SlideShare una empresa de Scribd logo

Pcrhandbook ver4

•
•
Elsa von Licy
Elsa von Licy
1 de 32
Descargar para leer sin conexión
PCR ARRAY . GUIDE v4 0 The Complete Technical Reference to PCR ARRAYS Cancer Cytokines Biomarkers ECM & Adhesion Oxidative Stress Signal Transduction Inflammation Stem Cells MicroRNA Epigenetics Toxicology NEW 100 Selected Peer-reviewed Publications A QIAGEN Company Focus on your PathwayTM
Table of Contents PCR ARRAY Guide v4.0 PCR ARRAY GUIDE version 4.0 RT2 ProfilerTM PCR ARRAYS ................................................................................................................2 The Most Accurate and Sensitive Technology for Pathway-Powered Gene Expression Analysis RT2 Profiler PCR ARRAY System .....................................................................................................4 A Complete and Reliable Solution for Gene Expression Analysis Custom PCR ARRAYS & Assay Design ................................................................................................5 Focus on Your Genes with PCR Arrays Created from Your Gene List RT2 SYBR Green qPCR Master Mixes ..............................................................................................6 ® The Required High-Performance Master Mix for RT2 Profiler PCR Arrays RT2 Profiler PCR ARRAY Performance ..........................................................................................7 Reliable and Reproducible Pathway-focused Gene Expression Analysis RT2 Nano PreAMPTM cDNA Synthesis Technology ..........................................................................8 Enabling the Analysis of One Nanogram of RNA with RT2 Profiler PCR Arrays RT2 FFPE PreAMP cDNA Synthesis Technology............................................................................9 Enabling the Analysis of FFPE Samples with RT2 Profiler PCR Arrays PCR ARRAY Data Analysis Guide ..................................................................................................10 Complete Solutions for Interpreting RT2 Profiler PCR Array Data Service Core for PCR ARRAY Gene Expression Analysis ..................................................10 Complete Set of Quick and Convenient Gene Expression Profilng Services QIAGEN RNeasy Kits ........................................................................................................................11 ® Purification of High-quality Total RNA from a Range of Biological Samples QIAGEN Products for Sample Disruption ................................................................................12 Fast and Effective Disruption of Biological Samples at a Range of Throughputs QIAGEN Products for RNA Stabilization ................................................................................13 Convenient and Immediate Stabilization of RNA in a Range of Biological Samples Research Area-Focused PCR ARRAY Product Listing ...........................................................14 Search Our Complete Catalog of PCR Array Products by Your Area of Research RT2 MicroRNA PCR ARRAYS ................................................................................................................16 Simultaneous Detection of Genome-Wide or Pathway-Focused miRNA QIAGEN miRNeasy Kits ....................................................................................................................18 Purification of Total RNA from a Range of Biological Samples ChampionChIPTM PCR System .............................................................................................................19 Reliable Chromatin IP with Real-time PCR Precision Achieved in Only One Day Methyl-ProfilerTM PCR ARRAY System ..........................................................................................20 Simple, Fast and Reliable DNA Methylation Analysis Without Bisulfite Conversion QIAGEN DNeasy Blood and Tissue Kits ...................................................................................22 ® Purification of Total DNA from Cells, Tissues and Blood QIAGEN QIAamp DNA Mini Kits ....................................................................................................22 ® Purification of Genomic, Mitochondrial, Bacterial, Parasitic, or Viral DNA PreAnalytiX PAXgene DNA System .............................................................................................23 ® ® Collection & Stabilization of Blood or Tissue Samples & Subsequent DNA Purification PCR ARRAY Published Literature ...............................................................................................24 Publications Citing RT2 Profiler PCR Arrays Complete Product Catalog Index .................................................................................................27 Search the Complete Catalog of RT2 Profiler PCR Array Products and Accessories www.SABiosciences.com 1
RT2 Profiler PCR ARRAYS TM The Most Accurate and Sensitive Technology for Pathway Gene Expression Analysis What Are PCR ARRAYS? How PCR ARRAYS Work RT² ProfilerTM PCR Arrays are the most reliable and sensitive gene expression profiling technology for analyzing focused panels of genes in signal transduction, biological process, or disease-related pathways using real-time PCR. Each cataloged PCR Array contains a list of the pathway-focused genes as well as five housekeeping (refererence) genes on the array. Wells H6 through H12 contain a panel of proprietary controls to monitor genomic DNA contamination (HGDC) as well as the first strand synthesis (RTC) and real-time PCR efficiency (PPC). 2. Convert Total RNA to cDNA. Control Experimental 3. Add cDNA to RT2 SYBR® Green Master Mix. Aliquot Mixture Across PCR Array. Why Use RT Profiler PCR ARRAYS? 2 1. Isolate RNA from Cells, Tissues, FFPE and/or Blood. TM Simplicity: The simplicity of RT2 Profiler PCR Arrays makes routine expression profiling practical in any research laboratory with a real-time instrument. 4. Run in Your Real-Time PCR Instrument. Performance: Experimental Profile Control Profile 1.E-000 Delta Rn Profiler PCR Arrays have the sensitivity, reproducibility, specificity, and reliability to accurately profile multiple genes simultaneously in 96- or 384-well formats. 1.E+001 1.E-000 Delta Rn 1.E+001 RT² 1.E-001 1.E-003 1.E-003 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Relevance: 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Cycle Number Cycle Number 5. Data Analysis. 10-6 p-Value for Fold Change Anatomy of a 96-well RT Profiler PCR ARRAY 2 1.E+00 A B A 1.E-01 10-5 Normal Breast RT² Profiler PCR Arrays focus on profiling the genes relevant to the pathways or disease states important to your research. 10-4 10-3 10-2 0 1 2 3 4 CCL2 CCL20 CCL21 CCL23 CCL24 CCL25 CCL26 CCL3 CCL4 CCL8 CCR1 CCR2 CCR8 CCR9 CEBPB CCR3 C5 CCL1 Breast Tumor CCR4 CCR5 CCL11 CCL13 CCL15 CCL16 CCL17 CCL18 CCR6 CCR7 CCL5 CCL7 IL10RA IL10RB IL13 IL13RA1 IL17C IL1A IL1F6 IL1F7 IL1F8 IL1F9 IL1R1 IL1RN IL22 IL5 IL5RA IL9 IL9R LTA LTB LTB4R MIF SCYE1 SPP1 TNF IL1F10 IL1B IL8RA IL8 16 CRP CX3CR1 CXCL1 CXCL10 CXCL11 CXCL12 CXCL13 CXCL14 CXCL2 CXCL3 CXCL5 CXCL6 CXCL9 IL10 SYBR® Green Versus TaqMan® Chemistries IL1F5 IL8RB TaqMan Log2 FC C4A 1.E+00 -1 TIMP3 1.E-01 CCL19 C3 MCAM ITGB4 1.E-02 -2 MMP9 ITGA2 1.E-03 -3 1.E-06 D 2 BCL6 TGFB1 ITGB3 1.E-04 1.E-04 C Fold Change Ratio (log ) ABCF1 1.E-03 1.E-05 -4 CDKN2A FGFR2 1.E-06 1 CCNE1 1.E-02 1.E-05 10-1 D ICEBERG IFNA2 1.E-001 1.E-002 1.E-002 Figure 2: Comparable Biological Results.* Gene expression 12 E = 0.97 R2 = 0.99 8 4 -16 -12 -8 -4 4 -4 8 12 16 -8 86 GENES -12 -16 TNFSF5 TOLLIP XCR1 analysis was compared between RT2 Profiler PCR Arrays (SYBR Green-based) and the TaqMan platform. Regression analysis of fold differences, with data normalized against POLR2A, demonstrate that both platforms yield similar biological results. RT2 PCR Log2 FC HPRT1 RPL13A GAPDH ACTB HOUSEKEEPING (REFERENCE) GENES HGDC RTC RTC RTC GENOMIC REVERSE TRANSCRIPTION CONTROLS DNA CONTROL PPC PPC PPC 25 POSITIVE PCR CONTROLS Figure 1: Each Well in a PCR Array Measures the Expression of a Gene Related to a Pathway or Disease State. The Human Inflammatory Cytokines and Receptors PCR Array in a 96-well format is shown. This is also available in a 384-well format. Figure 3: Sensitivity with RT2 SYBR Green Versus TaqMan Chemistry.* PCR amplicons detected TaqMan 20 Ct B2M E = 100% R2 = 0.9998 using the same primer pair with or without TaqMan probes in either SYBR Green or TaqMan chemistry. SYBR green chemistry yields earlier Cts for each dilution, demonstrating better sensitivity than TaqMan chemistry. 15 SYBR Green 10 E = 100% R2 = 0.9999 5 4 2 Support@SABiosciences.com 6 8 10 Log [Copy Number] 12 * BMC Genomics 2008, 9: 378.
RT2 ProfilerTM PCR ARRAYS PCR ARRAY Guide v4.0 Application: Angiogenesis Application: ECM PCR ARRAYS for Cancer Biomarker Discovery ECM and Cell Adhesion VEGF Regulation of Cellular Architecture 0 100 -50 10-1 Breast Tumor 101 -100 10-2 -150 -200 10-3 UP -R EG UL AT ED 10-5 Chen, C. et al. Cancer Research. 2009; 69 (16): 6721-6729. COL4A2 CTNND2 ADAMTS1 SELE TIMP3 NO 10-5 ITGB4 MMP9 MMP3 10-4 ANGPT1 FGF1 KDR TIMP3 FIGF SERPINF1 JAG1 FGFR3 B2M TNFA ECGF1 CXCL10 LAMA5 TIMP1 TGFA IL1B VEGFA ACTB TGFB1 SPHK1 VEGFC FGF2 MDK PTGS1 ENG IL6 PECAM1 THBS1 EREG NRP2 MMP9 PGF IL8 Fold Change mAb225/lgG 50 FN1 DO WN -R EG UL AT ED CNTN1 ITGB3 GE AN CH 10-3 10-4 10-2 10-1 101 100 Normal Breast Figure 4: Relative Fold Change Between Disorganized and Organized Colonies Using the RT2 Profiler Angiogenesis PCR Array. RNA isolated from unorganized T4-2 cells treated with a control antibody (IgG) or reverted to an organized colony by blocking EGFR signaling (mAB225) was reverse transcribed and relative gene expression data was obtained using the Human Angiogenesis PCR Arrays. The expression profile of 84 genes relevant to Angiogenesis as well as 5 housekeeping genes was assayed. Fold change calculations were done using SABiosciences’ data analysis software which automatically calculates the fold change in gene expression between the treated and control groups. Figure 7: ECM and Cell Adhesion PCR Arrays Revealed Up- and Down-Regulated Genes in Breast Cancer. Total RNA from a normal human breast and a human breast tumor were characterized in technical triplicates, and the relative expression levels for each gene in the two samples are plotted against each other in the Scatter Plot. Genes encoding the matrix metallopeptidases (MMP3 and MMP9) and their inhibitors (TIMP3) are up-regulated, while genes encoding integrins (ITGB3 and ITGB4) are down-regulated, by at least three-fold (outside the silver field) in breast tumors relative to normal tissue. p value STATISTICAL SIGNIFICANCE Application: Immune Response 10-9 10-8 10-7 10-6 10-5 10-4 10-3 10-2 10-1 100 Popular Pathway-Focused PCR ARRAYS Common Cytokines IL10 IL1A IL1B CSF1 PDGFA TGFB2 TNFSF11 BMP6 TNFRSPSF11B TNFSF14 TNFSF13B IFNA5 IFNG CSF2 IL9 IL11 IL21 IL5 IL13 TNF LTA TNFSF10 IL1F7 IL2 IL22 IL3 IL17 BMP3 -7 -5 -3 -1 1 3 5 7 9 fold difference [log2] DOWN-REGULATED 11 13 15 17 UP-REGULATED Figure 5: Common Cytokine PCR Array Identified 23 Up-Regulated and 6 DownRegulated Genes Following PBMC Stimulation. Triplicate total RNA samples from human peripheral blood mononuclear cells (either untreated or stimulated with 50 ng/mL PMA and 1 µg/mL ionomycin for 6 hours) were characterized with the Human Common Cytokine PCR Array. Twenty-three cytokine genes are up-regulated (> 5-fold,p < 0.0005) including interleukins, colony stimulating factors, and TNF ligands after 6 hours of stimulation. Six interleukin and TNF ligand genes are down-regulated under the same conditions. Application: Determining Drug Toxicity with PCR ARRAYS Stress and Toxicity PathwayFinder 5005 128 Inflammatory Cytokines & Receptors NFκB Signaling Pathway Oxidative Stress & Antioxidant Defense Signal Transduction PathwayFinderTM Stem Cell (Embryonic, Mesenchymal) Stress and Toxicity PathwayFinderTM TGFβ / BMP Signaling Pathway Th1-Th2-Th3 Toll-Like Receptor Signaling Pathway Wnt Signaling Pathway Complete PCR Array List Custom PCR Arrays www.SABiosciences.com/ArrayList.php (Detailed Information on Page 5) Complete RT Profiler PCR ARRAY System 2 Product Plate Format RT Profiler PCR Array 2 96-well Plate 384-well Plate Product RT First Strand cDNA Synthesis Kit 2 RT SYBR Green w/ ROX Master Mix 2 RT SYBR Green w/ Fluorescein Master Mix 2 RT SYBR Green Only Master Mix (see page 6) HSPA6 CRYAB CSF2 HSPA1A TNF DDIT3 HSPH1 CYP1A1 HSPA5 HSPCA 2 DNAJB4 HMOx1 30 20 10 0 119 1GADD45A 125 1ACTB ActosTM Avandia® Rezulin® MT2A 5000 18SrRNA Fold Up-Regulation tm Angiogenesis Apoptosis Cancer PathwayFinderTM Cell Cycle Chemokines and Receptors Common Cytokines DNA Damage Signaling Pathway Endothelial Cell Biology Epithelial to Mesenchymal Transition Extracellular Matrix and Adhesion Figure 6: Stress and Toxicity PathwayFinderTM PCR Array Uncovered Distinct Gene Expression Profiles Associated with Liver Toxicity Caused by 3 PPARγ Agonists. RNA from HepG2 cells treated with three different glitazone PPARγ agonists for type 2 diabetes mellitus was characterized, and the results were compared to that of a vehicle (DMSO) control. The drug withdrawn due to idiosyncratic liver toxicity (Rezulin), induces very different changes in the expression of stress-related genes than two safer drugs still on the market (Avandia and Actos). Pack Size 2, 12, 24 Arrays 4 Arrays Catalog # Pack Size 12 Samples 330401 2, 12, 24 Arrays 2, 12, 24 Arrays 2, 12, 24 Arrays Various Various Various PCR Array Data Analysis Software FREE PCR ARRAY Accessories Pack Size Catalog # RT Nano PreAMP cDNA Synthesis Kit 2 RT FFPE PreAMP cDNA Synthesis Kit 2 RT Nano PreAMP cDNA Synthesis Primer Mixes 12 Samples 12 Samples 12 Samples 330451 330461 Inquire 2 www.SABiosciences.com 3
RT2 Profiler PCR ARRAY System A Complete & Reliable Solution for Gene Expression Analysis How The PCR ARRAY System Works Cells, Tissues, FFPE, Blood, and Biofluids RT 2 Profiler PCR ARRAYS Each pathway-focused PCR Array includes 89-wet bench validated qPCR Primers Assays (including 5 housekeeping genes) and a proprietary control panel. RNeasy KITS RT 2 SYBR Green qPCR Master Mixes A unique formulation of buffers that co-evolved with the primer design algorithm provides high amplification efficiencies. Available with reference dyes (ROX, Fluorescein or without). Total RNA gDNA Elimination Solution (GE) RT Enzyme Oligo-dTs Random Hexamers External RNA Control (RTC) dNTPs RT2 FIRST STRAND cDNA SYNTHESIS KIT GENOMIC DNA ELIMINATION REVERSE TRANSCRIPTION RT 2 First Strand cDNA Synthesis Kit RE SOLUTION 5 MINUTES 15 MINUTES AAAAA AAAAA AAAAA AAAAA First Strand cDNA An External RNA Control detected by the PCR Array tests the quality of input RNA. It also features a proprietary genomic DNA elimination buffer essential for eliminating residual gDNA, ensuring specific detection of mRNA. FREE Data Analysis Software The power of the PCR Array to assess the expression of a pathwayfocused set of genes over a wide range of detection yields an abundance of data. With our FREE PCR Array Data Analysis tool, go from raw Ct values to fold change results displayed in a variety of formats (Scatter Plots, Volcano Plots, Clustergram) in a MATTER OF MINUTES. 45 GE Effectively Removes Genomic DNA 40 CLEAN OF gDNA 35 Ct GDC RNA ISOLATION 5-120 MINS SABiosciences RT2 Profiler PCR Arrays are a complete system for PathwayFocused Gene Expression Analysis. From Sample Preparation to Data Analysis, the PCR Array system includes four components that GUARANTEE high-quality, reproducible, and reliable gene expression data. Integral to the performance of the PCR Array system is a proprietary set of control elements that enhance the reliability of your data and serve as a guarantee for performance over time. These elements allow researchers to quickly assess the quality of their data by determining if samples were contaminated with genomic DNA (gDNA), the quality of the reverse transcription reaction, and real-time PCR efficiency. Each component of the RT2 Profiler system contributes to these quality control elements by incorporating an interlocked system for comprehensive monitoring of each step of the PCR Array process. Untreated GE Treated 30 25 20 dNTPs SYBR Green Dye DNA Polymerase Binding Elongation SYBR Green Binding Detection HEK293T Cells Mouse Spinal Tissue Mouse Brain Tissue RNA Source Rat Brain tissue Figure 1: Elimination of Genomic DNA Contamination. RNA from HEK 293T cells, mouse spinal tissue, mouse brain tissue, or rat brain tissue was characterized on SYBR Green PCR Arrays before (blue bars) and after (red bars) treatment with gDNA Elimination Buffer from the RT² First Strand Kit. Average Ct (RTC-PPC) Hot-Start DNA Polymerase RT2 SYBR GREEN MASTER MIX 10 HEAT ACTIVATION CYCLING AND DETECTION 2 HOURS (40 CYCLES) 10 MINS 15 10 Reverse Transcription Monitoring 8 6 FAIL PASS 4 2 0 None Mg2+ Addition / Treatment TRIzol® Figure 2: Monitoring Inhibition in Reverse Transcription. Human universal RNA was added with magnesium salt to simulate RNA degradation or added with TRIzol® reagent to simulate contamination that inhibits enzyme activity. RT² First Strand Kit was used for cDNA synthesis. 4 Support@SABiosciences.com
RT2 SYBR® Green qPCR Master Mixes The Required High-Performance Master Mix for RT2 Profiler PCR Arrays SYBR Green Detection is a popular approach used in quantifying gene expression analysis with RT-PCR. It relies on the preferential binding of the SYBR green dye to double-stranded DNA, resulting in strong fluorescence emission signals, with the signal intensity proportional to the amount of double-stranded DNA present. Greater Sensitivity Without Sacrificing Specificity 2 RT SYBR Green qPCR Master Mix Primer SYBR Green DNA Template MMP15 Gel MMP13 Gel Competitor I Master Mix Polymerase High quality PCR reaction components are essential for achieving superior amplification specificity and efficiency. SABiosciences offers a complete solution for using SYBR Green PCR Arrays with the RT2 SYBR Green qPCR Master Mixes. Each mix includes a Hot Start Taq DNA polymerase, which provides tighter control over activity, and other proprietary chemical components that significantly minimize primer dimer formation, thereby enhancing amplification efficiencies for even the most difficult-to-amplify genes. The higher SYBR Green signal from our formulations provides greater sensitivity and ensures clean results without sacrificing specificity or amplification efficiency. Brighter SYBR Green Signal MMP15 Gel MMP13 Gel Figure 2: RT2 SYBR Green qPCR Master Mixes Provide Greater Sensitivity Without Sacrificing Specificity. RT2 SYBR Green qPCR Master Mixes and Competitor I Master Mixes were 2 used in qPCR assays to detect the human MMP13 and MMP15 mRNA in reference RNA. RT SYBR Green qPCR Master mixes provide detection of the genes at an earlier threshold cycle value (Ct). The real-time dissociation curves and agarose gel electrophoresis characterization reveal the presence of a non-specific 2 secondary product generated with the competitor’s master mix which is not amplified by the RT SYBR Green qPCR Master Mix. 2 RT SYBR Green qPCR Master Mix from SABiosciences A Amplification Plots 10 Compatible PCR Instruments Applied Biosystems (ABI): 5700, 7000, 7300, 7500, 7500 FAST, 7700, 7900HT, StepOnePlus (96- and 384-well blocks) Bio-Rad: CFX96, CFX384, iCycler, iQ5, MyiQ, MyiQ 2, Chromo4, Opticon 2 Stratagene: Mx3000P, Mx3005P, Mx4000 Roche: LightCycler 480 (96- and 384-well blocks) Eppendorf: Mastercycler ep realplex 2/2S, 4/4S TaKaRa: TP-800 ∆RN 8 6 4 2 0 Signal [-d(RFU)/dT] B 4 0 8 12 16 20 24 Cycle Number 28 32 36 40 RT qPCR Master Mixes 2 Dissociation Curves 0.5 Product RT SYBR Green w/ ROX qPCR Master Mix 2 0.4 0.3 0.2 RT SYBR Green w/ Fluorescein qPCR Master Mix 2 0.1 0 60 65 70 75 80 85 Melting Temperature [oC] 90 95 RT SYBR Green qPCR Master Mix 2 Figure 1: RT2 SYBR Green qPCR Master Mixes Provide Greater Sensitivity with a Brighter SYBR Green Signal. Four commercial master mixes were used to detect the expression of human ACTB from the same universal reference RNA. The amplification (A) and the dissociation curves (B) for the master mix from SABiosciences demonstrate a sharper amplification curve and a brighter SYBR Green signal than observed with three competing master mixes. 6 Support@SABiosciences.com Without Reference Dye * Plate format is 384-well. Size Catalog # SABio # 2 Arrays 12 Arrays 24 Arrays 4 Arrays* 25 mL 2 Arrays 12 Arrays 24 Arrays 4 Arrays* 25 mL 2 Arrays 12 Arrays 24 Arrays 4 Arrays* 25 mL 330520 330522 330523 330521 330529 330510 330512 330513 330511 330519 330500 330502 330503 330501 330509 PA-012 PA-012-12 PA-012-24 PA-012-8 PA-112 PA-011 PA-011-12 PA-011-24 PA-011-8 PA-111 PA-010 PA-010-12 PA-010-24 PA-010-8 PA-110
