SEMINARIO DE ACIDOS NUCLEICOSUNIVERSIDAD POPULAR DEL CESAR 2007<br /><ul><li>INTEGRACIÓN DE LAS TIC EN EL AULA
PROFESORA: CANDIDA BARRIOS
MONITORES: </li></ul>                                DAYRO DE LA CRUZ<br />                                OSCAR MEJIA<br ...
<ul><li>OBJETIVO:  FACILITAR Y MEJORAR LA COMPRENSION DE LA ESTRUCTURA DEL ADN Y DE LOS PROCESOS DE REPLICACIÓN, TRANSCRIP...
APLICAR LAS NUEVAS TECNICAS DE LA INFORMACIÓN Y LA COMUNICACIÓN.
PERMITIR QUE SE DESARROLLE LA INVESTIGACIÓN EN LOS MIEMBROS DEL CURSO DE BIOLOGIA CELULAR.</li></li></ul><li>CONCEPTO<br /...
Entre las principales funciones de estos ácidos tenemos:<br /><ul><li>Duplicación del ADN
Expresión del mensaje genético:
Transcripción del ADN para formar ARN y otros</li></ul>- Traducción, en los ribosomas, del mensaje contenido en el  ARN a ...
HISTORIA DEL DESCUBRIMIENTO DE LA ESTRUCTURA DEL ADN<br />
CLASIFICACION DE LOS ACIDOS NUCLEICOS<br />De acuerdo a la composición química, los ácidos nucleicos se clasifican en ácid...
ESTRUCTURA MOLECULAR DEL ADN Y ARN<br />ADN                                     ARN         <br />
ESTRUCTURA<br />El conocimiento de la estructura de los ácidos nucleicos permitió la elucidación del código genético, la d...
ESTRUCTURA<br />Los nucleótidos están formados por una base nitrogenada, un grupo fosfato y un azúcar; ribosa en caso de A...
ESTRUCTURA<br />
ADN<br />Características principales del ADN:<br />- Polímero de desoxirribonucleótidos que se unen en cadena.<br /><ul><l...
Ambas cadenas se unen por sus bases nitrogenadas.
Entre las bases nitrogenadas enfrentadas se forman uniones fácilmente rompibles llamadas puentes de hidrógeno.</li></ul>Fu...
Propiedades del DNA<br /><ul><li> Insolubles en soluciones diluidas de NaCl
Soluble en soluciones concentradas de NaCl
Insoluble en alcohol
Puede ser disociado de la proteína por tratamiento con un detergente o un fenol</li></li></ul><li>NIVELES DE COMPOSICION D...
ESTRUCTURA SECUNDARIA  DEL                              <br />                           ADN<br />Es una estructura en dob...
- La equivalencia de bases de Chargaff,que dice que la suma de adeninas más guaninas es igual a la suma de timinas más cit...
ESTRUCTURA TERCIARIA DEL ADN.<br />Se refiere a como se almacena el ADN en un volumen reducido. Varía según se trate de or...
b) En eucariontes el empaquetamiento ha de ser más complejo y compacto y para esto necesita la presencia de proteinas, com...
DESNATURALIZACIÓN DEL ADN.<br />Al enfriar lentamente puede renaturalizarse. <br />
CLASIFICACION DEL ADN<br /><ul><li>SEGÚN ESTRUCTURA
MONOCATENARIO
BICATENARIO
SEGÚN  FORMA DE EMPAQUETARSE
ADN MAS HISTONAS
ADN MAS PROTEINAS NO HISTONAS</li></li></ul><li>ARN<br />Características del ARN:<br /><ul><li>Polímero de ribonucleótido ...
Esa cadena forma una hélice simple.
Presenta iguales bases nitrogenadas que el ADN, pero reemplaza a la timina (T) por el uracilo (U).
La pentosa que posee es la ribosa, de ahí el nombre del nucleótido.
Es escaso en el núcleo, formando un elemento llamado nucléolo; muy abundante en el citoplasma, especialmente formando orga...
Insoluble en alcohol
Puede ser disociado de las proteínas por tratamiento con un detergente o un fenol</li></li></ul><li>NIVELES DE COMPOSICION...
ESTRUCTURA SECUNDARIA DEL ARN<br />Alguna vez, en una misma cadena, existen regiones con secuencias complementarias capace...
