can be represented: text (unicode),
bitmap, audio, video, etc.
Try It: http://amitsnyderman.com/school/designfrontiers/
encoder.php
Disk is cheap.
Who cares?
Non-Digital Library
Via recombinant DNA technologies, craft a portable,
reproducible, time-resistant library. Embed, grow and
spread in bacteria. Package as a pill. Organic time
capsule.
Spime
"The key to the Spime is identity. A Spime is, by
definition, the protagonist of a documented process. It
is an historical entity with an accessible, precise
trajectory through space and time."
                           –Bruce Sterling, Shaping Things
Spime Ingredients
Unique ID code
History of ownership
Geographical position
Customization details
Public discourse
Etc.
Human
Identification
Tools, artifacts, archeology
Bone structure, teeth, dental records, fingerprints, DNA
Yellowpages, resume, Facebook/LinkedIn/etc, Google
Narrative
Embedded Histories. Family trees and Lineage. Stories.
Junk DNA
Noncoding DNA describes sequences that do not
encode for protein sequences. Much of this DNA has no
known biological function and is sometimes referred to
as "junk DNA".

More than 98% of the human genome is non-coding.
Human Spime
Recycle junk DNA by recombining encoded messages
into non-coding DNA regions.
In-vitro manipulation. Gene therapy.
Hereditary storytelling.

Más contenido relacionado

Último

Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...Neo4j
 
08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking Men08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking MenDelhi Call girls
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerThousandEyes
 
Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Enterprise Knowledge
 
Advantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your BusinessAdvantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your BusinessPixlogix Infotech
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?Igalia
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...apidays
 
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024The Digital Insurer
 
04-2024-HHUG-Sales-and-Marketing-Alignment.pptx
04-2024-HHUG-Sales-and-Marketing-Alignment.pptx04-2024-HHUG-Sales-and-Marketing-Alignment.pptx
04-2024-HHUG-Sales-and-Marketing-Alignment.pptxHampshireHUG
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024Rafal Los
 
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Igalia
 
Breaking the Kubernetes Kill Chain: Host Path Mount
Breaking the Kubernetes Kill Chain: Host Path MountBreaking the Kubernetes Kill Chain: Host Path Mount
Breaking the Kubernetes Kill Chain: Host Path MountPuma Security, LLC
 
08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking Men08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking MenDelhi Call girls
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsEnterprise Knowledge
 
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking MenDelhi Call girls
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Scriptwesley chun
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationMichael W. Hawkins
 
A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024Results
 
Handwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsHandwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsMaria Levchenko
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationSafe Software
 

Último (20)

Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...Workshop - Best of Both Worlds_ Combine  KG and Vector search for  enhanced R...
Workshop - Best of Both Worlds_ Combine KG and Vector search for enhanced R...
 
08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking Men08448380779 Call Girls In Civil Lines Women Seeking Men
08448380779 Call Girls In Civil Lines Women Seeking Men
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
 
Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...Driving Behavioral Change for Information Management through Data-Driven Gree...
Driving Behavioral Change for Information Management through Data-Driven Gree...
 
Advantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your BusinessAdvantages of Hiring UIUX Design Service Providers for Your Business
Advantages of Hiring UIUX Design Service Providers for Your Business
 
A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?A Year of the Servo Reboot: Where Are We Now?
A Year of the Servo Reboot: Where Are We Now?
 
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
Apidays Singapore 2024 - Building Digital Trust in a Digital Economy by Veron...
 
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
 
04-2024-HHUG-Sales-and-Marketing-Alignment.pptx
04-2024-HHUG-Sales-and-Marketing-Alignment.pptx04-2024-HHUG-Sales-and-Marketing-Alignment.pptx
04-2024-HHUG-Sales-and-Marketing-Alignment.pptx
 
The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024The 7 Things I Know About Cyber Security After 25 Years | April 2024
The 7 Things I Know About Cyber Security After 25 Years | April 2024
 
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
Raspberry Pi 5: Challenges and Solutions in Bringing up an OpenGL/Vulkan Driv...
 
Breaking the Kubernetes Kill Chain: Host Path Mount
Breaking the Kubernetes Kill Chain: Host Path MountBreaking the Kubernetes Kill Chain: Host Path Mount
Breaking the Kubernetes Kill Chain: Host Path Mount
 
08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking Men08448380779 Call Girls In Friends Colony Women Seeking Men
08448380779 Call Girls In Friends Colony Women Seeking Men
 
IAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI SolutionsIAC 2024 - IA Fast Track to Search Focused AI Solutions
IAC 2024 - IA Fast Track to Search Focused AI Solutions
 
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
08448380779 Call Girls In Diplomatic Enclave Women Seeking Men
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Script
 
GenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day PresentationGenCyber Cyber Security Day Presentation
GenCyber Cyber Security Day Presentation
 
A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024A Call to Action for Generative AI in 2024
A Call to Action for Generative AI in 2024
 
Handwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed textsHandwritten Text Recognition for manuscripts and early printed texts
Handwritten Text Recognition for manuscripts and early printed texts
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
 

Destacado

2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by Hubspot2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by HubspotMarius Sescu
 
Everything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPTEverything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPTExpeed Software
 
Product Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage EngineeringsProduct Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage EngineeringsPixeldarts
 
How Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental HealthHow Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental HealthThinkNow
 
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdfAI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdfmarketingartwork
 
PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024Neil Kimberley
 
Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)contently
 
How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024Albert Qian
 
Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsKurio // The Social Media Age(ncy)
 
Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Search Engine Journal
 
5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summarySpeakerHub
 
ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd Clark Boyd
 
Getting into the tech field. what next
Getting into the tech field. what next Getting into the tech field. what next
Getting into the tech field. what next Tessa Mero
 
Google's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentGoogle's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentLily Ray
 
Time Management & Productivity - Best Practices
Time Management & Productivity -  Best PracticesTime Management & Productivity -  Best Practices
Time Management & Productivity - Best PracticesVit Horky
 
The six step guide to practical project management
The six step guide to practical project managementThe six step guide to practical project management
The six step guide to practical project managementMindGenius
 
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...RachelPearson36
 

Destacado (20)

2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by Hubspot2024 State of Marketing Report – by Hubspot
2024 State of Marketing Report – by Hubspot
 
Everything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPTEverything You Need To Know About ChatGPT
Everything You Need To Know About ChatGPT
 
Product Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage EngineeringsProduct Design Trends in 2024 | Teenage Engineerings
Product Design Trends in 2024 | Teenage Engineerings
 
How Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental HealthHow Race, Age and Gender Shape Attitudes Towards Mental Health
How Race, Age and Gender Shape Attitudes Towards Mental Health
 
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdfAI Trends in Creative Operations 2024 by Artwork Flow.pdf
AI Trends in Creative Operations 2024 by Artwork Flow.pdf
 
Skeleton Culture Code
Skeleton Culture CodeSkeleton Culture Code
Skeleton Culture Code
 
PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024PEPSICO Presentation to CAGNY Conference Feb 2024
PEPSICO Presentation to CAGNY Conference Feb 2024
 
Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)Content Methodology: A Best Practices Report (Webinar)
Content Methodology: A Best Practices Report (Webinar)
 
How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024How to Prepare For a Successful Job Search for 2024
How to Prepare For a Successful Job Search for 2024
 
Social Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie InsightsSocial Media Marketing Trends 2024 // The Global Indie Insights
Social Media Marketing Trends 2024 // The Global Indie Insights
 
Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024Trends In Paid Search: Navigating The Digital Landscape In 2024
Trends In Paid Search: Navigating The Digital Landscape In 2024
 
5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary5 Public speaking tips from TED - Visualized summary
5 Public speaking tips from TED - Visualized summary
 
ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd ChatGPT and the Future of Work - Clark Boyd
ChatGPT and the Future of Work - Clark Boyd
 
Getting into the tech field. what next
Getting into the tech field. what next Getting into the tech field. what next
Getting into the tech field. what next
 
Google's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search IntentGoogle's Just Not That Into You: Understanding Core Updates & Search Intent
Google's Just Not That Into You: Understanding Core Updates & Search Intent
 
How to have difficult conversations
How to have difficult conversations How to have difficult conversations
How to have difficult conversations
 
Introduction to Data Science
Introduction to Data ScienceIntroduction to Data Science
Introduction to Data Science
 
Time Management & Productivity - Best Practices
Time Management & Productivity -  Best PracticesTime Management & Productivity -  Best Practices
Time Management & Productivity - Best Practices
 
The six step guide to practical project management
The six step guide to practical project managementThe six step guide to practical project management
The six step guide to practical project management
 
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
Beginners Guide to TikTok for Search - Rachel Pearson - We are Tilt __ Bright...
 