RT2 Profiler PCR ARRAY Performance Reliable and Reproducible Pathway-focused Gene Expression Analysis B 9.95 Fluorescence RT2 Profiler PCR Arrays are used and trusted by thousands of research scientists for pathway-focused gene expression analysis. Several factors, including the RT2 Primer Assay design algorithm, the proprietary control panel, and the strict manufacturing and quality control procedures, ensure the outstanding performance and reliability of our PCR Arrays. Each PCR Array and every qPCR Primer Assay is wet-bench verified to guarantee their performance, with results demonstrating several performance parameters illustrated here. 7.95 5.95 108 109 3.95 107 106 0.5 0 2 4 8 6 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Cycle Number Uniform PCR Amplification Efficiency One prerequisite for PCR Array technology is that the amount of template product doubles with every cycle. The more the assays deviate from this ideal, the error in the fold change calculation (∆Ct) increases exponentially. Only with consistently high amplification efficiencies can PCR Arrays yield meaningful comparison of gene expression levels of all genes simultaneously. The unique combination of SABiosciences' proprietary primer design algorithm and rigorous testing of every primer assay by hand guarantees the high performance of every primer assay on the PCR Arrays. Regardless of user or instrument used, the complete PCR Array System demonstrates strong correlations across technical replicates, lots, and instruments with average correlation coefficients > 0.99 insuring reliable detection of differences in expression between biological samples. 0.1 0 50 40 60 70 90 80 TM [ C] 99 120 PreAMP 100 Unamp % Increase in Positive Call Rate 80 60 40 20 0 100 50 25 10 Input RNA [ng] 1 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 % Increase Positive Call Rate A key benefit of using pathway-focused PCR Arrays for gene expression analysis is that genes that are over expressed can be measured as reliably as those that are under expressed. The complete PCR Array System yields > 85% positive call with 25 ng - 5 µg RNA or >90% with as a little as 1 ng PreAMP RNA. The 8-log wide dynamic range provided by real-time PCR is unparalleled when comparing a pathway-focused gene panel of varying expression levels across a variety of samples. Figure 2: PCR Arrays Detect as Little as 1 ng RNA. Different amounts of universal total RNA were characterized using the Human Inflammatory Cytokines and Receptors PCR Array (PAHS-011) with or without PreAMP. The percentage of detectable genes was calculated for each RNA amount, with 1ng RNA analysis enabled with the new pathway-focused PreAMP technology. A1 A2 Ct from User A High Sensitivity and Wide Dynamic Range A4 Universal total RNA was characterized for four chemokine and chemokine receptors using RT2 Primer Assays, followed by a dissociation (melt) curve analysis. PCR Arrays specifically detect individual genes despite the expression of related gene family members in the same RNA sample. % Positive Call B1 o Figure 1: PCR Arrays Amplify A Single Gene-Specific Product in Every Reaction. A 1 Superb Reproducibility 0.2 -0.1 101 102 Figure 3: PCR Arrays Detect RNA Across a Wide Dynamic Range. Ten-fold serial dilutions of Human CHRNA5 were characterized with the respective RT2 qPCR Primer Assay. A3 Signal [-d(RFU)/dT] CXCL3 CXCR1 CXCR2 CXCL2 CXCL3 0.3 CXCR1 CXCR2 CXCL2 Agarose Gel 0.4 103 104 19 .5 Distinct Specificity The complete PCR Array System , with high quality input RNA, is guaranteed to yield single bands without primer dimers or other secondary products. The proprietary primer design algorithm incorporates more than ten thermodynamic and sequence alignment criteria, and our wet-bench verification provides confidence that every real-time qPCR Assay accurately represents the expression of the queried gene. Over 20,000 gene-specific RT2 PCR Primer Assays have been designed and shipped to satisfied customers. 105 40 30 20 10 0 0 40 30 20 10 0 0 40 30 20 10 0 0 40 30 20 10 0 0 10 20 30 10 20 30 10 20 30 10 20 30 40 30 20 10 0 40 0 40 30 20 10 0 40 0 40 30 20 10 0 40 0 40 30 20 10 0 40 0 B2 10 20 30 10 20 30 10 20 30 10 20 30 40 30 20 10 0 40 0 40 30 20 10 0 40 0 40 30 20 10 0 40 0 40 30 20 10 0 40 0 B3 10 20 30 40 10 20 30 40 10 20 30 40 10 20 30 40 40 30 20 10 0 0 40 30 20 10 0 0 40 30 20 10 0 0 40 30 20 10 0 0 B4 10 20 30 40 10 20 30 40 10 20 30 40 10 20 30 40 Ct from User B Figure 4: PCR Arrays Yield Highly Reproducible Results. Four replicate sets of raw threshold data (1-4) obtained by two different scientists (A & B) at two different times on Human Drug Metabolism RT2 Profiler PCR Arrays are directly compared. The results demonstrate a high degree of correlation (R2 > 0.990). RT2 Profiler PCR Arrays: A Trusted & Reliable System PCR Arrays have been used by thousands of researchers who have successfully submitted and published their PCR Array results in very high impact journals, including Science, PNAS, Cancer Research, the Nature & Cell family of journals, and others (See Pages 24-27). www.SABiosciences.com 7
RT2 Nano PreAMP cDNA Synthesis Technology TM Enabling the Analysis of 1 Nanogram of RNA with RT2 ProfilerTM PCR ARRAYS 2 TM What Is the RT Nano PreAMP cDNA Synthesis Kit? RT² Nano PreAMP cDNA Synthesis Kit and Primer Mixes are a breakthrough technology enabling expression analysis starting from as little as 1 ng of total RNA. It employs a proprietary preamplification process to faithfully increase the amount of targeted cDNA for PCR Array analysis. This technology empowers RT² Profiler PCR Arrays to accurately analyze nanogram levels of total RNA. 2 How RT Nano PreAMP cDNA Synthesis Kits Work Two Simple Steps: AAAAA AAAAA AAAAA AAAAA 1. cDNA First Strand Synthesis Samples that can NOW be characterized with real-time PCR Arrays include: Laser Captured Microdissection Samples (LCM) mRNA This kit provides enough reagents for synthesizing first strand cDNA from 12 different samples of as little as 1 ng total RNA. 2. Preamplification of cDNA for Pathway Specific Genes Fine Needle Aspiration Biopsies (FNAB) Each first strand cDNA synthesis reaction can be amplified by 4 different sets of PCR Array-specific Primer Mixes, allowing gene expression analysis for one sample on as many as 4 different PCR Arrays. Stem Cell Clusters or Embryoid Bodies Flow Cytometry / Fluorescent-Activated Cell Sorting (FACS) Combined with PCR Arrays, the RT² Nano PreAMP cDNA Synthesis Kit and Primer Mixes extends the PCR Array System to accurately analyze a pathway-focused set of genes with as little as 1 ng of total RNA. ∆Ct - PreAMP cDNA Unbiased Amplification Process & Comparison of ∆Ct Values Between Preamplified and Unamplified cDNA RT 2 Nano PreAMP cDNA Synthesis Kit: Proprietary kits include optimized reagents for first strand cDNA synthesis and preamplification from only 1 ng of total RNA. RT 2 Nano PreAMP cDNA Synthesis Primer Mixes: Ready-to-use primer mixes for amplifying pathway-specific cDNA templates on corresponding RT2 Profiler PCR Arrays. Benefits of RT2 Nano PreAMP cDNA Synthesis Technology Robust Performance on Small Samples: Arrays starting with as little as 1 ng of Total RNA. Analyze up to 4 different PCR Easy Workflow and Designed for Routine Use: Simple and quick procedures with minimal hands-on time to preamplify target templates in under 2 hrs. Superior Sensitivity: Maximally enhances the sensitivity of RT Profiler PCR Arrays to analyze limited amounts of RNA. 2 100 Unamp % Increase in Positive Call Rate 80 60 40 20 0 100 50 25 10 Input RNA [ng] 1 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 Support@SABiosciences.com 5 10 15 Figure 2. Unbiased Amplification Process - Highly Comparable ∆Ct Values Between Preamplified and Unamplified cDNA from Human Liver Tumor RNA. First strand cDNA was synthesized from 5 ng of human liver tumor RNA. One-quarter of each RT product was used for preamplification with the RT2 Nano PreAMP cDNA Synthesis Kit plus the Human Cancer PathwayFinderTM Nano PreAMP Primer Mix. Unamplified cDNA synthesized from 500 ng of the same liver tumor RNA sample was used as the control. PreAMP amplified and unamplified cDNA samples were then analyzed on the Human Cancer PathwayFinderTM PCR Array, and the threshold cycle values (Ct) were obtained. The ∆Ct value for each gene was calculated by subtracting the average Ct value of the five reference genes (B2M, HPRT1, RPL13A, GAPDH, and ACTB) on the PCR Array from the Ct value of each gene of interest. The dashed line represents the ideal slope of 1.0. The solid line shows a linear regression fit with the R2 and slope indicated. Product (red) or without (blue) RT Nano preamplification. The unamplified and preamplified samples were then analyzed on the Human Inflammatory Cytokines and Receptors PCR Array (PAHS-011), which contains 84 pathway-specific assays, plus controls, including 5 assays for housekeeping genes. Threshold cycle values (Ct) were obtained and any genes with a Ct < 35 were considered to be present. Results indicate that with Nano preamplification, a 33.7% increase in positive call rate is observed in samples with as little as 1 ng RNA. 8 -5 2 Figure 1. RT2 Nano Preamplification Significantly Increases Sensitivity of Detection from 1 ng RNA Samples. Different amounts of human universal RNA were converted to cDNA with 2 -5 RT Nano PreAMP Products % Increase Positive Call Rate % Positive Call PreAMP R2 = 0.95 Slope = 1.01 5 ∆Ct - Unamplified cDNA Nano PreAMP Further Increases the Sensitivity of PCR ARRAYS 120 15 10 RT Nano PreAMP cDNA Synthesis Kit 2 RT Nano PreAMP cDNA Synthesis Primer Mixes* Human Cancer PathwayFinderTM Human Apoptosis Human Angiogenesis Human Mesenchymal Stem Cell Human Embryonic Stem Cell Human Extracellular Matrix and Adhesion Molecules Human Inflammatory Cytokines and Receptors Mouse Inflammatory Cytokines and Receptors Human Toll-like Receptor Signaling Pathway Mouse Toll-like Receptor Signaling Pathway 2 RT Nano PreAMP Primer Mixes for All PCR Arrays 2 * PreAMP Primer Mixes for Custom PCR Arrays available Catalog # SABio # 330454 330241 330241 330241 330241 330241 330241 330241 330241 330241 330241 330241 Inquire 330454 PBH-033 PBH-012 PBH-024 PBH-082 PBH-081 PBH-013 PBH-011 PBM-011 PBH-018 PBM-018 Inquire
RT2 FFPE PreAMP cDNA Synthesis Technology TM Enabling the Analysis of FFPE Samples with RT2 Profiler PCR Arrays RNA Extraction from FFPE Samples (330471) The combination of a simplified Xylene-Free RNA extraction and a high-fidelity amplification process maximizes recovery of RNA and microRNA (miRNA). RT² Profiler PCR Arrays facilitate easy and reliable expression analysis of genes associated with a biological pathway or a diseased state from FFPE samples. First Strand cDNA Synthesis and Preamplification (330461 + 330251:PFX-####) Benefits of RT FFPE PreAMP PCR ARRAY System Quick and Efficient: High quality and high-yield total RNA and miRNA isolation from FFPE samples in 70 minutes Superior Sensitivity: Simple Xylene-Free procedure and robust performance PCR ARRAY Detection RT2 FFPE Preamplification Faithfully Represents Biological Changes 30 . Real-time PCR Detection RT2 ProfilerTM PCR Array -3. 0 30 25 Figure 1. Highly Comparable Gene Expression Fold Change Results between FFPE Preamplified and Unamplified Samples. RNA extracted from FFPE spleen and intestine samples were extracted using the RT2 FFPE RNA Extraction Kit and converted to cDNA with and without preamplification. All four cDNAs were analyzed on the Human Cancer PathwayFinderTM PCR Array. The ∆∆Ct comparison and genes with raw Ct values lower than 33 in both unpreamplified spleen and intestine samples are presented. JUN IFNB1 FFPE PreAMP ∆∆Ct CDC25A 15 -5. 0 ANGPT1 -4. 0 TIMP3 20 TWIST1 -2. 0 35 TERT 3. 0 MET 2. 0 MMP1 1. 0 IFNA1 -1. 0 RT Only RT + PreAMP E2F1 -1. 0 RT2 SYBR® Green Master Mix 40 FGFR2 -2. 0 10 . CDKN2A -. 30 45 First-Strand cDNA Synthesis and PreAMP Multiplex PCR RT2 FFPE PreAMP Increases Detection of Genes Previously Classified as “Absent” CASP8 -. 40 20 . Raw Ct FFPE ∆∆Ct -. 50 Nucleic Acid Extraction 2 HOURS PreAMP protocol significantly enhances qRT-PCR detection sensitivity for FFPE samples y = 0.9749x - 0.0589 R2 = 0.9187 Proteinase K Digestion Column Clean-up 2 Easy Workflow: Cut FFPE Sections / Slides (10 - 80 µm) 70 MINUTES An innovative solution enabling the accurate qRT-PCR analysis of Formalin-fixed Paraffin-embedded (FFPE) samples. The RT² FFPE PreAMP technology utilizes multiplex tandem PCR to preamplify gene-specific cDNA with minimal bias. This kit is intended for preamplification of first-strand cDNA from fragmented total RNA from FFPE samples for gene expression analysis with RT² Profiler PCR Arrays. How the RT2 FFPE PreAMP PCR System Works 90 MINUTES Gene Expression Analysis from FFPE Samples Figure 2. Genes extracted from FFPE samples previously classified as “Absent” are now detectable after RT2 FFPE Preamplification. RNA was extracted from FFPE spleen sample (human) with the RT2 FFPE RNA Extraction Kit and reverse transcribed to cDNA using RT2 FFPE preamplification (red bars) and without PreAMP (blue bars). Results of the Human Cancer PathwayFinder PCR Array showed 55% of unpreamplified genes were virtually undetectable with no genes in the 10-20 Ct range. Preamplified genes with Ct values > 30, shift into the reliably quantitative range (Ct = 10-30). RT FFPE PreAMP & RNA Extraction Products 2 RT2 FFPE PreAMP Performance Increased positive call rate from FFPE samples Increased detection of genes previously classified as “Absent” Unbiased amplification of preamplified genes Faithful conservation of biological changes Product Catalog # RT FFPE RNA Extraction Kit 2 RT FFPE PreAMP cDNA Synthesis Kit 2 RT FFPE PreAMP Primer Mixes for All PCR ARRAYS 2 RT FFPE PreAMP Primer Mixes for Custom PCR ARRAYS 2 RT Profiler PCR ARRAYS 2 RT SYBR® Green qPCR Master Mixes 330471 330461 330251 2 www.SABiosciences.com 9
Data Analysis Quick and Easy Software Service Core Gene Expression Analysis Services FREE Web-Based PCR ARRAY Data Analysis Software Genomic & Gene Expression Analysis This integrated web-based software package for the PCR Array System automatically performs all ΔΔCt based fold-change calculations from your uploaded raw threshold cycle data. Simply providing the array's catalog number annotates the results to the correct gene list. The web portal delivers results not only in a tabular format but also in scatter, volcano, cluster-gram, and multi-group plots. Perform any pair-wise comparison between groups of experimental replicates by defining your own fold-change and statistical significance thresholds, or compare all of the groups side-by-side. The web portal also helps you correctly interpret the genomic DNA, reverse transcription efficiency, and positive PCR control well data. Make your pathway-focused gene expression analysis quick and painless with the PCR Array System and the PCR Array Data Analysis Suite. SABiosciences provides genomic and expression analysis services that deliver robust and reproducible results. The Service Core accepts and processes a variety of biological samples and then leverages cutting-edge tools for either pathway-focused or genome-wide analysis yielding superior results for scientists in academic, government and industrial settings. Available Analysis Services DNA Service Whole Genome Simple: Just upload your data and define your parameters* Convenient: No downloading or installation required RNA Service Illumina Genotyping Illumina Expression Profiling Methylation Illumina DASL (fixed samples) Methylation Individual Gene / Locus Methylation qPCR - SYBR® Green Cells Cells Tissue or Blood Tissue or Blood Fixed Tissue Fixed Tissue Small Sample Small Sample Publication-Ready Output: Export all results as FREE EXCEL files or PNG image files * EXCEL-based data analysis templates are available from our website. INSTRUCTIONS 1 2 3 PCR Array Pathway-focused Sample Preparation Upload your data in a simple EXCEL file format. Define your housekeeping genes and experimental groups. Choose an automatically generated data analysis result Take a test run with pre-loaded sample data set today: www.SABiosciences.com/pcrarraydataanalysis.php OR Join our next live webinar entitled: “PCR Array Data Analysis Tutorial” at: www.SABiosciences.com/seminarlist.php Volcano Plot Scatter Plot miRNA PCR Array Nucleic Acid Isolation Sample isolation and integrity are fundamental to the success of any biological analysis. The Service Core provides qualified expertise in RNA and DNA isolation from a variety of biological samples. Each sample is evaluated for concentration and degradation to ensure successful future analysis. • RNA / DNA Isolation from Cells, Tissue or Biofluids (USA only) • Integrity/Degradation Checked for Every Sample Whole Genome Analysis LOG10 [p-Value] LOG10 [Group 1] LOG10 [Control Group] Figure 1: The Scatter Plot Compares Gene Expression Levels Between Two Experimental Conditions. The graph plots the log10 of normalized gene expression levels in a control condition (x-axis) versus an experimental condition (y-axis). Symbols outside the gray area indicate fold-differences larger than a threshold that you can define. The red symbols in the upper-left corner readily identify up-regulated genes, and the green symbols in the lower right corner readily identify down-regulated genes. 10 The Service Core uses the Illumina Platform to provide whole genome expression profiling, cytogenetic analysis, methylation and single nucleotide polymorphism (SNP) genotyping. As an Illumina CSPro (certified service provider), scientists are receiving results from a trained and tested scientific staff. LOG2 [Group 1/Control Group] Figure 2: The Volcano Plot Indicates the Statistical Significance of Gene Expression Changes. The x-axis plots the log2 of the fold-differences, while the y-axis plots their p-values based on student’s t-test of your replicate raw Ct data. The red and green symbols outside the gray area conveniently have the same meaning as the Scatter Plot. Symbols in the Volcano Plot above the blue line readily identify fold-differences at least as statistically significant as a threshold that you can define. Support@SABiosciences.com • Expression Profiling (Human, Mouse or Rat) • SNP Genotyping & Copy Number Variation Analysis • Whole Genome Methylation Analysis (Human) Pathway-focused Analysis Real-time PCR is a powerful tool for validating results from whole genome expression profiling, methylation or pathway analysis. An experienced leader in providing qPCR services, the Service Core delivers rapid and reproducible results. • Custom PCR Array Analysis • Pathway-focused PCR Array • Methyl-Profiler PCR Array