ESTRUCTURA TERCIARIA DE ARN<br />Es un plegamiento, complicado, sobre al estructura secundaria.<br />
CLASIFICACIÓN DE LOS ARN.<br />Para clasificarlos se adopta la masa molecular media de sus cadenas, cuyo valor se deduce d...
En los eucariontes se puede distinguir también:<br />- Exones, secuencias de bases que codifican proteinas<br />- Intrones...
ARN RIBOSÓMICO (ARNr)<br />Sus principales características son:<br />- Cada ARNr  presenta cadena de diferente tamaño, con...
ARN NUCLEOLAR (ARNn)<br />Sus características principales son:<br />- Se sintetiza en el nucleolo.<br />- Posee una masa m...
ARN TRANSFERENTE (ARNt)<br />Sus principales características son.<br />- Son moléculas de pequeño tamaño<br />- Poseen en ...
SINTESIS Y LOCALIZACIÓN DE LOS ARN<br />En la célula eucarionte los ARN se sintetizan gracias a tres tipos de enzimas:<br ...
NUCLEOTIDOS<br />
COMPONENTES<br /> <br /> Los nucleótidos están formados por: una base nitrogenada (BN), un azúcar (A) y ácido fosfórico (P...
EL AZÚCAR (PENTOSA)<br />
ACIDO FOSFORICO<br />Unión Fosfodiester en los Ácidos Nucleicos.<br />
Figura 1.1.1.G.-Estructura de los Pares de Bases.<br />
NUCLEOSIDOS<br />
IMPORTANCIA DE LOS NUCLEOTIDOS<br /><ul><li> ACUMULADORAS Y DONANTES DE ENRGIA
FUNCION COENZIMATICA</li></li></ul><li>Extremo 5’<br />Polinucleótido<br />Enlace<br />fosfodiéster<br />Extremo 3’<br />
Formas de representación de polinucleótidos<br />5’- CpApTpTpGpCpGpGpApApTpGpCpCp -3’<br />5’-CATTGCGGAATGCC-3’<br />3’-GT...
3’<br />5’<br />Polinucleótido<br />en doble hélice<br />5’<br />3’<br />
Propiedades de los polinucleótidos, 1<br />1. Absorción de luz UV a 260 nm<br />Hipocromismo<br />% A260,<br />120<br />En...
Propiedades de los polinucleótidos, 2<br />2. Reacción positiva de los polidesoxirribonucleótidos a la<br />   difenilamin...
Rotura química de polinucleótidos<br />- Tratando un polinucleótido (DNA) con dimetil sulfato (DMS)<br />tiene lugar la me...
Próxima SlideShare
Cargando en…5
×

Acidos nucleicos

20.853 visualizaciones

Publicado el

Breve explicación acerca de los ácidos nucleicos

Publicado en: Salud y medicina
0 comentarios
5 recomendaciones
Estadísticas
Notas
  • Sé el primero en comentar

Sin descargas
Visualizaciones
Visualizaciones totales
20.853
En SlideShare
0
De insertados
0
Número de insertados
2
Acciones
Compartido
0
Descargas
157
Comentarios
0
Recomendaciones
5
Insertados 0
No insertados

No hay notas en la diapositiva.

Acidos nucleicos

  1. 1. SEMINARIO DE ACIDOS NUCLEICOSUNIVERSIDAD POPULAR DEL CESAR 2007<br /><ul><li>INTEGRACIÓN DE LAS TIC EN EL AULA
  2. 2. PROFESORA: CANDIDA BARRIOS
  3. 3. MONITORES: </li></ul> DAYRO DE LA CRUZ<br /> OSCAR MEJIA<br /> YANNA BELL ROMERO<br />FACULTAD DE INGENIERAS<br />AGROINDUSTRIA<br />
  4. 4. <ul><li>OBJETIVO: FACILITAR Y MEJORAR LA COMPRENSION DE LA ESTRUCTURA DEL ADN Y DE LOS PROCESOS DE REPLICACIÓN, TRANSCRIPCIÓN Y TRADUCCIÓN.
  5. 5. APLICAR LAS NUEVAS TECNICAS DE LA INFORMACIÓN Y LA COMUNICACIÓN.