Co-opting Genetic Code for Data Storage

  • 1. Co-opting the Genetic Code DNA Binary Encoding Protocol Amit Snyderman, ITP Design Frontiers, 2010
  • 2. Genetic Code The genetic code is the set of rules by which information encoded in genetic material is translated into proteins by living cells.
  • 3. DNA Deoxyribonucleic acid (DNA) contains the genetic instructions used in the development and functioning of all known living organisms. The main role of DNA molecules is the long-term storage of information.
  • 4. Units of the Code Adenosine (A) Cytosine (C) Guanine (G) Thymine (T)
  • 5. Codons Mapping between nucleotide triplets and amino acids 43 combinations = 64 possible codons http://upload.wikimedia.org/wikipedia/en/d/d6/GeneticCode21- version-2.svg
  • 6. Amino Acids 20 amino acids Just as the letters of the alphabet can be combined to form an almost endless variety of words, amino acids can be linked together in varying sequences to form a vast variety of proteins. http://upload.wikimedia.org/wikipedia/commons/3/37/Aa.svg
  • 7. Proteins Every protein is chemically defined by its unique sequence of amino acid residues, which in turn define the three-dimensional structure of the protein.
  • 8. MIME Base64 Encoding scheme that encodes binary data by treating it numerically and translating it into a base 64 representation. TEXT M a n ASCII 77 97 110 BIT PATTERN 010011010110000101101110 INDEX 19 22 5 46 BASE64-ENCODED T W F u
  • 9. Remap Rather than mapping to a character, map to a codon.
  • 10. VALUE CHARACTE CODON AMINO ACID VALUE CHARACTE CODON AMINO ACID VALUE CHARACTE CODON AMINO ACID R R R 0 A AAA Lysine (K) 22 W CCG Proline (P) 43 r GGT Glycine (G) 1 B AAC Asparagine (N) 23 X CCT Proline (P) 44 s GTA Valine (V) 2 C AAG Lysine (K) 24 Y CGA Arginine (R) 45 t GTC Valine (V) 3 D AAT Asparagine (N) 25 Z CGC Arginine (R) 46 u GTG Valine (V) 4 E ACA Threonine (T) 26 a CGG Arginine (R) 47 v GTT Valine (V) 5 F ACC Threonine (T) 27 b CGT Arginine (R) 48 w TAA STOP 6 G ACG Threonine (T) 28 c CTA Leucine (L) 49 x TAC Tyrosine (Y) 7 H ACT Threonine (T) 29 d CTC Leucine (L) 50 y TAG STOP 8 I AGA Arginine (R) 30 e CTG Leucine (L) 51 z TAT Tyrosine (Y) 9 J AGC Serine (S) 31 f CTT Leucine (L) 52 0 TCA Serine (S) 10 K AGG Arginine (R) 32 g GAA Glutamate (E) 53 1 TCC Serine (S) 11 L AGT Serine (S) 33 h GAC Aspartate (D) 54 2 TCG Serine (S) 12 M ATA Isoleucine (I) 34 i GAG Glutamate (E) 55 3 TCT Serine (S) 13 N ATC Isoleucine (I) 35 j GAT Aspartate (D) 56 4 TGA STOP 14 O ATG Methionine (M) 36 k GCA Alanine (A) 57 5 TGC Cystine (C) 15 P ATT Isoleucine (I) 37 l GCC Alanine (A) 58 6 TGG Tryptophan (W) 16 Q CAA Glutamine (Q) 38 m GCG Alanine (A) 59 7 TGT Cystine (C) 17 R CAC Histidine (H) 39 n GCT Alanine (A) 60 8 TTA Leucine (L) 18 S CAG Glutamine (Q) 40 o GGA Glycine (G) 61 9 TTC Phenylalanine (F) 19 T CAT Histidine (H) 41 p GGC Glycine (G) 62 + TTG Leucine (L) 20 U CCA Proline (P) 42 q GGG Glycine (G) 63 / TTT Phenylalanine (F) 21 V CCC Proline (P)
  • 11. Example: Hello, world! BASE64 SGVsbG8sIHdvcmxkIQo= BASE64 INDEX 18 6 21 44 27 6 60 44 8 7 29 47 28 38 49 36 8 16 40 DNA CAGACGCCCGTACGTACGTTAGTAAGAACTCTCGTTCTAGCGTACGCAAG ACAAGGA PROTEIN QTPVRTLVRTLVLAYARQG Any binary data can be represented: text (unicode), bitmap, audio, video, etc. Try It: http://amitsnyderman.com/school/designfrontiers/ encoder.php
  • 13. Non-Digital Library Via recombinant DNA technologies, craft a portable, reproducible, time-resistant library. Embed, grow and spread in bacteria. Package as a pill. Organic time capsule.
  • 14.
  • 15.
  • 16. Spime "The key to the Spime is identity. A Spime is, by definition, the protagonist of a documented process. It is an historical entity with an accessible, precise trajectory through space and time." –Bruce Sterling, Shaping Things
  • 17. Spime Ingredients Unique ID code History of ownership Geographical position Customization details Public discourse Etc.
  • 18. Human Identification Tools, artifacts, archeology Bone structure, teeth, dental records, fingerprints, DNA Yellowpages, resume, Facebook/LinkedIn/etc, Google
  • 19.
  • 20.
  • 21.
  • 22.
  • 23. Narrative Embedded Histories. Family trees and Lineage. Stories.
  • 24. Junk DNA Noncoding DNA describes sequences that do not encode for protein sequences. Much of this DNA has no known biological function and is sometimes referred to as "junk DNA". More than 98% of the human genome is non-coding.
  • 25. Human Spime Recycle junk DNA by recombining encoded messages into non-coding DNA regions. In-vitro manipulation. Gene therapy. Hereditary storytelling.

Notas del editor