QIAGEN® RNeasy® Kits Purification of High-quality Total RNA from a Range of Biological Samples A RNeasy Kits are a proven technology for rapid and convenient purification of ® high-quality RNA. Reproducible yields of intact RNA with high Agilent RIN (RNA Integrity Number) values are obtained, ensuring reliable results in downstream applications such as real-time RT-PCR. Kits are available for cells and easy-tolyse tissues as well as for more challenging samples, such as fiber-rich or fatty tissues, fine needle aspirates, and cryosections. Why Use RNeasy Kits? QIAGEN QIAxcel® Rel. FI Units [RFU, x1E+000] What Are RNeasy Kits? 1799.4 nt 20 4628.7 nt 10 131.0 nt 10 min 5 min B Agilent Bioanalyzer 400 How Do RNeasy Kits Work? Biological samples are first lysed in a lysis buffer that contains a guanidine salt, which fully denatures RNases to prevent RNA degradation. RNA is then specifically bound to a silica membrane, either in an RNeasy spin column or the well of an RNeasy 96 plate. Other cellular material is efficiently washed away using a series of wash buffers before pure, intact RNA is eluted in RNase-free water. 300 FU When purifying RNA, it is important to use a method that maintains RNA integrity and removes contaminants. Degradation of RNA makes reliable analysis of gene expression impossible, while the presence of contaminants in the purified RNA can inhibit enzymes in downstream applications such as real-time RT-PCR and microarray analysis. RNeasy Kits overcome these challenges through the combination of a specialized lysis buffer and silica-membrane technology. 200 100 0 25 200 500 1000 2000 4000 Figure 1. Highly Intact RNA. RNA was purified from Jurkat cells using the RNeasy Mini Kit. The purified RNA was analyzed on the [A] QIAxcel system (ratio of 28S to 18S rRNA: 1.55) and [B] Agilent 2100 Bioanalyzer (ratio of 28S to 18S rRNA: 1.7). A high RNA Integrity Number (RIN) of 9.6 was obtained, indicating highly intact RNA. QIAGEN RNeasy Kits* Product Catalog # RNeasy Mini Kit (50) For purification of RNA from cells & easy-to-lyse tissues Sample Lyse, homogenize, and add ethanol Bind total RNA to RNeasy membrane 74104 RNeasy Fibrous Tissue Mini Kit (50) For purification of RNA from fiber-rich tissues RNeasy Procedure 74704 RNeasy Lipid Tissue Mini Kit (50) For purification of RNA from all tissue types 74804 RNeasy 96 Kit (12) For purification of RNA from cells in 96-well format 74182 QIAzol Lysis Reagent (200 mL) For lysis of fatty & standard tissues before RNA isolation. 79306 * See also page 22 for RNeasy Protect Kits for stabilization and purification of RNA from tissues, cells, 2 saliva, and blood. See page 7 for for details on the RT FFPE RNA Extraction Kit. Wash RNeasy Fibrous Tissue Mini Kit Elute in small volume Ready-to-use RNA The RNeasy Fibrous Tissue Mini Kit includes proteinase K for removing abundant protein in fiber-rich tissue samples, and RNeasy spin columns for purifying up to 100 µg of high-quality RNA. Fibrous tissue samples can be conveniently stabilized using RNAlater RNA Stabilization Reagent or Allprotect Tissue Reagent, and efficiently disrupted using a TissueRuptor or TissueLyser system. www.SABiosciences.com 11
QIAGEN® Products for Sample Disruption Fast and Effective Disruption of Biological Samples at a Range of Throughputs What Is Sample Disruption? QIAGEN Sample Disruption Products Effective disruption and homogenization of a biological sample is an absolute requirement for all RNA purification procedures. Disruption releases the RNA contained in a sample, while homogenization reduces sample viscosity to facilitate subsequent RNA purification. Product QIAshredder (50) For homogenization of cell lysates ® Catalog # 79654 TissueRuptor For disruption of individual samples 9001271 TissueRuptor Disposable Probes (25) Disposable probes for use with the TissueRuptor 990890 TissueLyser LT For disruption of up to 12 samples 85600 TissueLyser LT Adapter, 12-tube Adapter for use with the TissueLyser LT 69980 300 TissueLyser II For disruption of up to 48 or 192 samples 85300 200 TissueLyser Adapter Set 2 x 24 Adapter set for use with the TissueLyser II; holds 48 tubes 69982 TissueLyser Adapter Set 2 x 96 Adapter set for use with the TissueLyser II; holds 192 tubes 69984 Stainless Steel Beads, 5mm (200) 69989 Stainless Steel Beads, 7mm (200) 69990 Tungsten Carbide Beads, 3mm (200) 69997 TissueLyser Single-Bead Dispenser, 5mm 69965 The QIAshredder is a biopolymer-shredding system in a spin-column format. Cell lysate is applied to a QIAshredder spin column, which is then briefly centrifuged to homogenize the lysate. TissueLyser Single-Bead Dispenser, 7mm 69967 TissueLyser 3 mm Bead Dispenser, 96-Well 69973 The TissueRuptor is a handheld device that provides simultaneous disruption and homogenization using TissueRuptor Disposable Probes, which contain a blade that rotates at very high speeds. As the probes are both disposable and transparent, the risk of cross-contamination is minimized and the sample disruption process can be visually monitored. Use of disposable probes also saves time as there is no need to clean the same probe after disrupting each sample. TissueLyser 5 mm Bead Dispenser, 96-Well 69975 Why Use QIAGEN Sample Disruption Products? QIAGEN provides a range of technologies for disruption and homogenization — from QIAshredder spin columns for fast and simple homogenization of cell lysates to TissueRuptor and TissueLyser systems for mechanical disruption and homogenization of tougher tissue samples at a range of throughputs. TissueRuptor and TissueLyser systems deliver fast and effective disruption, and replace tedious and time-consuming methods such as disruption using a mortar and pestle. RNA Concentration [ng/µL] 400 TissueLyser LT TissueLyser II 100 0 Skin Heart Lung Brain Figure 1. Effective Tissue Disruption. Various rat tissues were disrupted using the TissueLyser LT or TissueLyser II. RNA was purified from 20 mg samples on the QIAcube using the RNeasy Fibrous Tissue Mini Kit (skin, heart, and lung) or RNeasy Lipid Tissue Mini Kit (brain). RNA was eluted in a volume of 50 µL, and concentration was determined using a spectrophotometer. How Do QIAGEN Sample Disruption Products Work? TissueLyser instruments are bead mills that simultaneously disrupt and homogenize samples through high-speed shaking with grinding beads in plastic tubes. Using an adapter that holds several tubes, the instruments disrupt multiple samples at the same time — up to 12 samples with the TissueLyser LT, and up to 48 or 192 samples with the TissueLyser II. 12 Support@SABiosciences.com The TissueLyser LT The TissueLyser LT is a small bead mill which provides fast, effective disruption of up to 12 samples at the same time. Simultaneous disruption and homogenization is achieved through high-speed shaking of samples in 2 mL microcentrifuge tubes with stainless steel or glass beads.
QIAGEN® Products for RNA Stabilization Convenient and Immediate Stabilization of RNA in a Range of Biological Samples What Is RNA Stabilization? QIAGEN RNA Stabilization Products* Once a biological sample is harvested, its RNA becomes extremely unstable. The RNA is degraded by RNases, and gene induction or downregulation triggered by sample manipulation will also occur. Immediate stabilization of cellular RNA to preserve mRNA levels is critical for accurate gene expression analysis. RNA stabilization is usually achieved by rapidly freezing samples in liquid nitrogen or on dry ice. However, the use of such chemicals is hazardous, and care should be taken to avoid thawing of samples prior to sample disruption and RNA purification. Why Use QIAGEN RNA Stabilization Products? QIAGEN provides a broad range of reagents for convenient stabilization of RNA in cells, tissues, blood, and saliva at room temperature. The use of hazardous liquid nitrogen or dry ice to freeze samples is avoided. Samples are simply submerged in the reagents to immediately preserve the gene expression profile, and can then be conveniently handled and transported at ambient temperature prior to RNA purification. For further convenience, stabilization reagents are also available as part of QIAGEN kits for RNA purification. Fold Change in Transcript Level Allprotect Tissue Reagent (100 mL) For stabilization of RNA, DNA, and protein in tissues ® AllPrep DNA/RNA Mini Kit (50) For simultaneous purification of DNA and RNA from cells and tissues ® Catalog # 76405 80204 RNAlater RNA Stabilization Reagent (250 mL) For stabilization of RNA in tissues 76106 RNeasy Protect Mini Kit (50) For stabilization of RNA in tissues and purification of RNA 74124 ® RNAprotect Cell Reagent (250 mL) For stabilization of RNA in cells 76526 RNeasy Protect Cell Mini Kit (50) For stabilization of RNA in cells and purification of RNA 74624 RNeasy Protect Saliva Mini Kit (50) For stabilization of RNA in saliva and purification of RNA 74324 RNAprotect Animal Blood Tubes (50 x 100 µL) For collection of 100 µL animal blood with RNA stabilization 76544 RNAprotect Animal Blood Tubes (50 x 500 µL) For collection of 500 µL animal blood with RNA stabilization 76554 RNeasy Protect Animal Blood Kit (50) For purification of RNA from blood collected in RNAprotect Animal Blood Tubes 73224 miRNeasy Protect Animal Blood Kit (50) For purification of RNA, including miRNA, from blood collected in RNAprotect Animal Blood Tubes c-fos Transcript in Lung 100 217304 80 60 40 20 0 2 Hours 4 Hours Allprotect 24 Hours 2 Hours 4 Hours PBS 24 Hours Madh7 Transcript in Intestine 10 Fold Change in Transcript Level Product 1 * For collection of human blood with RNA stabilization and purification, use the PAXgene Blood RNA System. For collection of tissues with preservation of histomorphology and nucleic acids and nucleic acid purification, use the PAXgene Tissue System. For details, visit www.PreAnalytiX.com. 0.1 0.01 0.001 2 Hours 4 Hours Allprotect 24 Hours 2 Hours 4 Hours PBS 24 Hours Figure 1. Effective RNA Stabilization. Rat tissues were stored at 25ºC for 2–24 hours in Allprotect Reagent or PBS prior to real-time RT-PCR analysis. Transcript levels relative to those in liquid nitrogen stabilized tissues were calculated. Changes in transcript levels were prevented by Allprotect Reagent. Allprotect Tissue Reagent Allprotect Tissue Reagent provides immediate stabilization of DNA, RNA, and protein in tissue samples at room temperature. It is ideal for use prior to simultaneous purification of DNA, RNA, and protein using AllPrep Kits. www.SABiosciences.com 13
APOPTOSIS BIOMARKERS CANCER CELL CYCLE PATHWAY-POWERED RT2 PROFILERTM PCR ARRAYS • Technology Overview (page 2) • Over 100 Pathways Available (page 28) Breast Cancer and Estrogen Receptor Signaling Apoptosis Autophagy Cancer PathwayFinder TM Cell Cycle DNA Damage Signaling Pathway Endothelial Cell Biology • Start With as Little as 1 ng of RNA (page 8) • Analyze FFPE Samples with PCR Arrays (page 9) • Over 1,000 Peer-reviewed Publications • Custom PCR Arrays Available for Human, Mouse, Rat, Rhesus Macaque and Drosophila Heat Shock Proteins NFκB Signaling Pathway Oxidative Stress and Antioxidant Defense p53 Signaling Pathway PI3K-AKT Signaling Pathway Stress and Toxicity PathwayFinder Angiogenesis Apoptosis Cell Surface Markers Apoptosis Autophagy Breast Cancer and Estrogen Receptor Signaling Cancer PathwayFinder Cancer Drug Resistance and Metabolism DNA Damage Signaling Pathway Dendritic and Antigen Presenting Cell Epigenetic Chromatin Modification Enzymes Epigenetic Chromatin Remodeling Factors Epithelial to Mesenchymal Transition (EMT) Extracellular Matrix and Adhesion Molecules Glucose Metabolism Hematopoietic Stem Cells and Hematopoiesis Homeobox (HOX) Genes TNF Ligand and Receptor Mesenchymal Stem Cell Unfolded Protein Response Stem Cell T-cell and B-cell Activation • To Learn More, Please Visit the PCR Product Web Page: Th1-Th2-Th3 • Accurate Detection of DNA Methylation at CpG Islands Without Bisulfite (page 20) RT2 MicroRNA PCR ARRAYS • Regulation of Gene Transcription and Translation (page 16) • Human, Mouse & Rat (Sanger miRBase 14) ChampionChIPTM PCR ARRAYS • Analyze DNA-Protein (histone) Interactions (page 19) 14 Cell Cycle Epithelial to Mesenchymal Transition (EMT) DNA Damage Signaling Pathway MAP Kinase Signaling Pathway Epithelial to Mesenchymal Transition (EMT) Neurogenesis and Neural Stem Cell EGF / PDGF Signaling Pathway NFκB Signaling Pathway MAP Kinase Signaling Pathway PI3K-AKT Signaling Pathway p53 Signaling Pathway Protein Phosphatases PI3K-AKT Signaling Pathway TGFβ BMP Signaling Pathway Tumor Metastasis www.SABiosciences.com/RTPCR.php Methyl-ProfilerTM PCR ARRAYS Cancer PathwayFinder Cell Cycle p53 Signaling Pathway Protein Phosphatases Signal Transduction PathwayFinder Transcription Factors Ubiquitination Pathway Wnt Signaling Pathway Breast, Colon, Gastric, Liver, Lung, & Prostate Cancer Breast, Colon, Gastric, Liver, Lung, & Prostate Cancer Breast, Colon, Gastric, Liver, Lung, & Prostate Cancer Tumor Suppressor Genes* Tumor Suppressor Genes* Cancer Cancer Cancer Cancer Cell Differentiation and Development Cell Differentiation and Development miFinderTM Cell Differentiation and Development miFinderTM miFinderTM Genome v2.0* Genome v2.0* Oncogenes and Tumor Suppressor Genes Oncogenes and Tumor Suppressor Genes Breast, Colon, Gastric, Liver, Lung, & Prostate Cancer (Signature & Complete Panels) Support@SABiosciences.com (Signature & Complete Panels) (Signature & Complete Panels) Genome v2.0* (Signature & Complete Panels) miFinderTM Genome v2.0* Oncogenes and Tumor Suppressor Genes T Helper Cell Differentiation
CYTOKINES / INFLAMMATION NEUROSCIENCE STEM CELL / SIGNAL TRANSDUCTION DEVELOPMENT Angiogenic Growth Factors & Angiogenesis Inhibitors Alzheimer's Disease cAMP / Ca2+ Signaling PathwayFinderTM Dendritic and Antigen Presenting Cell Cancer Drug Resistance and Metabolism Inflammatory Cytokines and Receptors Atherosclerosis Embryonic Stem Cells Embryonic Stem Cells Cancer PathwayFinderTM Inflammatory Response and Autoimmunity Common Cytokine GPCR Signaling PathwayFinder EGF / PDGF Signaling Pathway Hedgehog Signaling Pathway DNA Damage Signaling Pathway Embryonic Stem Cells Heat Shock Proteins Endothelial Cell Biology Hedgehog Signaling Pathway Hematopoietic Stem Cells and Hematopoiesis Drug Metabolism Interferon and Receptor Chemokines & Receptors Common Cytokine Interferon α, β Response JAK / STAT Signaling Pathway NFκB Signaling Pathway T Cell Anergy & Immune Tolerance T-cell and B-cell Activation TGFβ BMP Signaling Pathway Th17 for Autoimmunity and Inflammation Th1-Th2-Th3 Toll-Like Receptor Signaling Pathway ECM / ADHESION Chemokines and Receptors Extracellular Matrix and Adhesion Molecules Apoptosis Hypoxia Signaling Pathway GPCR Signaling PathwayFinderTM Hedgehog Signaling Pathway Homeobox (HOX) Genes Mesenchymal Stem Cell MAP Kinase Signaling Pathway Neurogenesis and Neural Stem Cell Mesenchymal Stem Cell Neuroscience Ion Channels and Transporters Osteogenesis TGFβ BMP Signaling Pathway Tumor Metastasis TNF Ligand and Receptor Neurotransmitter Receptors and Regulators Neurotrophin and Receptors Nitric Oxide Signaling Pathway Notch Signaling Pathway Hepatotoxicology Notch Signaling Pathway Nuclear Receptors and Coregulators GPCR Signaling PathwayFinder Neurotrophin & Receptors NFκB Signaling Pathway NFκB Signaling Pathway Drug Transporters Neurogenesis and Neural Stem Cell MAP Kinase Signaling Pathway Drug Metabolism: Phase II Enzymes Mesenchymal Stem Cell JAK / STAT Signaling Pathway Drug Metabolism: Phase I Enzymes Lipoprotein Signaling and Cholesterol Metabolism Insulin Signaling Pathway Glycosylation Lipoprotein Signaling & Cholesterol Metabolism Osteogenesis PI3K-AKT Signaling Pathway Stem Cell Signaling T-cell and B-cell Activation Signal Transduction PathwayFinder Terminal Differentiation Marker TGFβ BMP Signaling Pathway Transcription Factors Inflammatory Response T Cell Activation Cytokine Production Breast, Colon, Gastric, Liver, Lung, & Prostate Cancer Inflammatory Response (Signature & Complete Panels) Cancer Genome v2.0 miFinder Immunopathology Breast, Colon, Gastric, Liver, Lung, & Prostate Cancer Stem Cell Transcription Factors (Signature & Complete Panels) Homeobox* (HOX) Polycomb* (PcG) Mitochondria Nephrotoxicity Oxidative Stress and Antioxidant Defense Stress and Toxicity PathwayFinder Inflammatory Response T Cell Activation Cytokine Production Cancer Cancer miFinderTM Genome v2.0* Cell Differentiation and Development Cell Differentiation and Development Genome v2.0* miFinderTM miFinderTM Genome v2.0* Genome v2.0* Oncogenes and Tumor Suppressor Genes Stem Cell Transcription Factors Genome v2.0* TM Inflammation T Helper Cell Differentiation Wnt Signaling Pathway Molecular Toxicology 384HT miFinderTM miFinderTM Inflammatory Response TGFβ BMP Signaling Pathway Wnt Signaling Pathway TNF Ligand and Receptor TOXICOLOGY / DRUG ADME Stem Cell Transcription Factors Inflammatory Response T Helper Cell Differentiation www.SABiosciences.com 15