  6. 6. PERMITIR QUE SE DESARROLLE LA INVESTIGACIÓN EN LOS MIEMBROS DEL CURSO DE BIOLOGIA CELULAR.</li></li></ul><li>CONCEPTO<br />Los ácidos nucleicos son las biomoléculas portadoras de la información genética. Tienen una estructura polimérica, lineal, cuyos monómeros son los nucleótidos. El grado de polimerización puede llegar a ser altísimo, con moléculas constituídas por centenares de millones de nucleótidos en una sola estructura covalente. De la misma manera que las proteínas son polímeros lineales aperiódicos de aminoácidos, los ácidos nucleicos lo son de nucleótidos. La aperiodicidad de la secuencia de nucleótidos implica la existencia de información. De hecho, sabemos que los ácidos nucleicos constituyen el depósito de información de todas las secuencias de aminoácidos de todas las proteínas de la célula.<br />
  7. 7. Entre las principales funciones de estos ácidos tenemos:<br /><ul><li>Duplicación del ADN
  8. 8. Expresión del mensaje genético:
  9. 9. Transcripción del ADN para formar ARN y otros</li></ul>- Traducción, en los ribosomas, del mensaje contenido en el  ARN a proteínas.<br />- Sirven de intermediarios en las transferencias de energía en las células (ATP, ADP y otros) o en las transferencias de electrones (NAD+, NADP+, FAD, etc.).<br />
  10. 10. HISTORIA DEL DESCUBRIMIENTO DE LA ESTRUCTURA DEL ADN<br />
  11. 11. CLASIFICACION DE LOS ACIDOS NUCLEICOS<br />De acuerdo a la composición química, los ácidos nucleicos se clasifican en ácidos desoxiribonucleicos (ADN) que se encuentran residiendo en el núcleo celular y algunos organelos, y en ácidos ribonucleicos (ARN) que actúan en el citoplasma. Se conoce con considerable detalle la estructura y función de los dos tipos de ácidos. <br />
  12. 12. ESTRUCTURA MOLECULAR DEL ADN Y ARN<br />ADN ARN <br />
  13. 13. ESTRUCTURA<br />El conocimiento de la estructura de los ácidos nucleicos permitió la elucidación del código genético, la determinación del mecanismo y control de la síntesis de las proteínas y el mecanismo de transmisión de la información genética de la célula madre a las células hijas. <br />A las unidades químicas que se unen para formar los ácidos nucleicos se les denomina nucleótidos y al polímero se le denomina polinucleótido o ácido nucleico. <br />
  14. 14. ESTRUCTURA<br />Los nucleótidos están formados por una base nitrogenada, un grupo fosfato y un azúcar; ribosa en caso de ARN y desoxiribosa en el caso de ADN. <br />Las bases nitrogenadas son las que contienen la información genética y los azúcares y los fosfatos tienen una función estructural formando el esqueleto del polinucleótido. <br />En el caso del ADN las bases son dos purinas y dos pirimidinas. Las purinas son A (Adenina) y G (Guanina). Las pirimidinas son T (Timina) y C (Citosina) . <br />En el caso del ARN también son cuatro bases, dos purinas y dos pirimidinas. Las purinas son A y G y las pirimidinas son C y U (Uracilo). <br />
  15. 15. ESTRUCTURA<br />
  16. 16. ADN<br />Características principales del ADN:<br />- Polímero de desoxirribonucleótidos que se unen en cadena.<br /><ul><li>Dos cadenas se unen entre sí formando una doble hélice.
  17. 17. Ambas cadenas se unen por sus bases nitrogenadas.
  18. 18. Entre las bases nitrogenadas enfrentadas se forman uniones fácilmente rompibles llamadas puentes de hidrógeno.</li></ul>Función del ADN:<br />La información genética almacenada en la secuencia de nucleótidos de ADN sirve para dos propósitos:<br /># Es la fuente de información para la síntesis de todas las moléculas de proteínas de la célula y el organismo.<br /># Provee la información heredada por las células hijas de la progenie.<br />Ambas funciones requieren que las células del ADN sirva como molde, en el primero de los casos para la transcripción de información al ARN y en el segundo, para la replicación de la información en las moléculas hijas de ADN.<br />
  19. 19. Propiedades del DNA<br /><ul><li> Insolubles en soluciones diluidas de NaCl
  20. 20. Soluble en soluciones concentradas de NaCl
  21. 21. Insoluble en alcohol
  22. 22. Puede ser disociado de la proteína por tratamiento con un detergente o un fenol</li></li></ul><li>NIVELES DE COMPOSICION DE ADN<br />ESTRUCTURA PRIMARIA DEL ADN<br />SE TRATA DE LA SECUENCIA DE DESOXIRRIBONUCLEÓTIDOS DE UNA DE LAS CADENAS. LA INFORMACIÓN GENÉTICA ESTÁ CONTENIDA EN EL ORDEN EXACTO DE LOS NUCLEÓTIDOS.<br />
  23. 23. ESTRUCTURA SECUNDARIA DEL <br /> ADN<br />Es una estructura en doble hélice. Permite explicar el almacenamiento de la información genética y el mecanismo de duplicación del ADN. Fué postulada por Watson y Crick,basandose en:<br />- La difracción de rayos X que habían realizado Franklin y Wilkins<br />
  24. 24. - La equivalencia de bases de Chargaff,que dice que la suma de adeninas más guaninas es igual a la suma de timinas más citosinas.<br />Es una cadena doble, dextrógira o levógira, según el tipo de ADN. Ambas cadenas son complementarias, pues la adenina de una se une a la timina de la otra, y la guanina de una a la citosina de la otra. Ambas cadenas son antiparalelas, pues el extremo 3´de una se enfrenta al extremo 5´de la otra.<br />Existen tres modelos de ADN. El ADN de tipo B es el más abundante y es el descubierto por Watson y Crick.<br />
  25. 25. ESTRUCTURA TERCIARIA DEL ADN.<br />Se refiere a como se almacena el ADN en un volumen reducido. Varía según se trate de organismos procariontes o eucariontes:<br />a) En procariontes se pliega como una super-hélice en forma, generalmente, circular y asociada a una pequeña cantidad de proteinas. Lo mismo ocurre en la mitocondrias y en los plastos.<br />
  26. 26. b) En eucariontes el empaquetamiento ha de ser más complejo y compacto y para esto necesita la presencia de proteinas, como son las histonas y otras de naturaleza no histona (en los espermatozoides las proteinas son las protaminas). A esta unión de ADN y proteinas se conoce como cromatina, en la cual se distinguen diferentes niveles de organización:<br />                - Nucleosoma<br />                - Collar de perlas<br />                - Fibra cromatínica<br />                - Bucles radiales<br />                - Cromosoma.<br />
  27. 27. DESNATURALIZACIÓN DEL ADN.<br />Al enfriar lentamente puede renaturalizarse. <br />
  28. 28. CLASIFICACION DEL ADN<br /><ul><li>SEGÚN ESTRUCTURA
  29. 29. MONOCATENARIO
  30. 30. BICATENARIO
  31. 31. SEGÚN FORMA DE EMPAQUETARSE
  32. 32. ADN MAS HISTONAS
  33. 33. ADN MAS PROTEINAS NO HISTONAS</li></li></ul><li>ARN<br />Características del ARN:<br /><ul><li>Polímero de ribonucleótido que forma una sola cadena.
  34. 34. Esa cadena forma una hélice simple.
  35. 35. Presenta iguales bases nitrogenadas que el ADN, pero reemplaza a la timina (T) por el uracilo (U).
  36. 36. La pentosa que posee es la ribosa, de ahí el nombre del nucleótido.