RT2 MicroRNA PCR ARRAYS Simultaneous Detection of Genome-Wide or Pathway-Focused miRNA How miRNA PCR ARRAYS Work As Easy as a Real-time PCR Experiment MicroRNAs are endogenous single-stranded RNA molecules 19-25 nucleotides in length, synthesized in a regulated manner from larger RNA molecules. Many miRNA sequences have been found in a variety of species [miRBase Release 14: >760 miRNAs in humans, >575 in mice, and >370 in rats]. 1. Convert miRNA to cDNA via Universal Tailing and Reverse Transcription. miRNA Sample 1 Why Use SABiosciences miRNA PCR ARRAYS? miRNA Sample2 miRNA 5’ Identification of miRNAs that potentially regulate your genes of interest is possible with our powerful yet simple bioinformatic algorithm at: www.SABiosciences.com/miRNAsearch.php 3. Functional Studies: The function of individual miRNAs can be identified via miRNA over expression or suppression of miRNA function. 16 Support@SABiosciences.com 1 hr Universal Priming AAAAAA 5’ TTTTTT Universal RT Primer Reverse Transcription AAAAAA cDNA 5’ TTTTTT 2 hr cDNA 5’ TTTTTT 3’ qPCR using miRNASpecific Primer and Universal qPCR Primer 4. Data Analysis. Specificity 120 Single Nucleotide Mismatch Specificity Targeted Template 80 72.2 20 0 0.54 hsa-miR-99a 0.07 hsa-miR-100 miR-99a miR-100 hsa-miR-99a 21.76 O F F 40 O T R E N A G T 60 SABiosciences Assay B Off-Target Template 100 O F T R E F A G T A Expression Analysis: Bioinformatic Prediction: Polyadenylation 3’ 3. Run in Your Real-Time PCR Instrument. The best technology for determining the expression of miRNA is the SABiosciences miRNA PCR Array System. 2. 5’ 3’ O T R E N A G T 1. Analyze 96 - 384 miRNAs in Each PCR Array O T R E N A G T MicroRNA represents a new layer of regulation in endogenous gene transcription and translation. Since there are hundreds of miRNAs in each species, with each miRNA potentially having hundreds of targets, the majority of genes may be subject to regulation by one or more miRNAs. miRNAs are already being considered as cancer biomarkers, and their importance is being realized in a variety of other research areas, such as differentiation, neurobiology and immunology. There are three major ways to start studying miRNA: AAAAAA Poly(A) tail 2. Add cDNA to RT2 qPCR Master Mix. Aliquot Mixture Across PCR Array. Sensitivity: As little as 0.5 µg total RNA needed Multi-Sequence Flexibility: Analyze up to 384 sequences simultaneously Simplicity: As easy as a real-time PCR Array experiment Why Study miRNA? Single Tube Reaction 5’ 3’ 2 The RT miRNA PCR Array accurately analyzes the expression of up to 96 or 384 microRNA sequences simultaneously on ANY real-time PCR instrument. SABiosciences' patent-pending miRNA technology integrates a universal-tailing and reverse transcription reaction specific for miRNA with accurate expression level measurement of distinct miRNA sequences that may differ by a single nucleotide base. RT2 miRNA PCR Arrays are the most specific and sensitive technology for analyzing genome-wide miRNA expression. 3’ 5’ Relative Detection [% Correct] Detecting every miRNA across the entire genome in a specific and sensitive way is a very technologically challenging task. Many miRNA family members and otherwise distinct miRNA species have very similar sequences. Moreover, other RNA species such as snRNA, tRNA, mRNA, and rRNA can cause non-specific amplification, making the specific analysis of mature miRNA even more problematic. SABiosciences' proprietary miRNA detection technologies enable uniformly high PCR amplification efficiencies, allowing simultaneous detection of miRNA under uniform cycling conditions. O T R E N A G T What are miRNAs? hsa-miR-100 Competitor Assay AACCCGUAGAUCCGAUCUUGUG AACCCGUAGAUCCGAACUUGUG Figure 1: miRNA qPCR Assays Distinguish Single Nucleotide Mismatches. RT2 miRNA PCR Assays and a competitor’s assays for miR-99a and miR-100 were used to detect both corresponding synthetic templates, whose sequences differ by only one nucleotide (B). Relative detection of the off-target template is calculated as a percentage of the correct template detection (A). RT2 miRNA PCR Assays’ proprietary primer design specifically discriminates closely related sequences better than competing assays.
QIAGEN® miRNeasy Kits Purification of Total RNA from a Range of Biological Samples A What Are miRNeasy Kits? miRNeasy Kits are a special adaptation of proven RNeasy technology, allowing purification of total RNA longer than approximately 18 nucleotides. The purified RNA includes large RNAs, such as mRNA and rRNA, as well as small RNAs, such as microRNA (miRNA), Piwi-interacting RNA (piRNA), small nucleolar RNA (snoRNA), and small nuclear RNA (snRNA). High-throughput Ct Value 32 Why Use miRNeasy Kits? Threshold Cycles 25 22 12 1x107 1x106 1x103 1x102 2 µg 200 ng Low-throughput 32 Ct Value Consistent Results 1x104 1x105 Cell Number B The miRNeasy Mini Kit and miRNeasy 96 Kit allow efficient purification of miRNA from all types of cells and tissues. Effective lysis, even with difficult-tolyse tissues, and removal of contaminants by organic-phase extraction is ® achieved using QIAzol Lysis Reagent. RNA is then purified in spin-column format (miRNeasy Mini Kit) or in 96-well format (miRNeasy 96 Kit). 30 27 17 Copurification of large and small RNAs allows real-time RT-PCR detection of both mRNA and miRNA using, for example, the miScript PCR System and RT2 Profiler PCR Arrays. For certain applications where large RNAs need to be removed, supplementary protocols are available for purification of an RNA fraction rich in small RNAs. How Do miRNeasy Kits Work? Copurification miRNA-enriched Fraction Copurification miRNA-enriched Fraction 27 22 17 QIAcube Manual 12 20 20 mg 2 mg 200 µg 20 µg Amount of Tissue 15 Figure 2. Effective Purification from a Range of Starting Amounts. Total RNA was purified from [A] 102–107 Jurkat cells using the miRNeasy 96 Kit or [B] a dilution series of rat lung tissue homogenate from 20 mg to 200 ng using the miRNeasy Mini Kit. miRNA-enriched fractions (<200 nucleotides) were also isolated from the same samples. Purified RNA was used as a template in quantitative, real-time RT-PCR assays for the miRNA miR-16. 10 5 0 miR-16 miR-25 Figure 1. Reliable miRNA Detection. Rat kidney (25 mg) was stabilized in RNAlater RNA Stabilization Reagent and disrupted using the TissueLyser II. Total RNA (with miRNA) was purified using the miRNeasy Mini Kit, either manually or on the QIAcube®. Real-time RT-PCR using the miScript PCR System was carried out to detect miR-16 and miR-25. miRNeasy Mini Kit The miRNeasy Mini Kit enables purification of total RNA which includes RNA from approximately 18 nucleotides (nt) upwards from all types of animal tissues and cells, including difficult-to-lyse tissues. The miRNeasy Mini Kit is used for low-throughput RNA purification using spin columns. QIAGEN miRNeasy Kits* Product miRNeasy Mini Kit (50) For purification of RNA, including miRNA, from cells and tissues 217004 miRNeasy 96 Kit (4) For purification of RNA, including miRNA, from cells and tissues in 96-well format 217061 * See also page 22 for stabilization and purification of RNA, including miRNA, from blood. 2 for for details on the RT FFPE RNA Extraction Kit that also recovers miRNA. 18 Support@SABiosciences.com Catalog # See page 7
ChampionChIP qPCR System TM 40% 35% 30% 25% The ChampionChIP One-Day Kit simplifies the usual two- to five-day ChIP protocol down to a manageable six to eight hours. Its crosslink reversal step is much faster and less tedious than conventional methods, and its DNA purification step yields a larger quantity and higher quality ChIP DNA than other one-day kits. 20% 15% 10% 5% 0% CDKN1A Gene Region (kb Relative to TSS) ChampionChIP antibodies for modified histones (H3Ac, H3K4me2, H3K27me3) or control IgG were used for precipitating chromatin from one million HeLa cells. Each ChIP DNA fraction was analyzed with a ChampionChIP Tiling Array representing 30 one-kb tile intervals across the genomic sequence of the CDKN1A gene. The results obtained from three independent experiments are consistent with active transcription of the CDKN1A gene. 8 30 min 30 min 40 min Optional: Quickly Evaluate Fragmentation Size 2. Immunoprecipitation Pre-Clear Anti-TF or -Histone Antibody & Control IgG Save Input Protein A Beads Fraction Wash 3. ChIP and Input Fraction DNA Isolation Reverse Cross-Linking and Elution DNA Spin-Column Purification B. Real-Time PCR C. Data Analysis (ChIP PCR Array Analysis Software) 50 min 1-2 hr 1 hr 30 min 30 min 10 min 2 hr 15 min Fold Change 7 A. Chromatin Immunoprecipitation (ChIP) 1. ChIP-Ready Chromatin Preparation Fix and Harvest Cells Sonicate Chromatin 6 5 4 The ChampionChIP System includes a simplified high-performance One-Day ChIP Kit, ChIP-Grade Antibodies, real-time PCR primers, and a FREE ChIP PCR Array Data Analysis Suite. Percent of DNA Input [%] Euchromatin and Heterochromatin Markers H3K4me2 H3K27me3 H3K9me3 Control IgG 6 4 2 0 A549 HepG2 PC3 0 p53 Binding CDKN1A mRNA Expression Figure 4: Treatment with 5-Fluorouracil Increases CDKN1A Gene Expression and p53 Binding in Cell Lines Expressing Wild-Type But Not Mutant p53. Triplicate samples from A549, HepG2, and PC3 cells were treated with 5-FU (300 µM, 6 h), and either subjected to ChIP with an anti-p53 antibody followed by qPCR analysis of the CDKN1A-2kb p53 binding site, or harvested for RNA to analyze CDKN1A expression by real-time RT-PCR. The results of both assays are expressed as the fold-increase upon 5-FU treatment. ChampionChIP qPCR System Catalog # Human Mouse ChampionChIP PCR Arrays Stem Cell Transcription Genes Oncogene & Tumor Suppressor Genes T Helper Cell Differentiation Inflammatory Responses ChampionChIP One-Day Kit ChampionChIP Antibody Kits Human RNA Polymerase II, p53 Histones (H3Ac, H4Ac, H3Kme2, etc.) 330454 330454 330454 330454 330454 334471 GH-501 GH-502 GH-503 GH-504 GA-101 GM-501 GM-502 GM-503 GM-504 GA-101 334481 Inquire Inquire ChampionChIP qPCR Primers High Specificity 8 Transcription Factor Binding and mRNA Expression Analysis 3 2 1 Figure 1: The Entire ChampionChIP System Protocol Can Be Completed in a Single Day. 10 H3Ac H3K4me2 H3K27me3 Control IgG Figure 3: Differential Histone Modification Tiling Across the Sequence of Any Gene. How the ChampionChIPTM System Works 12 Differential Histone Modification Across Any Gene +10 +9 +8 +7 +6 +5 +4 +3 +2 +1 -1 -2 -3 -4 -5 -6 -7 -8 -9 -10 -11 -12 -13 -14 -15 -16 -17 -18 -19 -20 The ChampionChIPTM System provides the first complete platform for the analysis of in vivo protein-DNA interactions using Chromatin Immunoprecipitation (ChIP) and real-time PCR (qPCR) detection. With validated high-quality ChIP-grade antibodies and PCR primers for any genes’ promoter region, a simple and robust one-day preparation assay quickly delivers reliable and biologically relevant results. ChIP qPCR is a powerful and versatile method for the analysis of chromatin DNA bound by transcription factors, co-regulators, modified histones, chromatin remodeling proteins, or other nuclear factors from live cells. However, the tedious process and variable results have limited many researchers’ ability to adopt this technique to study dynamic protein-DNA interactions in native chromatin environments. The ChampionChIPTM System, yields the most reliable ChIP assay results with qPCR precision in just a single day. Percent of DNA Input [%] Reliable Chromatin IP with Real-Time PCR Precision Achieved in Only ONE DAY! 334001 Inquire Inquire Custom ChampionChIP qPCR Arrays Inquire Inquire Inquire Product Any Promoter Region for Human, Mouse or Rat ALDOA MYO-D Genomic Loci SAT2 TF Binding Sites or Promoter Tiling 330520 RT SYBR Green w/ ROX Master Mix 2 330510 RT SYBR Green w/ Fluorescein Master Mix 2 330500 RT SYBR Green Only Master Mix ChampionChIP PCR Array Data Analysis Software 2 Figure 2. The ChampionChIP System Readily and Correctly Identifies Different Euchromatin and Heterochromatin Loci. ChampionChIP antibodies against modified histones (H3K4me2, H3K27me3, H3K9me3) or control IgG were used for precipitating chromatin from HeLa cells. Each ChIP DNA fraction was analyzed by real-time PCR using primers specific for the ALDOA, MYO-D, and SAT2 loci to calculate percentages of co-precipitating DNA relative to input. www.SABiosciences.com FREE 19
Methyl-Profiler PCR ARRAY System TM Simple, Fast and Reliable DNA Methylation Analysis The Methyl-ProfilerTM DNA Methylation PCR Array System is an innovative technology enabling fast and accurate detection of DNA methylation status at CpG islands. This technology complements the bisulfite-based methods with simple and simultaneous selective restriction digests of either methylated or unmethylated DNA, and takes advantage of the quantitative power of real-time PCR. The PCR Array format reveals the DNA methylation status of gene panels related to diseases or pathways. The individual primer pairs allow analysis of the DNA methylation status of any human or mouse gene. The reliability and simplicity of the procedure makes this technology ideal for profiling DNA methylation and biomarkers of stem cell growth and differentiation, cancer, and other human diseases. How DNA Methylation PCR ARRAYS Work 1. DNA Digestion. Mix DNA + Digestion Buffer Split into 4 Fractions Why Use the Methyl-ProfilerTM PCR ARRAY System? Simple, Fast and Reliable: No bisulfite conversion and ready-to-use. Disease- or Pathway-Focused Gene Sets: Simultaneously detect DNA methylation of 24 or 96 genes. Genome-wide Coverage: Primers to detect methylation of your favorite genes. The Methyl-Profiler PCR Array System relies on the differential cleavage of target sequences by two different restriction endonucleases whose activities require either the presence or absence of methylated cytosines in their respective recognition sequences. As real-time PCR quantifies the relative amount of intact DNA remaining after each enzyme digestion, the methylation status of individual genes and the methylation profile across a gene panel are reliably and easily calculated. The high yield of DNA from the restriction digests and PCR amplification allow the analysis of smaller, more heterogeneous samples. Results Comparable to Bisulfite Sequencing Add Enzyme: Mock Sensitive Dependent Methylation Sensitive - + - + Methylation Dependent - - + + 37 C (6 hr - overnight) RT SYBR Green qPCR Master Mix 2 ® Mock Sensitive Dependent Double % Total Input DNA Hypermethylated Intermediately Methylated Unmethylated Gene 1 Gene 2 Gene 3 Gene 4 Gene 5 Gene 6 The human genome contains many long hypermethylated stretches of CpG dinucleotide-rich sequences. In this sea of CpG methylation, unmethylated CpG-rich sequences, known as “CpG islands”, are found in the promoters of most transcriptionally active genes. These normal patterns of DNA methylation are perturbed in cancer cells, where specific tumor suppressor genes (TSG) become hypermethylated, causing their expression to be silenced. Since every tumor type has a unique “methylation profile”, or panel of hypermethylated genes, the analysis of TSG hypermethylation has become very important for basic cancer research, clinical diagnostics, and therapeutic applications. The Methyl-Profiler PCR Array System fulfills the need to rapidly and simultaneously determine the methylation status of more genes in more samples in a higher-throughput fashion. The current time- and labor-intensive methodologies require bisulfite conversion of unmethylated cytosines to uracil followed by either sequence analysis or PCR using primers sensitive to the resulting base conversion. Bisulfite conversion is not only tedious but is also inefficient and damages DNA. The resulting low yields of DNA make bisulfite-based methods unsuitable for the analysis of small samples. 20 90 Support@SABiosciences.com Hypermethylated Intermediately Methylated Unmethylated 80 70 60 50 40 30 20 10 0 3. Data Analysis. 100 80 60 40 20 0 Percent of Input DNA [%] Double o 2. Real-Time PCR. 100 Bisulfite Sequencing MethylProfiler MCF7 Bisulfite Sequencing MethylProfiler SKBR3 Bisulfite Sequencing MethylProfiler MDA-MB-231 Figure 1: Methyl-Profiler PCR Assays Yield Results Consistent with Bisulfite Sequencing. The methylation status of the cadherin 1 gene (CDH1) was determined using bisulfite sequencing and Methyl-Profiler PCR Assays in three breast cancer cell lines known to have very different CDH1 methylation patterns. To validate the accuracy of the Methyl-Profiler PCR Array System, its results were compared with those generated by bisulfite sequencing, the gold standard for DNA methylation analysis. The methylation status for both the CDH1 (Figure 1) and CDH13 (data not shown) genes observed in three different breast cancer cell lines by the two methods match very closely. Real-time PCR characterization of methylation-dependent and methylation-sensitive restriction enzyme digestions directly quantifies unmethylated and hypermethylated genomic DNA, respectively. The results indicate that the sensitivity and specificity of the MethylProfiler PCR Array System rivals bisulfite sequencing, suggesting that it can provide an alternative to more tedious bisulfite PCR analysis methods. Make your DNA Methylation analysis as quick and painless as possible with the Methyl-Profiler DNA Methylation PCR System and EXCEL-based data analysis. Download our FREE EXCEL Data Analysis Software: www.SABiosciences.com/dna_methylation.php
Methyl-ProfilerTM PCR ARRAY System PCR ARRAY Guide v4.0 Novel Breast Cancer Biomarker Discovery 100 Hypermethylated Intermediately Methylated Unmethylated 80 70 60 50 40 30 20 10 0 100 93.75 87.5 75 50 33.33 12.5 6.25 0 and normal blood genomic DNA (encoding hypermethylated and unmethylated HIC1, respectively) were mixed in different ratios. Using Human HIC1 Methyl-Profiler qPCR Primers, the percentage of hypermethylated HIC1 relative to total promoter DNA in each mixture was detectable down to 6.25 percent. Primary tumors are typically very heterogeneous, containing a mixture of both cancerous and noncancerous cells. Therefore, reliable tumor characterization requires detecting smaller amounts of hypermethylated DNA diluted in an unmethylated background. Methyl-Profiler PCR Assays have the sensitivity required to detect hypermethylated DNA from breast cancer cells even when they represent only 6.25 % of the total cell population (Figure 2). Applications MLH1 ATM APC CHFR CAV1 CRBP1 FHIT BRCA1 CDKN2A CDKN1A SFN p14ARF PYCARD GADD45A ZMYND10 GSTP1 CDH1 CALCA MGMT ABCB1 CDH13 WT1 p73 HIC1 % Hypermethylated DNA 30% 40% 50% 60% 70% >80% Blood MCF7 SKBR3 24 Signature Breast Cancer Tumor Suppressor Genes Breast Cancer Biomarker Validation 20% 20% 30% 40% 50% 60% 70% Normal MDA- MDA- UACC812 MDA- SKBR3 SKBR3 MCF7 MCF7 MB-415 MB-231 MB-435 Figure 2: Methyl-Profiler PCR Assays Detect Hypermethylation in Heterogeneous Samples Containing As Little As Five Percent Tumor DNA. SKBR3 breast cancer cell line 10% 10% >80% Percent SKBR3 Genomic DNA [%] <10% 79 Transcription Factor Genes <10% 90 % Hypermethylated DNA Percent of Total Input DNA [%] Sensitivity Comparable to Bisulfite Sequencing MDA-MB-231 Cell Lines Figure 3: Methyl-Profiler PCR Arrays Validate Breast Cancer Gene Methylation Status in Breast Cancer Cell Lines. Heat map comparison of the hypermethylation status of 24 genes in the genomic DNA of three breast cancer cell lines and blood genomic DNA as determined by Human Breast Cancer Signature Panel DNA Methylation PCR Arrays. To demonstrate that Methyl-Profiler PCR Arrays can validate methylation biomarkers, we first scanned published results to design a cataloged PCR Array representing a signature panel of the 24 most frequently methylated genes in human breast tumors. We then analyzed the methylation profile of this gene panel in three different breast cancer cell lines (Figure 3). The results further strengthen the correlation of these biomarkers with breast cancer. Cell Lines Figure 4: Methyl-Profiler PCR Arrays Discover New Candidate Breast Cancer DNA Methylation Biomarkers. Heat map comparison of the hypermethylation status of a panel of 79 transcription factor genes in six breast cancer cell lines and a normal epithelial cell line as determined with Custom DNA Methylation PCR Arrays. To demonstrate that Methyl-Profiler PCR Arrays can also discover new biomarkers, we arranged a custom array containing a panel of candidate transcription factor genes, whose methylation status had not been previously associated with breast cancer (Figure 4). We found that breast cancer cell lines also hypermethylate this gene panel, potentially providing a new discovery source for cancer biomarkers. The Methyl-Profiler DNA Methylation PCR Array System is ideally suited to genomic DNA hypermethylation analysis for both basic research applications and clinical biomarker development. The simple two-step procedure is considerably faster and easier than current bisulfite sequencing and bisulfite PCR methods, and yields closely matching results with equivalent sensitivity. Methyl-Profiler TM DNA Methylation PCR ARRAYS Product* Breast Cancer Gastric Cancer Liver Cancer Lung Cancer Prostate Cancer Colon Cancer Human Stem Cell Transcription Factors Inflammatory Response T Cell Activation Cytokine Production Tumor Suppressor Genes (TSG) Homeobox Genes (HOX) Polycomb Genes (PcG) Custom Methyl-Profiler PCR Arrays Catalog # Human Mouse 335211 335211 335211 335211 335211 335211 335211 335211 335211 335211 335211 335211 335211 MeAH-011 MeAH-021 MeAH-031 MeAH-041 MeAH-051 MeAH-061 MeAH-511 MeaH-521 MeaH-531 MeAH-541 MeAH-551 MeAH-561 MeAH-571 Inquire MeAM-011 MeAM-021 MeAM-031 MeAM-041 MeAM-051 MeAM-061 MeAM-511 MeAM-521 MeAM-531 MeAM-541 MeAM-551 MeAM-561 MeAM-571 Inquire * Methyl-Profiler PCR Arrays are available in Signature Panels (24 genes) & Comprehensive Panels (96 genes). PCR ARRAY Accessories Pack Size Methyl-Profiler qPCR Assays 200 Reactions Methyl-Profiler Enzyme Kit 12 Samples 2 RT SYBR Green Master Mixes (see page 6) 2 Arrays Methyl-Profiler PCR Array Data Analysis Software www.SABiosciences.com Catalog # 335001 335451 Various FREE 21