  37. 37. Es escaso en el núcleo, formando un elemento llamado nucléolo; muy abundante en el citoplasma, especialmente formando organoides llamados ribosomas, presentes en células vegetales y animales.</li></li></ul><li>Propiedades del RNA<br /><ul><li>Soluble en soluciones diluidas de NaCl
  38. 38. Insoluble en alcohol
  39. 39. Puede ser disociado de las proteínas por tratamiento con un detergente o un fenol</li></li></ul><li>NIVELES DE COMPOSICION DEL<br /> ARN<br />ESTRUCTURA PRIMARIA DEL ARN<br />Al igual que el ADN, se refiere a la secuencia de las bases nitrogenadas que constituyen sus nucleótidos.<br />
  40. 40. ESTRUCTURA SECUNDARIA DEL ARN<br />Alguna vez, en una misma cadena, existen regiones con secuencias complementarias capaces de aparearse.<br />
  41. 41. ESTRUCTURA TERCIARIA DE ARN<br />Es un plegamiento, complicado, sobre al estructura secundaria.<br />
  42. 42. CLASIFICACIÓN DE LOS ARN.<br />Para clasificarlos se adopta la masa molecular media de sus cadenas, cuyo valor se deduce de la velocidad de sedimentación. La masa molecular y por tanto sus dimensiones se miden en svedberg (S). Según esto tenemos:<br />ARN MENSAJERO (ARNm)<br />Sus características son la siguientes:<br />- Cadenas de largo tamaño con estructura primaria.<br />- Se le llama mensajero porque transporta la información necesaria para la síntesis proteica.<br />- Cada ARNm tiene información para sintetizar una proteina determinada.<br />- Su vida media es corta.<br />a) En procariontes el extremo 5´posee un grupo trifosfato<br />b) En eucariontes en el extremo 5´posee un grupo metil-guanosina unido al trifosfato, y el el extremo 3´posee una cola de poli-A<br />
  43. 43. En los eucariontes se puede distinguir también:<br />- Exones, secuencias de bases que codifican proteinas<br />- Intrones, secuencias sin información.<br />Un ARNm  de este tipo ha de madurar (eliminación de intrones) antes de hacerse funcional. Antes de madurar, el ARNm  recibe el nombre de ARN heterogeneonuclear (ARNhn ).<br />
  44. 44. ARN RIBOSÓMICO (ARNr)<br />Sus principales características son:<br />- Cada ARNr  presenta cadena de diferente tamaño, con estructura secundaria y terciaria.<br />- Forma parte de las subunidades ribosómicas cuando se une con muchas proteinas.<br />- Están vinculados con la síntesis de proteinas.<br />
  45. 45. ARN NUCLEOLAR (ARNn)<br />Sus características principales son:<br />- Se sintetiza en el nucleolo.<br />- Posee una masa molecular de 45 S, que actua como recursor de parte del ARNr, concretamente de los ARNr 28 S (de la subunidad mayor), los ARNr 5,8 S (de la subunidad mayor) y los ARNr 18 S (de la subunidad menor)<br />ARNu<br />Sus principales características son:<br />- Son moléculas de pequeño tamaño<br />- Se les denomina de esta manera por poseer mucho uracilo en su composición<br />- Se asocia a proteinas del núcleo y forma ribonucleoproteinas pequeño nucleares (RNPpn) que intervienen en:<br />                a) Corte y empalme de ARN<br />                b) Maduración en los ARNm  de los eucariontes<br />                c) Obtención de ARNr a partir de ARNn  45 S.<br />
  46. 46. ARN TRANSFERENTE (ARNt)<br />Sus principales características son.<br />- Son moléculas de pequeño tamaño<br />- Poseen en algunas zonas estructura secundaria, lo que va hacer que en las zonas donde no hay bases complementarias adquieran un aspecto de bucles, como una hoja de trebol.<br />- Los plegamientos se llegan a hacer tan complejos que adquieren una estructura terciaria<br />- Su misión es unir aminoácidos y transportarlos hasta el ARNm  para sintetizar proteinas.<br />
  47. 47.
  48. 48. SINTESIS Y LOCALIZACIÓN DE LOS ARN<br />En la célula eucarionte los ARN se sintetizan gracias a tres tipos de enzimas:<br />- ARN polimerasa I, localizada en el nucleolo y se encarga de la sinteis de los ARNr 18 S, 5,8 S y 28 S.<br />- ARN polimerasa II, localizada en el nucleoplasma y se encarga de la síntesis de los ARNhn, es decir de los precursores de los ARNm<br />- ARN polimerasa III, localizada en el nucleoplasma y se encarga de sintetizar los ARNr 5 S y los ARNm.<br />
  49. 49. NUCLEOTIDOS<br />
  50. 50. COMPONENTES<br /> <br /> Los nucleótidos están formados por: una base nitrogenada (BN), un azúcar (A) y ácido fosfórico (P); unidos en el siguiente orden: P-A-BN<br />LAS BASES NITROGENADAS<br />  <br /> <br />Estructura de las Bases Nitrogenadas. <br /> <br /> <br />
  51. 51. EL AZÚCAR (PENTOSA)<br />
  52. 52. ACIDO FOSFORICO<br />Unión Fosfodiester en los Ácidos Nucleicos.<br />
  53. 53. Figura 1.1.1.G.-Estructura de los Pares de Bases.<br />
  54. 54. NUCLEOSIDOS<br />
  55. 55. IMPORTANCIA DE LOS NUCLEOTIDOS<br /><ul><li> ACUMULADORAS Y DONANTES DE ENRGIA
  56. 56. FUNCION COENZIMATICA</li></li></ul><li>Extremo 5’<br />Polinucleótido<br />Enlace<br />fosfodiéster<br />Extremo 3’<br />
  57. 57. Formas de representación de polinucleótidos<br />5’- CpApTpTpGpCpGpGpApApTpGpCpCp -3’<br />5’-CATTGCGGAATGCC-3’<br />3’-GTAACGCCTTACGG-5’<br />
  58. 58. 3’<br />5’<br />Polinucleótido<br />en doble hélice<br />5’<br />3’<br />
  59. 59. Propiedades de los polinucleótidos, 1<br />1. Absorción de luz UV a 260 nm<br />Hipocromismo<br />% A260,<br />120<br />En el DNA doble hélice se da el<br />fenómeno de hipocromismo:<br />el DNA desnaturalizado por el calor<br />absorbe un 20-30 % más que el<br />DNA nativo<br />110<br />100<br />T (ºC)<br />
  60. 60. Propiedades de los polinucleótidos, 2<br />2. Reacción positiva de los polidesoxirribonucleótidos a la<br /> difenilamina y al reactivo de Schiff<br />3. Reacción positiva de los polirribonucleótidos al orcinol<br />4. Reacción con agentes intercalantes (acridinas)<br />5. Hidrólisis completa del RNA con álcali; el DNA es resistente<br />a álcali.<br />
  61. 61. Rotura química de polinucleótidos<br />- Tratando un polinucleótido (DNA) con dimetil sulfato (DMS)<br />tiene lugar la metilación de purinas; por calentamiento a pH neutro<br />se rompe el enlace glicosídico y queda un sitio apurínico; el tra-<br />tamiento ulterior con ácido diluído rompe la cadena por el sitio<br />apurínico.<br />- Tratando un polinucleótido (DNA) con hidrazina se rompe el <br />enlace glicosídico de las pirimidinas, quedando un sitio apirimi-<br />dínico; el tratamiento ulterior con piperidina rompe la cadena por<br />el sitio apirimidínico.<br />
  62. 62.
  63. 63. Calentamiento<br />
  64. 64.
  65. 65. Rotura enzimática de polinucleótidos<br />Endonucleasas: atacan enlaces fosfodiéster situados en<br />el interior de una cadena polinucleotídica, y suelen ser<br />específicas de cada ácido nucleico:<br /> - Ribonucleasas<br /> - Desoxirribonucleasas<br />Exonucleasas: atacan enlaces fosfodiéster situados en los<br />extremos (3’ o 5’) de una cadena polinucleotídica, y suelen<br />atacar indistintamente ambos tipos de ácidos nucleicos:<br /> - Exonucleasa de bazo (rotura tipo b)<br /> - Exonucleasa de veneno de serpiente (rotura tipo a)<br />
  66. 66. Rotura tipo a:<br />Da lugar a una<br />mezcla de<br />5’-nucleótidos<br />
  67. 67. Rotura tipo b:<br />Da lugar a una<br />mezcla de<br />3’-nucleótidos<br />