QIAGEN® DNeasy® Blood & Tissue Kits Purification of Total DNA from Cells, Tissues & Blood What Are DNeasy Blood & Tissue Kits? DNeasy Blood & Tissue Kits provide fast and easy silica-based DNA purification in convenient spin-column and 96-well-plate formats. Most samples can be directly lysed with proteinase K, eliminating the need for mechanical disruption and reducing hands-on time. Optimized protocols for specific sample types provide reproducible purification of high-quality DNA for life science, genotyping, and veterinary pathogen research applications. Why Use DNeasy Blood & Tissue Kits? DNeasy Blood & Tissue Kits simplify purification of DNA from a wide range of sample types, including animal species commonly encountered in life science, veterinary, and genotyping applications. The efficient DNeasy Blood & Tissue procedure enables high yields of total DNA from animal blood and tissue samples. Typical Yields Using DNeasy Blood & Tissue Kits Source Amount DNA [µg] Mammalian Blood Bird Blood HeLa Cells Liver Brain Kidney Spleen Mouse Tail Rat Tail Pig Ear Horse Hair Fish Fin Fish Spawn (mackerel) 100 µL 5 µL 2 x 106 25 mg 25 mg 25 mg 10 mg 1.2 cm (tip) 0.6 cm (tip) 25 mg 10 hairs 20 mg 10 mg 3-6 9-40 15-25 10-30 15-30 15-30 5-30 10-25 20-40 10-30 2-4 10-20 5-10 QIAGEN DNeasy Blood & Tissue Kits How Do DNeasy Blood & Tissue Kits Work? Product DNeasy Blood & Tissue Kits use reliable silica-membrane technology, in convenient spin-column or 96-well formats. This technology ensures fast and reproducible DNA purification, eliminating the need for organic extraction and alcohol precipitation. Catalog # 69581 69582 69506 69504 DNeasy 96 Blood & Tissue Kit (4) 4 x 96 DNA minipreps DNeasy 96 Blood & Tissue Kit (12) 12 x 96 DNA minipreps DNeasy Blood & Tissue Kit (250) 250 DNA minipreps DNeasy Blood & Tissue Kit (50) 50 DNA minipreps QIAGEN® QIAamp® DNA Mini Kits Purification of Genomic, Mitochondrial, Bacterial, Parasitic, or Viral DNA What are QIAamp DNA Mini Kits? QIAamp DNA Mini Kits provide silica-membrane-based nucleic acid purification from tissues, swabs, CSF, blood, body fluids, or washed cells from urine. The spin-column procedure does not require mechanical homogenization, so total hands-on preparation time is only 20 minutes. Why use QIAamp DNA Mini Kits? QIAamp DNA technology yields genomic, mitochondrial, bacterial, parasite, or viral DNA from human tissue samples ready to use in PCR and blotting procedures. DNA purified using the QIAamp DNA Mini Kit is sized up to 50 kb. DNA of this length denatures completely and has the highest amplification efficiency. How do QIAamp DNA Mini Kits work? QIAamp DNA Mini Kits use fast spin-column or vacuum procedures. No phenolchloroform extraction is required. DNA binds specifically to the QIAamp silica-gel membrane while contaminants pass through. PCR inhibitors such as divalent cations and proteins are completely removed in two efficient wash steps, leaving purified DNA to be eluted in either water or a buffer provided with the kit. 22 Support@SABiosciences.com Typical Yields Using QIAamp DNA Mini Kits Sample Blood Buffy Coat Cells Liver Brain Lung Heart Kidney Spleen Amount Total Nucleic Acids [µg]* DNA [µg]† 200 µL 200 µL 107 25 mg 25 mg 25 mg 25 mg 25 mg 10 mg 4-12 25-50 40-60 60-115 35-60 25-45 15-40 40-85 25-45 4-12 25-50 30-40 10-30 15-30 5-10 5-10 15-30 5-30 * Nucleic acids obtained without RNase treatment. † DNA obtained with RNase treatment. QIAGEN QIAamp DNA Mini Kits Product Catalog # QIAamp DNA Mini Kit (250) For 250 DNA preps 51306 QIAamp DNA Mini Kit (50) For 50 DNA preps 51304
PreAnalytiX® PAXgene® DNA System Collection & Stabilization of Blood or Tissue Samples & Subsequent DNA Purification What Is the PAXgene DNA System? A For blood, the PAXgene Blood DNA System is an integrated and standardized system for collection and stabilization of whole blood specimens and subsequent purification of genomic DNA. The system uses PAXgene Blood DNA Tubes for blood collection and stabilization, and the PAXgene Blood DNA Kit for subsequent DNA purification. For tissue, the PAXgene Tissue DNA System enables molecular and traditional pathology testing from the same specimen, providing a superior alternative to traditional tissue fixation methods. PAXgene Tissue Containers are used for collection, stabilization, and storage of tissue specimens, while preserving tissue morphology. The PAXgene Tissue DNA Kit allows subsequent purification of DNA. Why Use the PAXgene DNA System? The PAXgene Blood DNA System provides blood collection and purification in one system, easy sample transport after collection, and high-quality, high-molecular–weight DNA. The PAXgene Tissue DNA System provides an integrated system for fixation, stabilization, and purification. It both preserves tissue morphology and provides high-quality DNA. How Does the PAXgene DNA System Work? PAXgene Blood DNA Tubes are used for collection under vacuum of 8.5 mL whole blood. These tubes contain a proprietary blend of reagents that both prevents blood coagulation and stabilizes white blood cells. For DNA isolation, the blood is transferred to processing tubes filled with cell lysis buffer and the solution is mixed to lyse red and white blood cells. Cell nuclei and mitochondria are pelleted by centrifugation, washed, and resuspended in digestion buffer. Protein contaminants are removed by incubation with a protease. DNA is precipitated in isopropanol, washed in 70% ethanol, dried, and resuspended in resuspension buffer. For tissue, samples are placed into PAXgene Tissue Containers. These are dual-chamber containers prefilled with 2 reagents: PAXgene Tissue Fix which rapidly penetrates and fixes the tissue and PAXgene Tissue Stabilizer which stops fixation and stabilizes tissue. DNA purification is performed using the PAXgene Tissue DNA Kit which uses silica-based technology in a spin-column format. M M 48.5 kb B M M 145.5 kb 48.5 kb Figure 1. High Quality and High Molecular Weight of Genomic DNA. Genomic DNA was isolated from 8 blood donors using the PAXgene Blood DNA System. [A] Agarose gel analysis; [B] pulsed-field gel electrophoresis for enhanced separation of high-molecular–weight genomic DNA; [M] markers. PreAnalytiX PAXgene DNA Kits Product Catalog # 761133 PAXgene Tissue Containers (10) For 10 tissue samples PAXgene Tissue Containers are dual-cavity containers prefilled with 2 reagents. PAXgene Tissue Fix rapidly penetrates and fixes the tissue, preserving tissue morphology. Fixation is comparable to formalin fixation, but without the destructive nucleic acid crosslinking and degradation. After fixation, the tissue is transferred to PAXgene Tissue Stabilizer in the same container. Nucleic acids and morphology of the sample are stable up to 7 days at room temperature, for longer periods at 2-8°C, or even at -20°C. Stabilized samples can be embedded in paraffin for histological studies. PAXgene Tissue Kits provide efficient subsequent purification of RNA, miRNA, and/or DNA from the same sample. Inquire PAXgene Blood DNA Kit (25) For 25 DNA preparations PAXgene Tissue Containers PAXgene Blood DNA Tubes (100) For collection of 100 samples 765112 PAXgene Tissue DNA Kit (50) For 50 DNA preparations 767134 PAXgene Blood DNA Tubes The PAXgene Blood DNA system consists of PAXgene Blood DNA Tubes, for blood collection and stabilization, and the PAXgene Blood DNA Kit, for DNA purification in a single-tube procedure. www.SABiosciences.com 23
RT2 Profiler PCR ARRAY Publications Selected Research Papers Citing RT2 Profiler PCR ARRAYS* References Listed by Pathway-Focused PCR Arrays ANGIOGENESIS APPLICATION: CANCER BIOLOGY Brant KA, Fabisiak JP. Nickel and the microbial toxin, MALP-2, stimulate proangiogenic mediators from human lung fibroblasts via a HIF-1alpha and COX-2-mediated pathway. Toxicol Sci. 2009 Jan;107(1):227-37. Liu Z, Kobayashi K, van Dinther M, van Heiningen SH, Valdimarsdottir G, van Laar T, Scharpfenecker M, Lowik CW, Goumans MJ, Ten Dijke P, Pardali E. VEGF and inhibitors of TGFbeta type-I receptor kinase synergistically promote J Cell Sci. 2009 Sep 15;122(Pt 18):3294-302. McElroy MK, Kaushal S, Tran Cao HS, Moossa AR, Talamini MA, Hoffman RM, Bouvet M. Upregulation of thrombospondin-1 and angiogenesis in an aggressive human Mol Cancer Ther. 2009 Jul;8(7):1779-86. APOPTOSIS Bose RN, Maurmann L, Mishur RJ, Yasui L, Gupta S, Grayburn WS, Hofstetter H, Milton T. Non-DNA-binding platinum anticancer agents: Cytotoxic activities of platinum-phosphato complexes towards human ovarian cancer cells. Proc Natl Acad Sci U S A. 2008 Nov 25;105(47):18314-9. Uetani T, Nakayama H, Okayama H, Okura T, Higaki J, Inoue H, Higashiyama S. Insufficiency of proHB-EGF shedding enhances hypoxic cell death in H9c2 cardiomyoblasts via the activation of Caspase-3 and c-JUN N-terminal kinase. J Biol Chem. 2009 Feb 4. Bok K, Prikhodko VG, Green KY, Sosnovtsev SV. Apoptosis in Murine Norovirus Infected RAW264.7 Cells is Associated with Survivin Downregulation. J Virol. 2009 Feb 11. Mhyre AJ, Marcondes AM, Spaulding EY, Deeg HJ. Stroma-dependent apoptosis in clonal hematopoietic precursors correlates with expression of PYCARD. Blood. 2009 Jan 15;113(3):649-58. Pru JK, Kaneko-Tarui T, Jurisicova A, Kashiwagi A, Selesniemi K, Tilly JL. Induction of proapoptotic gene expression and recruitment of p53 herald ovarian Reprod Sci. 2009 Apr;16(4):347-56. BREAST CANCER & ESTROGEN RECEPTOR SIGNALING Cooper C, Guo J, Yan Y, Chooniedass-Kothari S, Hube F, Hamedani MK, Murphy LC, Myal Y, Leygue E. Increasing the relative expression of endogenous non-coding Steroid Receptor RNA Nucleic Acids Res. 2009 Jul;37(13):4518-31. Adams BD, Cowee DM, White BA. The role of miR-206 in the epidermal growth factor (EGF) induced repression of Mol Endocrinol. 2009 Aug;23(8):1215-30. TM CANCER PATHWAYFINDER Gridley DS, Slater JM, Luo-Owen X, Rizvi A, Chapes SK, Stodieck LS, Ferguson VL, Pecaut MJ. Spaceflight effects on T lymphocyte distribution, function and gene expression. J Appl Physiol. 2009 Jan;106(1):194-202. Das KK, Bajpai M, Kong Y, Liu J, Geng X, Das KM. Mesalamine suppresses the expression of TC22, a novel tropomyosin isoform Mol Pharmacol. 2009 Jul;76(1):183-91. * For a complete list of publications, please visit: www.SABiosciences.com/support_publication.php 24 Support@SABiosciences.com Figure: PIK3CA mRNA Expression in Multiple Lung Cancer Cell Lines. PIK3CA mRNA expression was compared among cell lines having different features, such as PIK3CA alterations or mutations of other genes involved in the EGFR signaling pathway. PIK3CA mRNA expression levels were expressed relative to the mean levels in six HBEC cell lines. PIK3CA mRNA expression in PIK3CA gain or EGFR mutant cell lines were significantly increased compared with that of wild-type cell lines. However, PIK3CA mutant lines do not express increased mRNA levels. Horizonatal bars indicate mean values. The Kruskal-Wallis test with Dunn’s multiple comparison test was used to determine significance. Yamamoto, H., et al. Cancer Research 2008; 68: 6913-6921. CELL CYCLE Chen S, Sims GP, Chen XX, Gu YY, Chen S, Lipsky PE. Modulatory effects of 1,25-dihydroxyvitamin D3 on human B cell differentiation. J Immunol. 2007 Aug 1;179(3):1634-47. Lu SY, Sontag DP, Detillieux KA, Cattini PA. FGF-16 is released from neonatal cardiac myocytes and alters growth-related signaling: a possible role in postnatal development. Am J Physiol Cell Physiol. 2008 May;294(5):C1242-9. Higgins S, Wong SH, Richner M, Rowe CL, Newgreen DF, Werther GA, Russo VC. Fibroblast growth factor 2 reactivates G1 checkpoint in SK-N-MC cells via Endocrinology. 2009 Sep;150(9):4044-55. CHEMOKINES & RECEPTORS Miselis NR, Wu ZJ, Van Rooijen N, Kane AB Targeting tumor-associated macrophages in an orthotopic murine model of diffuse malignant mesothelioma. Mol Cancer Ther. 2008 Apr;7(4):788-99. Lim J, Derrick SC, Kolibab K, Yang AL, Porcelli S, Jacobs WR, Morris SL. Early pulmonary cytokine and chemokine responses in mice immunized with three different vaccines against Mycobacterium tuberculosis determined by PCR array. Clin Vaccine Immunol. 2009 Jan;16(1):122-6. Fukami N, Ramachandran S, Saini D, Walter M, Chapman W, Patterson GA, Mohanakumar T. Antibodies to MHC class I induce autoimmunity: role in the pathogenesis of chronic rejection. J Immunol. 2009 Jan 1;182(1):309-18. Cheung KP, Yang E, Goldrath AW. Memory-like CD8+ T cells generated during homeostatic proliferation defer to J Immunol. 2009 Sep 1;183(5):3364-72. Sundararaj KP, Samuvel DJ, Li Y, Sanders JJ, Lopes-Virella MF, Huang Y. Interleukin-6 released from fibroblasts is essential for up-regulation of matrix J Biol Chem. 2009 May 15;284(20):13714-24.
PUBLICATIONS: PCR ARRAYS COMMON CYTOKINES Silver RF, Walrath J, Lee H, Jacobson BA, Horton H, Bowman MR, Nocka K, Sypek JP. Human Alveolar Macrophage Gene Responses to Mycobacterium tuberculosis Strains H37Ra and H37Rv. Am J Respir Cell Mol Biol. 2008 Sep 11. Nacu N, Luzina IG, Highsmith K, Lockatell V, Pochetuhen K, Cooper ZA, Gillmeister MP, Todd NW, Atamas SP Macrophages produce TGF-beta-induced (beta-ig-h3) following ingestion of apoptotic cells and regulate MMP14 levels and collagen turnover in fibroblasts J Immunol. 2008 Apr 1;180(7):5036-44. Campeau PM, Rafei M, Boivin MN, Sun Y, Grabowski GA, Galipeau J. Characterization of Gaucher disease bone marrow mesenchymal stromal cells reveals Blood. 2009 Oct 8;114(15):3181-90. Shinoda Y, Ogata N, Higashikawa A, Manabe I, Shindo T, Yamada T, Kugimiya F, Ikeda T, Kawamura N, Kawasaki Y, Tsushima K, Takeda N, Nagai R, Hoshi K, Nakamura K, Chung UI, Kawaguchi H. Kruppel-like factor 5 causes cartilage degradation through transactivation of matrix metalloproteinase 9. J Biol Chem. 2008 Jul 10. Myskiw C, Arsenio J, van Bruggen R, Deschambault Y, Cao J. Vaccinia virus E3 suppresses expression of diverse cytokines through inhibition J Virol. 2009 Jul;83(13):6757-68. Lucio-Eterovic AK, Piao Y, de Groot JF. Mediators of glioblastoma resistance and invasion during antivascular endothelial Clin Cancer Res. 2009 Jul 15;15(14):4589-99. CUSTOM PCR ARRAYS Kuhn AR, Schlauch K, Lao R, Halayko AJ, Gerthoffer WT, Singer CA. MicroRNA Expression in Human Airway Smooth Muscle Cells: Role of miR-25 in Am J Respir Cell Mol Biol. 2009 Jun 18. Huang J, Chen K, Huang J, Gong W, Dunlop NM, Howard OM, Bian X, Gao Y, Wang JM. Regulation of the leucocyte chemoattractant receptor FPR in glioblastoma cells by cell differentiation. Carcinogenesis. 2009 Feb;30(2):348-55. ENDOTHELIAL CELL BIOLOGY Chahrour M, Jung SY, Shaw C, Zhou X, Wong ST, Qin J, Zoghbi HY. MeCP2, a Key Contributor to Neurological Disease, Activates and Represses Transcription Science. 2008 May 30;320(5880):1224-9. Peduto L, Dulauroy S, Lochner M, Spath GF, Morales MA, Cumano A, Eberl G. Inflammation recapitulates the ontogeny of lymphoid stromal cells. J Immunol. 2009 May 1;182(9):5789-99. Ianzini F, Kosmacek EA, Nelson ES, Napoli E, Erenpreisa J, Kalejs M, Mackey MA. Activation of meiosis-specific genes is associated with depolyploidization of Cancer Res. 2009 Mar 15;69(6):2296-304. Schreiber TH, Deyev VV, Rosenblatt JD, Podack ER. Tumor-induced suppression of CTL expansion and subjugation by gp96-Ig Cancer Res. 2009 Mar 1;69(5):2026-33. DiMeo TA, Anderson K, Phadke P, Fan C, Perou CM, Naber S, Kuperwasser C. A novel lung metastasis signature links Wnt signaling with cancer cell Cancer Res. 2009 Jul 1;69(13):5364-73. DNA DAMAGE Hoffman AE, Zheng T, Ba Y, Zhu Y. The circadian gene NPAS2, a putative tumor suppressor, is involved in DNA damage response. Mol Cancer Res. 2008 Sep;6(9):1461-8. Chesnokova V, Wong C, Zonis S, Gruszka A, Wawrowsky K, Ren SG, Benshlomo A, Yu R. Diminished pancreatic {beta} cell mass in securin-null mice is caused by {beta} cell apoptosis and senescence. Endocrinology. 2009 Feb 12. Li Z, Suzuki Y, Huang M, Cao F, Xie X, Connolly AJ, Yang PC, Wu JC Comparison of Reporter Gene and Iron Particle Labeling for Tracking Fate of Human Embryonic Stem Cells and Differentiated Endothelial Cells in Living Subjects. Stem Cells. 2008 Apr;26(4):864-73. Asada S, Takahashi T, Isodono K, Adachi A, Imoto H, Ogata T, Ueyama T, Matsubara H, Oh H. Downregulation of Dicer expression by serum withdrawal sensitizes human endothelial cells to apoptosis. Am J Physiol Heart Circ Physiol. 2008 Dec;295(6):H2512-21. GROWTH FACTORS Stirling DP, Liu S, Kubes P, Yong VW Depletion of Ly6G/Gr-1 leukocytes after spinal cord injury in mice alters wound healing and worsens neurological outcome. J Neurosci. 2009 Jan 21;29(3):753-64. HYPOXIA SIGNALING Wendler CC, Amatya S, McClaskey C, Ghatpande S, Fredholm BB, Rivkees SA. A1 adenosine receptors play an essential role in protecting the embryo against hypoxia. Proc Natl Acad Sci U S A. 2007 Jun 5;104(23):9697-702. Mueller BR, Bale TL. Sex-specific programming of offspring emotionality after stress early in pregnancy. J Neurosci. 2008 Sep 3;28(36):9055-65. APPLICATION: INFLAMMATORY CYTOKINES & RECEPTORS Santisteban M, Reiman JM, Asiedu MK, Behrens MD, Nassar A, Kalli KR, Haluska P, Ingle JN, Hartmann LC, Manjili MH, Radisky DC, Ferrone S, Knutson KL. Immune-induced epithelial to mesenchymal transition in vivo generates breast Cancer Res. 2009 Apr 1;69(7):2887-95. DRUG METABOLISM: PHASE I ENZYMES Ning B, Dial S, Sun Y, Wang J, Yang J, Guo L Systematic and simultaneous gene profiling of 84 drug-metabolizing genes in primary human hepatocytes J Biomol Screen. 2008 Mar;13(3):194-201. EXTRACELLULAR MATRIX & ADHESION MOLECULES Johansen LD, Naumanen T, Knudsen A, Westerlund N, Gromova I, Junttila M, Nielsen C, Bottzauw T, Tolkovsky A, Westermarck J, Coffey ET, Jaattela M, Kallunki T. IKAP localizes to membrane ruffles with filamin A and regulates actin cytoskeleton organization and cell migration. J Cell Sci. 2008 Mar 15;121(Pt 6):854-64. Figure: Lineage-dependent Differences in Expression of Treg Functional Genes. Quantitative PCR analysis of selected genes related to Treg function in CD4+CD25+ cells from Mossi, Fulani, and European donors infected with Plasmodium falciparum (malaria). CD4+CD25+ cells were isolated from 12 Mossi (red bars) and 12 Fulani (blue bars) donors included in the study and 10 European donors (gray bars), and lysed to obtain total RNA. Equal amounts of RNA (50 ng) from each donor were reverse-transscribed and amplified in duplicate in RT2 Custom PCR Arrays to simultaneously examine the mRNA levels of nine selected genes related to Treg activity using PPIA, GAPDH, and ACTB as housekeeping genes (HKG). Data was normalized to the mean values of the HKG, and a relative amount of RNA was calculated using the 2-∆C method. t Torcia MG, Santarlasci V,. et al. Proc Natl Acad Sci U S A. 2008 Jan 15;105:646-651. www.SABiosciences.com 25
Pcrhandbook ver4
Pcrhandbook ver4
Pcrhandbook ver4
Pcrhandbook ver4
Pcrhandbook ver4