  68. 68. Endonucleasas:<br /> DNAasa I: rotura completa, tipo a<br /> DNAasa II: rotura completa, tipo b<br /> RNAasa pancreática: rompe (b) enlaces Py-X<br /> RNAasa T-1: rompe (b) enlaces G-X<br /> Endonucleasas de restricción<br />Exonucleasas:<br /> Exonucleasa de bazo: libera 3’-nucleótidos<br /> Exonucleasa de veneno de serpiente: libera 5’-nucleótidos<br />
  69. 69. Endonucleasas de restricción, 1:<br />1. Reconocen secuencias específicas, por lo general palindrómicas:<br />5’- ATCGTTGCCTACAATTGAATTCCCAATAACCCTT -3’<br />3’- TAGCAACGGATGTTAACTTAAGGGTTATTGGGAA -5’<br />La secuencia reconocida en este caso es GAATTC<br />
  70. 70. Endonucleasas de restricción, 2:<br />2. Suelen romper el polinucleótido dejando extremos cohesivos:<br />5’- ATCGTTGCCTACAATTGAATTCCCAATAACCCTT -3’<br />3’- TAGCAACGGATGTTAACTTAAGGGTTATTGGGAA -5’<br />AATTCCCAATAACCCTT -3’<br /> GGGTTATTGGGAA -5’<br />5’- ATCGTTGCCTACAATTG<br />3’- TAGCAACGGATGTTAACTTAA<br />Lo que permite la soldadura de fragmentos de DNA rotos por la<br />misma endonucleasa de restricción<br />
  71. 71. Endonucleasas de restricción, 3:<br />3. Al reconocer secuencias relativamente largas, cortan el DNA<br />por un número muy limitado de sitios, lo que facilita la manipula-<br />ción experimental del mismo.<br />Algunas endonucleasas de restricción:<br />EcoRI GAATTC<br />ClaI ATCGAT<br />HaeIII GGCC<br />RsrII CGGATCCG<br />
  72. 72. Supongamos la secuencia reconocida por la endonucleasa<br />de restricción EcoRI, que es<br />5’-GAATTC-3’<br />En un DNA que contenga 30% de A, 30 % de T, 20 % de G y<br />20 % de C, la probabilidad de encontrar esta secuencia al azar<br />sería de<br />0.2 x 0.3 x 0.3 x 0.3 x 0.3 x 0.2 = 0.000324<br />O lo que es lo mismo, aproximadamente una cada 3086 nucleótidos<br />
  73. 73. MECANISMOS DE REPLICACÓN, TRANSCRIPCION, TRADUCCIÓN<br />
  74. 74. DUPLICACION O REPLICACION<br />LAS DOS CELULAS HIJAS PROVENIENTES DE UNA DIVISION CELULAR CONTIENEN COPIAS IDENTICAS DEL ADN PRESENTE EN LA CELULA QUE SE DIVIDIO<br />PASOS<br /><ul><li>SEPARACION DE LAS CADENAS
  75. 75. LAS BASES NITROGENADAS SE AGREGAN
  76. 76. FORMACION DE ARN MENSAJERO
  77. 77. FLUJO(ENVIO DE LA INFORMACION GENETICA A LOS RIBOSOMAS Y ESPECIFICACION DE LA SINTESIS PROTEICA)</li></li></ul><li>REPLICACIÓN DEL ADN<br />ANIMACIÓN EN LA QUE SE REPRESENTA EL PROCESO DE REPLICACIÓN, LOS ENZIMAS QUE INTERVIENEN Y LA FUNCIÓN DE CADA ENZIMA<br />http://www.biorom.uma.es/contenido/biomodel/biomodel-misc/anim/replic/replic1.html<br />
  78. 78. TRANSCRIPCIÓN<br />ES EL PROCESO DE COPIADO DE LA INFORMACION CONTENIDA EN EL ADN CROMOSOMAL DURANTE LA SINTESIS DEL ARN MENSAJERO<br />http://web.educastur.princast.es/proyectos/biogeo_ov/2BCH/B4_INFORMACION/T404_TRAS_TRADU/animaciones/Presentacion1.pps<br />
  79. 79. TRADUCCIÓN Síntesis de proteínas<br />ES EL PROCESO DE LECTURA EN EL RIBOSOMA DE LA INFORMACION TRANSPORTADA POR EL ARN MENSAJERO DURANTE LA SINTESIS DE PROTEINAS<br />http://web.educastur.princast.es/proyectos/biogeo_ov/2BCH/B4_INFORMACION/T404_TRAS_TRADU/animaciones/Presentacion3.pps<br />
  80. 80. MODIFICADORES<br />RECOMBINACION : Es cuando se modifica la molecula de ADN provenientes de otro organismo.<br />TRANSICION: Cuando es cambiada una pirinida por otra purina.<br />TRANSVERSION: Cuando es cambiada una purina por pirimida.<br />CAMBIO DE MARCO: Cuando se agrga o disminuye bases nitrogenadas.<br />Asi es que se presentan las mutaciones.<br />
  81. 81. MUCHAS GRACIAS<br />

×