Recomendados

Pcrarraywhitepaper
PcrarraywhitepaperPcrarraywhitepaper
PcrarraywhitepaperElsa von Licy
 
1073956 wp rt2_profilerarrays_1012
1073956 wp rt2_profilerarrays_10121073956 wp rt2_profilerarrays_1012
1073956 wp rt2_profilerarrays_1012Elsa von Licy
 
Multicopy reference assay (MRef) — a superior normalizer of sample input in D...
Multicopy reference assay (MRef) — a superior normalizer of sample input in D...Multicopy reference assay (MRef) — a superior normalizer of sample input in D...
Multicopy reference assay (MRef) — a superior normalizer of sample input in D...QIAGEN
 
RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...
RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...
RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...QIAGEN
 
A field-deployable RT-PCR system performs equivalently to real-time RT-PCR in...
A field-deployable RT-PCR system performs equivalently to real-time RT-PCR in...A field-deployable RT-PCR system performs equivalently to real-time RT-PCR in...
A field-deployable RT-PCR system performs equivalently to real-time RT-PCR in...Simon Chung - genereach
 
10 Tips to maximize your Real Time PCR Success - Download the Technical Note
10 Tips to maximize your Real Time PCR Success - Download the Technical Note10 Tips to maximize your Real Time PCR Success - Download the Technical Note
10 Tips to maximize your Real Time PCR Success - Download the Technical NoteQIAGEN
 
Microarray validation
Microarray validationMicroarray validation
Microarray validationElsa von Licy
 
The importance of controls and novel solutions for successful real-time qPCR
The importance of controls and novel solutions for successful real-time qPCRThe importance of controls and novel solutions for successful real-time qPCR
The importance of controls and novel solutions for successful real-time qPCRQIAGEN
 

Recomendados

Pcrarraywhitepaper
PcrarraywhitepaperPcrarraywhitepaper
PcrarraywhitepaperElsa von Licy
 
1073956 wp rt2_profilerarrays_1012
1073956 wp rt2_profilerarrays_10121073956 wp rt2_profilerarrays_1012
1073956 wp rt2_profilerarrays_1012Elsa von Licy
 
Multicopy reference assay (MRef) — a superior normalizer of sample input in D...
Multicopy reference assay (MRef) — a superior normalizer of sample input in D...Multicopy reference assay (MRef) — a superior normalizer of sample input in D...
Multicopy reference assay (MRef) — a superior normalizer of sample input in D...QIAGEN
 
RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...
RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...
RT2 Profiler PCR Arrays: Pathway-focused Gene Expression Profiling with qRT-P...QIAGEN
 
A field-deployable RT-PCR system performs equivalently to real-time RT-PCR in...
A field-deployable RT-PCR system performs equivalently to real-time RT-PCR in...A field-deployable RT-PCR system performs equivalently to real-time RT-PCR in...
A field-deployable RT-PCR system performs equivalently to real-time RT-PCR in...Simon Chung - genereach
 
10 Tips to maximize your Real Time PCR Success - Download the Technical Note
10 Tips to maximize your Real Time PCR Success - Download the Technical Note10 Tips to maximize your Real Time PCR Success - Download the Technical Note
10 Tips to maximize your Real Time PCR Success - Download the Technical NoteQIAGEN
 
Microarray validation
Microarray validationMicroarray validation
Microarray validationElsa von Licy
 
The importance of controls and novel solutions for successful real-time qPCR
The importance of controls and novel solutions for successful real-time qPCRThe importance of controls and novel solutions for successful real-time qPCR
The importance of controls and novel solutions for successful real-time qPCRQIAGEN
 
Advanced miRNA Expression Analysis: miRNA and its Role in Human Disease Webin...
Advanced miRNA Expression Analysis: miRNA and its Role in Human Disease Webin...Advanced miRNA Expression Analysis: miRNA and its Role in Human Disease Webin...
Advanced miRNA Expression Analysis: miRNA and its Role in Human Disease Webin...QIAGEN
 
Biochain PCR Products
Biochain PCR ProductsBiochain PCR Products
Biochain PCR Productsbiochain
 
QIAGEN LNA Tools - Experience truly exceptional RNA Research
QIAGEN LNA Tools - Experience truly exceptional RNA ResearchQIAGEN LNA Tools - Experience truly exceptional RNA Research
QIAGEN LNA Tools - Experience truly exceptional RNA ResearchQIAGEN
 
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3QIAGEN
 
Simultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE SampleSimultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE SampleQIAGEN
 
Critical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCRCritical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCRQIAGEN
 
PCR - From Setup to Cleanup: A Beginner`s Guide with Useful Tips and Tricks -...
PCR - From Setup to Cleanup: A Beginner`s Guide with Useful Tips and Tricks -...PCR - From Setup to Cleanup: A Beginner`s Guide with Useful Tips and Tricks -...
PCR - From Setup to Cleanup: A Beginner`s Guide with Useful Tips and Tricks -...QIAGEN
 
Pp gef rt2_profiler_0212_web
Pp gef rt2_profiler_0212_webPp gef rt2_profiler_0212_web
Pp gef rt2_profiler_0212_webElsa von Licy
 
Automated DNA extraction from FFPE tissue using a xylene free deparaffinizati...
Automated DNA extraction from FFPE tissue using a xylene free deparaffinizati...Automated DNA extraction from FFPE tissue using a xylene free deparaffinizati...
Automated DNA extraction from FFPE tissue using a xylene free deparaffinizati...QIAGEN
 
RT PCR KIT For Covid 19 | Covid-19 RT PCR KIT
RT PCR KIT For Covid 19 | Covid-19 RT PCR KITRT PCR KIT For Covid 19 | Covid-19 RT PCR KIT
RT PCR KIT For Covid 19 | Covid-19 RT PCR KITADITYASAINI74
 
RNase H2 PCR—A New Technology to Reduce Primer Dimers and Increase Genotyping...
RNase H2 PCR—A New Technology to Reduce Primer Dimers and Increase Genotyping...RNase H2 PCR—A New Technology to Reduce Primer Dimers and Increase Genotyping...
RNase H2 PCR—A New Technology to Reduce Primer Dimers and Increase Genotyping...Integrated DNA Technologies
 
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...QIAGEN
 
8 Challenges to Successful One-Step RT-PCR
8 Challenges to Successful One-Step RT-PCR8 Challenges to Successful One-Step RT-PCR
8 Challenges to Successful One-Step RT-PCRQIAGEN
 
Ascbrn ai poster
Ascbrn ai posterAscbrn ai poster
Ascbrn ai posterElsa von Licy
 
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...QIAGEN
 
Human Pathogen Booklet
Human Pathogen BookletHuman Pathogen Booklet
Human Pathogen BookletAli Mahmoudpour, Ph.D.
 
Reproducibility, Quality Control and Importance of Automation
Reproducibility, Quality Control and Importance of AutomationReproducibility, Quality Control and Importance of Automation
Reproducibility, Quality Control and Importance of AutomationQIAGEN
 
Pcr array 2013
Pcr array 2013Pcr array 2013
Pcr array 2013Elsa von Licy
 
GEN Reprint_LC1536
GEN Reprint_LC1536GEN Reprint_LC1536
GEN Reprint_LC1536RamaKrishna Badugu
 
1073958 wp guide-develop-pcr_primers_1012
1073958 wp guide-develop-pcr_primers_10121073958 wp guide-develop-pcr_primers_1012
1073958 wp guide-develop-pcr_primers_1012Elsa von Licy
 
Bahan organik tanah
Bahan organik tanahBahan organik tanah
Bahan organik tanahEDIS BLOG
 
Wikner rm
Wikner rmWikner rm
Wikner rmElsa von Licy
 

Más contenido relacionado

La actualidad más candente

Advanced miRNA Expression Analysis: miRNA and its Role in Human Disease Webin...
Advanced miRNA Expression Analysis: miRNA and its Role in Human Disease Webin...Advanced miRNA Expression Analysis: miRNA and its Role in Human Disease Webin...
Advanced miRNA Expression Analysis: miRNA and its Role in Human Disease Webin...QIAGEN
 
Biochain PCR Products
Biochain PCR ProductsBiochain PCR Products
Biochain PCR Productsbiochain
 
QIAGEN LNA Tools - Experience truly exceptional RNA Research
QIAGEN LNA Tools - Experience truly exceptional RNA ResearchQIAGEN LNA Tools - Experience truly exceptional RNA Research
QIAGEN LNA Tools - Experience truly exceptional RNA ResearchQIAGEN
 
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3QIAGEN
 
Simultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE SampleSimultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE SampleQIAGEN
 
Critical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCRCritical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCRQIAGEN
 
PCR - From Setup to Cleanup: A Beginner`s Guide with Useful Tips and Tricks -...
PCR - From Setup to Cleanup: A Beginner`s Guide with Useful Tips and Tricks -...PCR - From Setup to Cleanup: A Beginner`s Guide with Useful Tips and Tricks -...
PCR - From Setup to Cleanup: A Beginner`s Guide with Useful Tips and Tricks -...QIAGEN
 
Pp gef rt2_profiler_0212_web
Pp gef rt2_profiler_0212_webPp gef rt2_profiler_0212_web
Pp gef rt2_profiler_0212_webElsa von Licy
 
Automated DNA extraction from FFPE tissue using a xylene free deparaffinizati...
Automated DNA extraction from FFPE tissue using a xylene free deparaffinizati...Automated DNA extraction from FFPE tissue using a xylene free deparaffinizati...
Automated DNA extraction from FFPE tissue using a xylene free deparaffinizati...QIAGEN
 
RT PCR KIT For Covid 19 | Covid-19 RT PCR KIT
RT PCR KIT For Covid 19 | Covid-19 RT PCR KITRT PCR KIT For Covid 19 | Covid-19 RT PCR KIT
RT PCR KIT For Covid 19 | Covid-19 RT PCR KITADITYASAINI74
 
RNase H2 PCR—A New Technology to Reduce Primer Dimers and Increase Genotyping...
RNase H2 PCR—A New Technology to Reduce Primer Dimers and Increase Genotyping...RNase H2 PCR—A New Technology to Reduce Primer Dimers and Increase Genotyping...
RNase H2 PCR—A New Technology to Reduce Primer Dimers and Increase Genotyping...Integrated DNA Technologies
 
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...QIAGEN
 
8 Challenges to Successful One-Step RT-PCR
8 Challenges to Successful One-Step RT-PCR8 Challenges to Successful One-Step RT-PCR
8 Challenges to Successful One-Step RT-PCRQIAGEN
 
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...QIAGEN
 
Reproducibility, Quality Control and Importance of Automation
Reproducibility, Quality Control and Importance of AutomationReproducibility, Quality Control and Importance of Automation
Reproducibility, Quality Control and Importance of AutomationQIAGEN
 
1073958 wp guide-develop-pcr_primers_1012
1073958 wp guide-develop-pcr_primers_10121073958 wp guide-develop-pcr_primers_1012
1073958 wp guide-develop-pcr_primers_1012Elsa von Licy
 

La actualidad más candente (20)

Advanced miRNA Expression Analysis: miRNA and its Role in Human Disease Webin...
Advanced miRNA Expression Analysis: miRNA and its Role in Human Disease Webin...Advanced miRNA Expression Analysis: miRNA and its Role in Human Disease Webin...
Advanced miRNA Expression Analysis: miRNA and its Role in Human Disease Webin...
 
Biochain PCR Products
Biochain PCR ProductsBiochain PCR Products
Biochain PCR Products
 
QIAGEN LNA Tools - Experience truly exceptional RNA Research
QIAGEN LNA Tools - Experience truly exceptional RNA ResearchQIAGEN LNA Tools - Experience truly exceptional RNA Research
QIAGEN LNA Tools - Experience truly exceptional RNA Research
 
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
PCR Array Data Analysis Tutorial: qPCR Technology Webinar Series Part 3
 
Simultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE SampleSimultaneous Isolation of RNA & DNA from one FFPE Sample
Simultaneous Isolation of RNA & DNA from one FFPE Sample
 
Critical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCRCritical Factors for Successful Real-Time PCR: Multiplex PCR
Critical Factors for Successful Real-Time PCR: Multiplex PCR
 
PCR - From Setup to Cleanup: A Beginner`s Guide with Useful Tips and Tricks -...
PCR - From Setup to Cleanup: A Beginner`s Guide with Useful Tips and Tricks -...PCR - From Setup to Cleanup: A Beginner`s Guide with Useful Tips and Tricks -...
PCR - From Setup to Cleanup: A Beginner`s Guide with Useful Tips and Tricks -...
 
Pp gef rt2_profiler_0212_web
Pp gef rt2_profiler_0212_webPp gef rt2_profiler_0212_web
Pp gef rt2_profiler_0212_web
 
Automated DNA extraction from FFPE tissue using a xylene free deparaffinizati...
Automated DNA extraction from FFPE tissue using a xylene free deparaffinizati...Automated DNA extraction from FFPE tissue using a xylene free deparaffinizati...
Automated DNA extraction from FFPE tissue using a xylene free deparaffinizati...
 
RT PCR KIT For Covid 19 | Covid-19 RT PCR KIT
RT PCR KIT For Covid 19 | Covid-19 RT PCR KITRT PCR KIT For Covid 19 | Covid-19 RT PCR KIT
RT PCR KIT For Covid 19 | Covid-19 RT PCR KIT
 
RNase H2 PCR—A New Technology to Reduce Primer Dimers and Increase Genotyping...
RNase H2 PCR—A New Technology to Reduce Primer Dimers and Increase Genotyping...RNase H2 PCR—A New Technology to Reduce Primer Dimers and Increase Genotyping...
RNase H2 PCR—A New Technology to Reduce Primer Dimers and Increase Genotyping...
 
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
RotorGene Q A Rapid, Automatable real-time PCR Instrument for Genotyping and...
 
8 Challenges to Successful One-Step RT-PCR
8 Challenges to Successful One-Step RT-PCR8 Challenges to Successful One-Step RT-PCR
8 Challenges to Successful One-Step RT-PCR
 
Ascbrn ai poster
Ascbrn ai posterAscbrn ai poster
Ascbrn ai poster
 
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
Advanced Real-Time PCR Array Technology – Coding and Noncoding RNA Expression...
 
Human Pathogen Booklet
Human Pathogen BookletHuman Pathogen Booklet
Human Pathogen Booklet
 
Reproducibility, Quality Control and Importance of Automation
Reproducibility, Quality Control and Importance of AutomationReproducibility, Quality Control and Importance of Automation
Reproducibility, Quality Control and Importance of Automation
 
Pcr array 2013
Pcr array 2013Pcr array 2013
Pcr array 2013
 
GEN Reprint_LC1536
GEN Reprint_LC1536GEN Reprint_LC1536
GEN Reprint_LC1536
 
1073958 wp guide-develop-pcr_primers_1012
1073958 wp guide-develop-pcr_primers_10121073958 wp guide-develop-pcr_primers_1012
1073958 wp guide-develop-pcr_primers_1012
 

Destacado

Bahan organik tanah
Bahan organik tanahBahan organik tanah
Bahan organik tanahEDIS BLOG
 
Creativity in-business-ebook-by-michelle-james
Creativity in-business-ebook-by-michelle-jamesCreativity in-business-ebook-by-michelle-james
Creativity in-business-ebook-by-michelle-jamesElsa von Licy
 
2183485438 essential unani medicines lr
2183485438 essential unani medicines lr2183485438 essential unani medicines lr
2183485438 essential unani medicines lrElsa von Licy
 
Pathways in human_cancer
Pathways in human_cancerPathways in human_cancer
Pathways in human_cancerElsa von Licy
 
PENGEMBANGAN PROGRAM TERSTRUKTUR
PENGEMBANGAN PROGRAM TERSTRUKTURPENGEMBANGAN PROGRAM TERSTRUKTUR
PENGEMBANGAN PROGRAM TERSTRUKTUREDIS BLOG
 
Le fondement-de-la-morale
Le fondement-de-la-moraleLe fondement-de-la-morale
Le fondement-de-la-moraleElsa von Licy
 
Livret pesticides web
Livret pesticides webLivret pesticides web
Livret pesticides webElsa von Licy
 
Tboc2 detailedtoc final
Tboc2 detailedtoc finalTboc2 detailedtoc final
Tboc2 detailedtoc finalElsa von Licy
 
Alliances strategiques
Alliances strategiquesAlliances strategiques
Alliances strategiquesElsa von Licy
 
6128540521 essential homoeopathic-medicines for uploading on web site
6128540521 essential homoeopathic-medicines for uploading on web site6128540521 essential homoeopathic-medicines for uploading on web site
6128540521 essential homoeopathic-medicines for uploading on web siteElsa von Licy
 
Lacan le savoir du psychanalyste
Lacan le savoir du psychanalyste Lacan le savoir du psychanalyste
Lacan le savoir du psychanalyste Elsa von Licy
 
GRAPH TAK BERARAH
GRAPH TAK BERARAHGRAPH TAK BERARAH
GRAPH TAK BERARAHEDIS BLOG
 
Essai sur-les-apparitions-et-opuscules-divers
Essai sur-les-apparitions-et-opuscules-diversEssai sur-les-apparitions-et-opuscules-divers
Essai sur-les-apparitions-et-opuscules-diversElsa von Licy
 
Henri bortoft wholes
Henri bortoft wholesHenri bortoft wholes
Henri bortoft wholesElsa von Licy
 
Ethique droit-politique
Ethique droit-politiqueEthique droit-politique
Ethique droit-politiqueElsa von Licy
 
Fragments sur-l-histoire-de-la-philosophie
Fragments sur-l-histoire-de-la-philosophieFragments sur-l-histoire-de-la-philosophie
Fragments sur-l-histoire-de-la-philosophieElsa von Licy
 

Destacado (20)

Bahan organik tanah
Bahan organik tanahBahan organik tanah
Bahan organik tanah
 
Wikner rm
Wikner rmWikner rm
Wikner rm
 
Creativity in-business-ebook-by-michelle-james
Creativity in-business-ebook-by-michelle-jamesCreativity in-business-ebook-by-michelle-james
Creativity in-business-ebook-by-michelle-james
 
2183485438 essential unani medicines lr
2183485438 essential unani medicines lr2183485438 essential unani medicines lr
2183485438 essential unani medicines lr
 
Pathways in human_cancer
Pathways in human_cancerPathways in human_cancer
Pathways in human_cancer
 
PENGEMBANGAN PROGRAM TERSTRUKTUR
PENGEMBANGAN PROGRAM TERSTRUKTURPENGEMBANGAN PROGRAM TERSTRUKTUR
PENGEMBANGAN PROGRAM TERSTRUKTUR
 
Cigna lbrochure
Cigna lbrochureCigna lbrochure
Cigna lbrochure
 
Le fondement-de-la-morale
Le fondement-de-la-moraleLe fondement-de-la-morale
Le fondement-de-la-morale
 
World history
World historyWorld history
World history
 
Livret pesticides web
Livret pesticides webLivret pesticides web
Livret pesticides web
 
Tboc2 detailedtoc final
Tboc2 detailedtoc finalTboc2 detailedtoc final
Tboc2 detailedtoc final
 
Alliances strategiques
Alliances strategiquesAlliances strategiques
Alliances strategiques
 
6128540521 essential homoeopathic-medicines for uploading on web site
6128540521 essential homoeopathic-medicines for uploading on web site6128540521 essential homoeopathic-medicines for uploading on web site
6128540521 essential homoeopathic-medicines for uploading on web site
 
Pathways
PathwaysPathways
Pathways
 
Lacan le savoir du psychanalyste
Lacan le savoir du psychanalyste Lacan le savoir du psychanalyste
Lacan le savoir du psychanalyste
 
GRAPH TAK BERARAH
GRAPH TAK BERARAHGRAPH TAK BERARAH
GRAPH TAK BERARAH
 
Essai sur-les-apparitions-et-opuscules-divers
Essai sur-les-apparitions-et-opuscules-diversEssai sur-les-apparitions-et-opuscules-divers
Essai sur-les-apparitions-et-opuscules-divers
 
Henri bortoft wholes
Henri bortoft wholesHenri bortoft wholes
Henri bortoft wholes
 
Ethique droit-politique
Ethique droit-politiqueEthique droit-politique
Ethique droit-politique
 
Fragments sur-l-histoire-de-la-philosophie
Fragments sur-l-histoire-de-la-philosophieFragments sur-l-histoire-de-la-philosophie
Fragments sur-l-histoire-de-la-philosophie
 

Similar a Pcrhandbook ver4

Technical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the GuideTechnical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the GuideQIAGEN
 
1073957 wp rt2_profilerapp_1012
1073957 wp rt2_profilerapp_10121073957 wp rt2_profilerapp_1012
1073957 wp rt2_profilerapp_1012Elsa von Licy
 
Rt2 profilerbrochure
Rt2 profilerbrochureRt2 profilerbrochure
Rt2 profilerbrochureElsa von Licy
 
real-time-pcr-handbook.pdf
real-time-pcr-handbook.pdfreal-time-pcr-handbook.pdf
real-time-pcr-handbook.pdfssuserfc0897
 
Pcr array whitepaper_app
Pcr array whitepaper_appPcr array whitepaper_app
Pcr array whitepaper_appElsa von Licy
 
Real Time P C R
Real Time P C RReal Time P C R
Real Time P C Relmayestro
 
Real-time PCR.ppt
Real-time PCR.pptReal-time PCR.ppt
Real-time PCR.pptSappahAhmed
 
real-time PCR .... by aqee-lhadithe - sem iv
real-time PCR .... by aqee-lhadithe - sem ivreal-time PCR .... by aqee-lhadithe - sem iv
real-time PCR .... by aqee-lhadithe - sem ivAqeelhadithe
 
PCR Primer Design Tool for Sanger Sequencing Confirmation
PCR Primer Design Tool for Sanger Sequencing ConfirmationPCR Primer Design Tool for Sanger Sequencing Confirmation
PCR Primer Design Tool for Sanger Sequencing ConfirmationThermo Fisher Scientific
 
Pathway map-reference-guide
Pathway map-reference-guidePathway map-reference-guide
Pathway map-reference-guideElsa von Licy
 
Rt2q pcr primerassays
Rt2q pcr primerassaysRt2q pcr primerassays
Rt2q pcr primerassaysElsa von Licy
 
Pcr technology and its importance in covid 19 pandemic
Pcr technology and its importance in covid 19 pandemicPcr technology and its importance in covid 19 pandemic
Pcr technology and its importance in covid 19 pandemicAnupam Maity
 
Analyzing microbes
Analyzing microbesAnalyzing microbes
Analyzing microbesSpringer
 

Similar a Pcrhandbook ver4 (20)

Technical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the GuideTechnical Guide to Qiagen PCR Arrays - Download the Guide
Technical Guide to Qiagen PCR Arrays - Download the Guide
 
1073957 wp rt2_profilerapp_1012
1073957 wp rt2_profilerapp_10121073957 wp rt2_profilerapp_1012
1073957 wp rt2_profilerapp_1012
 
Rt2 profilerbrochure
Rt2 profilerbrochureRt2 profilerbrochure
Rt2 profilerbrochure
 
real-time-pcr-handbook.pdf
real-time-pcr-handbook.pdfreal-time-pcr-handbook.pdf
real-time-pcr-handbook.pdf
 
Abrf poster2007
Abrf poster2007Abrf poster2007
Abrf poster2007
 
Pcr array whitepaper_app
Pcr array whitepaper_appPcr array whitepaper_app
Pcr array whitepaper_app
 
Real Time P C R
Real Time P C RReal Time P C R
Real Time P C R
 
Real-time PCR.ppt
Real-time PCR.pptReal-time PCR.ppt
Real-time PCR.ppt
 
real time-PCR..
real time-PCR..real time-PCR..
real time-PCR..
 
real-time PCR .... by aqee-lhadithe - sem iv
real-time PCR .... by aqee-lhadithe - sem ivreal-time PCR .... by aqee-lhadithe - sem iv
real-time PCR .... by aqee-lhadithe - sem iv
 
PCR Primer Design Tool for Sanger Sequencing Confirmation
PCR Primer Design Tool for Sanger Sequencing ConfirmationPCR Primer Design Tool for Sanger Sequencing Confirmation
PCR Primer Design Tool for Sanger Sequencing Confirmation
 
3 pcr
3 pcr3 pcr
3 pcr
 
Pcr array guide
Pcr array guidePcr array guide
Pcr array guide
 
Pathway map-reference-guide
Pathway map-reference-guidePathway map-reference-guide
Pathway map-reference-guide
 
Chigot poster2007
Chigot poster2007Chigot poster2007
Chigot poster2007
 
Rt2q pcr primerassays
Rt2q pcr primerassaysRt2q pcr primerassays
Rt2q pcr primerassays
 
Pcr brochure
Pcr brochurePcr brochure
Pcr brochure
 
Pcr technology and its importance in covid 19 pandemic
Pcr technology and its importance in covid 19 pandemicPcr technology and its importance in covid 19 pandemic
Pcr technology and its importance in covid 19 pandemic
 
Analyzing microbes
Analyzing microbesAnalyzing microbes
Analyzing microbes
 
Realtime
RealtimeRealtime
Realtime
 

Más de Elsa von Licy

Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...Elsa von Licy
 
Strategie Decisions Incertitude Actes conference fnege xerfi
Strategie Decisions Incertitude Actes conference fnege xerfiStrategie Decisions Incertitude Actes conference fnege xerfi
Strategie Decisions Incertitude Actes conference fnege xerfiElsa von Licy
 
Neuropsychophysiologie
NeuropsychophysiologieNeuropsychophysiologie
NeuropsychophysiologieElsa von Licy
 
L agressivite en psychanalyse (21 pages 184 ko)
L agressivite en psychanalyse (21 pages 184 ko)L agressivite en psychanalyse (21 pages 184 ko)
L agressivite en psychanalyse (21 pages 184 ko)Elsa von Licy
 
C1 clef pour_la_neuro
C1 clef pour_la_neuroC1 clef pour_la_neuro
C1 clef pour_la_neuroElsa von Licy
 
Vuillez jean philippe_p01
Vuillez jean philippe_p01Vuillez jean philippe_p01
Vuillez jean philippe_p01Elsa von Licy
 
Spr ue3.1 poly cours et exercices
Spr ue3.1 poly cours et exercicesSpr ue3.1 poly cours et exercices
Spr ue3.1 poly cours et exercicesElsa von Licy
 
Plan de cours all l1 l2l3m1m2 p
Plan de cours all l1 l2l3m1m2 pPlan de cours all l1 l2l3m1m2 p
Plan de cours all l1 l2l3m1m2 pElsa von Licy
 
Bioph pharm 1an-viscosit-des_liquides_et_des_solutions
Bioph pharm 1an-viscosit-des_liquides_et_des_solutionsBioph pharm 1an-viscosit-des_liquides_et_des_solutions
Bioph pharm 1an-viscosit-des_liquides_et_des_solutionsElsa von Licy
 
Poly histologie-et-embryologie-medicales
Poly histologie-et-embryologie-medicalesPoly histologie-et-embryologie-medicales
Poly histologie-et-embryologie-medicalesElsa von Licy
 
Methodes travail etudiants
Methodes travail etudiantsMethodes travail etudiants
Methodes travail etudiantsElsa von Licy
 
Atelier.etude.efficace
Atelier.etude.efficaceAtelier.etude.efficace
Atelier.etude.efficaceElsa von Licy
 
There is no_such_thing_as_a_social_science_intro
There is no_such_thing_as_a_social_science_introThere is no_such_thing_as_a_social_science_intro
There is no_such_thing_as_a_social_science_introElsa von Licy
 

Más de Elsa von Licy (20)

Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
Styles of Scientific Reasoning, Scientific Practices and Argument in Science ...
 
Strategie Decisions Incertitude Actes conference fnege xerfi
Strategie Decisions Incertitude Actes conference fnege xerfiStrategie Decisions Incertitude Actes conference fnege xerfi
Strategie Decisions Incertitude Actes conference fnege xerfi
 
Rainville pierre
Rainville pierreRainville pierre
Rainville pierre
 
Neuropsychophysiologie
NeuropsychophysiologieNeuropsychophysiologie
Neuropsychophysiologie
 
L agressivite en psychanalyse (21 pages 184 ko)
L agressivite en psychanalyse (21 pages 184 ko)L agressivite en psychanalyse (21 pages 184 ko)
L agressivite en psychanalyse (21 pages 184 ko)
 
C1 clef pour_la_neuro
C1 clef pour_la_neuroC1 clef pour_la_neuro
C1 clef pour_la_neuro
 
Hemostase polycop
Hemostase polycopHemostase polycop
Hemostase polycop
 
Antiphilos
AntiphilosAntiphilos
Antiphilos
 
Vuillez jean philippe_p01
Vuillez jean philippe_p01Vuillez jean philippe_p01
Vuillez jean philippe_p01
 
Spr ue3.1 poly cours et exercices
Spr ue3.1 poly cours et exercicesSpr ue3.1 poly cours et exercices
Spr ue3.1 poly cours et exercices
 
Plan de cours all l1 l2l3m1m2 p
Plan de cours all l1 l2l3m1m2 pPlan de cours all l1 l2l3m1m2 p
Plan de cours all l1 l2l3m1m2 p
 
M2 bmc2007 cours01
M2 bmc2007 cours01M2 bmc2007 cours01
M2 bmc2007 cours01
 
Feuilletage
FeuilletageFeuilletage
Feuilletage
 
Chapitre 1
Chapitre 1Chapitre 1
Chapitre 1
 
Biophy
BiophyBiophy
Biophy
 
Bioph pharm 1an-viscosit-des_liquides_et_des_solutions
Bioph pharm 1an-viscosit-des_liquides_et_des_solutionsBioph pharm 1an-viscosit-des_liquides_et_des_solutions
Bioph pharm 1an-viscosit-des_liquides_et_des_solutions
 
Poly histologie-et-embryologie-medicales
Poly histologie-et-embryologie-medicalesPoly histologie-et-embryologie-medicales
Poly histologie-et-embryologie-medicales
 
Methodes travail etudiants
Methodes travail etudiantsMethodes travail etudiants
Methodes travail etudiants
 
Atelier.etude.efficace
Atelier.etude.efficaceAtelier.etude.efficace
Atelier.etude.efficace
 
There is no_such_thing_as_a_social_science_intro
There is no_such_thing_as_a_social_science_introThere is no_such_thing_as_a_social_science_intro
There is no_such_thing_as_a_social_science_intro
 

Pcrhandbook ver4

  • 1. PCR ARRAY . GUIDE v4 0 The Complete Technical Reference to PCR ARRAYS Cancer Cytokines Biomarkers ECM & Adhesion Oxidative Stress Signal Transduction Inflammation Stem Cells MicroRNA Epigenetics Toxicology NEW 100 Selected Peer-reviewed Publications A QIAGEN Company Focus on your PathwayTM
  • 2.
  • 3. Table of Contents PCR ARRAY Guide v4.0 PCR ARRAY GUIDE version 4.0 RT2 ProfilerTM PCR ARRAYS ................................................................................................................2 The Most Accurate and Sensitive Technology for Pathway-Powered Gene Expression Analysis RT2 Profiler PCR ARRAY System .....................................................................................................4 A Complete and Reliable Solution for Gene Expression Analysis Custom PCR ARRAYS & Assay Design ................................................................................................5 Focus on Your Genes with PCR Arrays Created from Your Gene List RT2 SYBR Green qPCR Master Mixes ..............................................................................................6 ® The Required High-Performance Master Mix for RT2 Profiler PCR Arrays RT2 Profiler PCR ARRAY Performance ..........................................................................................7 Reliable and Reproducible Pathway-focused Gene Expression Analysis RT2 Nano PreAMPTM cDNA Synthesis Technology ..........................................................................8 Enabling the Analysis of One Nanogram of RNA with RT2 Profiler PCR Arrays RT2 FFPE PreAMP cDNA Synthesis Technology............................................................................9 Enabling the Analysis of FFPE Samples with RT2 Profiler PCR Arrays PCR ARRAY Data Analysis Guide ..................................................................................................10 Complete Solutions for Interpreting RT2 Profiler PCR Array Data Service Core for PCR ARRAY Gene Expression Analysis ..................................................10 Complete Set of Quick and Convenient Gene Expression Profilng Services QIAGEN RNeasy Kits ........................................................................................................................11 ® Purification of High-quality Total RNA from a Range of Biological Samples QIAGEN Products for Sample Disruption ................................................................................12 Fast and Effective Disruption of Biological Samples at a Range of Throughputs QIAGEN Products for RNA Stabilization ................................................................................13 Convenient and Immediate Stabilization of RNA in a Range of Biological Samples Research Area-Focused PCR ARRAY Product Listing ...........................................................14 Search Our Complete Catalog of PCR Array Products by Your Area of Research RT2 MicroRNA PCR ARRAYS ................................................................................................................16 Simultaneous Detection of Genome-Wide or Pathway-Focused miRNA QIAGEN miRNeasy Kits ....................................................................................................................18 Purification of Total RNA from a Range of Biological Samples ChampionChIPTM PCR System .............................................................................................................19 Reliable Chromatin IP with Real-time PCR Precision Achieved in Only One Day Methyl-ProfilerTM PCR ARRAY System ..........................................................................................20 Simple, Fast and Reliable DNA Methylation Analysis Without Bisulfite Conversion QIAGEN DNeasy Blood and Tissue Kits ...................................................................................22 ® Purification of Total DNA from Cells, Tissues and Blood QIAGEN QIAamp DNA Mini Kits ....................................................................................................22 ® Purification of Genomic, Mitochondrial, Bacterial, Parasitic, or Viral DNA PreAnalytiX PAXgene DNA System .............................................................................................23 ® ® Collection & Stabilization of Blood or Tissue Samples & Subsequent DNA Purification PCR ARRAY Published Literature ...............................................................................................24 Publications Citing RT2 Profiler PCR Arrays Complete Product Catalog Index .................................................................................................27 Search the Complete Catalog of RT2 Profiler PCR Array Products and Accessories www.SABiosciences.com 1
  • 4. RT2 Profiler PCR ARRAYS TM The Most Accurate and Sensitive Technology for Pathway Gene Expression Analysis What Are PCR ARRAYS? How PCR ARRAYS Work RT² ProfilerTM PCR Arrays are the most reliable and sensitive gene expression profiling technology for analyzing focused panels of genes in signal transduction, biological process, or disease-related pathways using real-time PCR. Each cataloged PCR Array contains a list of the pathway-focused genes as well as five housekeeping (refererence) genes on the array. Wells H6 through H12 contain a panel of proprietary controls to monitor genomic DNA contamination (HGDC) as well as the first strand synthesis (RTC) and real-time PCR efficiency (PPC). 2. Convert Total RNA to cDNA. Control Experimental 3. Add cDNA to RT2 SYBR® Green Master Mix. Aliquot Mixture Across PCR Array. Why Use RT Profiler PCR ARRAYS? 2 1. Isolate RNA from Cells, Tissues, FFPE and/or Blood. TM Simplicity: The simplicity of RT2 Profiler PCR Arrays makes routine expression profiling practical in any research laboratory with a real-time instrument. 4. Run in Your Real-Time PCR Instrument. Performance: Experimental Profile Control Profile 1.E-000 Delta Rn Profiler PCR Arrays have the sensitivity, reproducibility, specificity, and reliability to accurately profile multiple genes simultaneously in 96- or 384-well formats. 1.E+001 1.E-000 Delta Rn 1.E+001 RT² 1.E-001 1.E-003 1.E-003 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Relevance: 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Cycle Number Cycle Number 5. Data Analysis. 10-6 p-Value for Fold Change Anatomy of a 96-well RT Profiler PCR ARRAY 2 1.E+00 A B A 1.E-01 10-5 Normal Breast RT² Profiler PCR Arrays focus on profiling the genes relevant to the pathways or disease states important to your research. 10-4 10-3 10-2 0 1 2 3 4 CCL2 CCL20 CCL21 CCL23 CCL24 CCL25 CCL26 CCL3 CCL4 CCL8 CCR1 CCR2 CCR8 CCR9 CEBPB CCR3 C5 CCL1 Breast Tumor CCR4 CCR5 CCL11 CCL13 CCL15 CCL16 CCL17 CCL18 CCR6 CCR7 CCL5 CCL7 IL10RA IL10RB IL13 IL13RA1 IL17C IL1A IL1F6 IL1F7 IL1F8 IL1F9 IL1R1 IL1RN IL22 IL5 IL5RA IL9 IL9R LTA LTB LTB4R MIF SCYE1 SPP1 TNF IL1F10 IL1B IL8RA IL8 16 CRP CX3CR1 CXCL1 CXCL10 CXCL11 CXCL12 CXCL13 CXCL14 CXCL2 CXCL3 CXCL5 CXCL6 CXCL9 IL10 SYBR® Green Versus TaqMan® Chemistries IL1F5 IL8RB TaqMan Log2 FC C4A 1.E+00 -1 TIMP3 1.E-01 CCL19 C3 MCAM ITGB4 1.E-02 -2 MMP9 ITGA2 1.E-03 -3 1.E-06 D 2 BCL6 TGFB1 ITGB3 1.E-04 1.E-04 C Fold Change Ratio (log ) ABCF1 1.E-03 1.E-05 -4 CDKN2A FGFR2 1.E-06 1 CCNE1 1.E-02 1.E-05 10-1 D ICEBERG IFNA2 1.E-001 1.E-002 1.E-002 Figure 2: Comparable Biological Results.* Gene expression 12 E = 0.97 R2 = 0.99 8 4 -16 -12 -8 -4 4 -4 8 12 16 -8 86 GENES -12 -16 TNFSF5 TOLLIP XCR1 analysis was compared between RT2 Profiler PCR Arrays (SYBR Green-based) and the TaqMan platform. Regression analysis of fold differences, with data normalized against POLR2A, demonstrate that both platforms yield similar biological results. RT2 PCR Log2 FC HPRT1 RPL13A GAPDH ACTB HOUSEKEEPING (REFERENCE) GENES HGDC RTC RTC RTC GENOMIC REVERSE TRANSCRIPTION CONTROLS DNA CONTROL PPC PPC PPC 25 POSITIVE PCR CONTROLS Figure 1: Each Well in a PCR Array Measures the Expression of a Gene Related to a Pathway or Disease State. The Human Inflammatory Cytokines and Receptors PCR Array in a 96-well format is shown. This is also available in a 384-well format. Figure 3: Sensitivity with RT2 SYBR Green Versus TaqMan Chemistry.* PCR amplicons detected TaqMan 20 Ct B2M E = 100% R2 = 0.9998 using the same primer pair with or without TaqMan probes in either SYBR Green or TaqMan chemistry. SYBR green chemistry yields earlier Cts for each dilution, demonstrating better sensitivity than TaqMan chemistry. 15 SYBR Green 10 E = 100% R2 = 0.9999 5 4 2 Support@SABiosciences.com 6 8 10 Log [Copy Number] 12 * BMC Genomics 2008, 9: 378.
  • 5. RT2 ProfilerTM PCR ARRAYS PCR ARRAY Guide v4.0 Application: Angiogenesis Application: ECM PCR ARRAYS for Cancer Biomarker Discovery ECM and Cell Adhesion VEGF Regulation of Cellular Architecture 0 100 -50 10-1 Breast Tumor 101 -100 10-2 -150 -200 10-3 UP -R EG UL AT ED 10-5 Chen, C. et al. Cancer Research. 2009; 69 (16): 6721-6729. COL4A2 CTNND2 ADAMTS1 SELE TIMP3 NO 10-5 ITGB4 MMP9 MMP3 10-4 ANGPT1 FGF1 KDR TIMP3 FIGF SERPINF1 JAG1 FGFR3 B2M TNFA ECGF1 CXCL10 LAMA5 TIMP1 TGFA IL1B VEGFA ACTB TGFB1 SPHK1 VEGFC FGF2 MDK PTGS1 ENG IL6 PECAM1 THBS1 EREG NRP2 MMP9 PGF IL8 Fold Change mAb225/lgG 50 FN1 DO WN -R EG UL AT ED CNTN1 ITGB3 GE AN CH 10-3 10-4 10-2 10-1 101 100 Normal Breast Figure 4: Relative Fold Change Between Disorganized and Organized Colonies Using the RT2 Profiler Angiogenesis PCR Array. RNA isolated from unorganized T4-2 cells treated with a control antibody (IgG) or reverted to an organized colony by blocking EGFR signaling (mAB225) was reverse transcribed and relative gene expression data was obtained using the Human Angiogenesis PCR Arrays. The expression profile of 84 genes relevant to Angiogenesis as well as 5 housekeeping genes was assayed. Fold change calculations were done using SABiosciences’ data analysis software which automatically calculates the fold change in gene expression between the treated and control groups. Figure 7: ECM and Cell Adhesion PCR Arrays Revealed Up- and Down-Regulated Genes in Breast Cancer. Total RNA from a normal human breast and a human breast tumor were characterized in technical triplicates, and the relative expression levels for each gene in the two samples are plotted against each other in the Scatter Plot. Genes encoding the matrix metallopeptidases (MMP3 and MMP9) and their inhibitors (TIMP3) are up-regulated, while genes encoding integrins (ITGB3 and ITGB4) are down-regulated, by at least three-fold (outside the silver field) in breast tumors relative to normal tissue. p value STATISTICAL SIGNIFICANCE Application: Immune Response 10-9 10-8 10-7 10-6 10-5 10-4 10-3 10-2 10-1 100 Popular Pathway-Focused PCR ARRAYS Common Cytokines IL10 IL1A IL1B CSF1 PDGFA TGFB2 TNFSF11 BMP6 TNFRSPSF11B TNFSF14 TNFSF13B IFNA5 IFNG CSF2 IL9 IL11 IL21 IL5 IL13 TNF LTA TNFSF10 IL1F7 IL2 IL22 IL3 IL17 BMP3 -7 -5 -3 -1 1 3 5 7 9 fold difference [log2] DOWN-REGULATED 11 13 15 17 UP-REGULATED Figure 5: Common Cytokine PCR Array Identified 23 Up-Regulated and 6 DownRegulated Genes Following PBMC Stimulation. Triplicate total RNA samples from human peripheral blood mononuclear cells (either untreated or stimulated with 50 ng/mL PMA and 1 µg/mL ionomycin for 6 hours) were characterized with the Human Common Cytokine PCR Array. Twenty-three cytokine genes are up-regulated (> 5-fold,p < 0.0005) including interleukins, colony stimulating factors, and TNF ligands after 6 hours of stimulation. Six interleukin and TNF ligand genes are down-regulated under the same conditions. Application: Determining Drug Toxicity with PCR ARRAYS Stress and Toxicity PathwayFinder 5005 128 Inflammatory Cytokines & Receptors NFκB Signaling Pathway Oxidative Stress & Antioxidant Defense Signal Transduction PathwayFinderTM Stem Cell (Embryonic, Mesenchymal) Stress and Toxicity PathwayFinderTM TGFβ / BMP Signaling Pathway Th1-Th2-Th3 Toll-Like Receptor Signaling Pathway Wnt Signaling Pathway Complete PCR Array List Custom PCR Arrays www.SABiosciences.com/ArrayList.php (Detailed Information on Page 5) Complete RT Profiler PCR ARRAY System 2 Product Plate Format RT Profiler PCR Array 2 96-well Plate 384-well Plate Product RT First Strand cDNA Synthesis Kit 2 RT SYBR Green w/ ROX Master Mix 2 RT SYBR Green w/ Fluorescein Master Mix 2 RT SYBR Green Only Master Mix (see page 6) HSPA6 CRYAB CSF2 HSPA1A TNF DDIT3 HSPH1 CYP1A1 HSPA5 HSPCA 2 DNAJB4 HMOx1 30 20 10 0 119 1GADD45A 125 1ACTB ActosTM Avandia® Rezulin® MT2A 5000 18SrRNA Fold Up-Regulation tm Angiogenesis Apoptosis Cancer PathwayFinderTM Cell Cycle Chemokines and Receptors Common Cytokines DNA Damage Signaling Pathway Endothelial Cell Biology Epithelial to Mesenchymal Transition Extracellular Matrix and Adhesion Figure 6: Stress and Toxicity PathwayFinderTM PCR Array Uncovered Distinct Gene Expression Profiles Associated with Liver Toxicity Caused by 3 PPARγ Agonists. RNA from HepG2 cells treated with three different glitazone PPARγ agonists for type 2 diabetes mellitus was characterized, and the results were compared to that of a vehicle (DMSO) control. The drug withdrawn due to idiosyncratic liver toxicity (Rezulin), induces very different changes in the expression of stress-related genes than two safer drugs still on the market (Avandia and Actos). Pack Size 2, 12, 24 Arrays 4 Arrays Catalog # Pack Size 12 Samples 330401 2, 12, 24 Arrays 2, 12, 24 Arrays 2, 12, 24 Arrays Various Various Various PCR Array Data Analysis Software FREE PCR ARRAY Accessories Pack Size Catalog # RT Nano PreAMP cDNA Synthesis Kit 2 RT FFPE PreAMP cDNA Synthesis Kit 2 RT Nano PreAMP cDNA Synthesis Primer Mixes 12 Samples 12 Samples 12 Samples 330451 330461 Inquire 2 www.SABiosciences.com 3
  • 6. RT2 Profiler PCR ARRAY System A Complete & Reliable Solution for Gene Expression Analysis How The PCR ARRAY System Works Cells, Tissues, FFPE, Blood, and Biofluids RT 2 Profiler PCR ARRAYS Each pathway-focused PCR Array includes 89-wet bench validated qPCR Primers Assays (including 5 housekeeping genes) and a proprietary control panel. RNeasy KITS RT 2 SYBR Green qPCR Master Mixes A unique formulation of buffers that co-evolved with the primer design algorithm provides high amplification efficiencies. Available with reference dyes (ROX, Fluorescein or without). Total RNA gDNA Elimination Solution (GE) RT Enzyme Oligo-dTs Random Hexamers External RNA Control (RTC) dNTPs RT2 FIRST STRAND cDNA SYNTHESIS KIT GENOMIC DNA ELIMINATION REVERSE TRANSCRIPTION RT 2 First Strand cDNA Synthesis Kit RE SOLUTION 5 MINUTES 15 MINUTES AAAAA AAAAA AAAAA AAAAA First Strand cDNA An External RNA Control detected by the PCR Array tests the quality of input RNA. It also features a proprietary genomic DNA elimination buffer essential for eliminating residual gDNA, ensuring specific detection of mRNA. FREE Data Analysis Software The power of the PCR Array to assess the expression of a pathwayfocused set of genes over a wide range of detection yields an abundance of data. With our FREE PCR Array Data Analysis tool, go from raw Ct values to fold change results displayed in a variety of formats (Scatter Plots, Volcano Plots, Clustergram) in a MATTER OF MINUTES. 45 GE Effectively Removes Genomic DNA 40 CLEAN OF gDNA 35 Ct GDC RNA ISOLATION 5-120 MINS SABiosciences RT2 Profiler PCR Arrays are a complete system for PathwayFocused Gene Expression Analysis. From Sample Preparation to Data Analysis, the PCR Array system includes four components that GUARANTEE high-quality, reproducible, and reliable gene expression data. Integral to the performance of the PCR Array system is a proprietary set of control elements that enhance the reliability of your data and serve as a guarantee for performance over time. These elements allow researchers to quickly assess the quality of their data by determining if samples were contaminated with genomic DNA (gDNA), the quality of the reverse transcription reaction, and real-time PCR efficiency. Each component of the RT2 Profiler system contributes to these quality control elements by incorporating an interlocked system for comprehensive monitoring of each step of the PCR Array process. Untreated GE Treated 30 25 20 dNTPs SYBR Green Dye DNA Polymerase Binding Elongation SYBR Green Binding Detection HEK293T Cells Mouse Spinal Tissue Mouse Brain Tissue RNA Source Rat Brain tissue Figure 1: Elimination of Genomic DNA Contamination. RNA from HEK 293T cells, mouse spinal tissue, mouse brain tissue, or rat brain tissue was characterized on SYBR Green PCR Arrays before (blue bars) and after (red bars) treatment with gDNA Elimination Buffer from the RT² First Strand Kit. Average Ct (RTC-PPC) Hot-Start DNA Polymerase RT2 SYBR GREEN MASTER MIX 10 HEAT ACTIVATION CYCLING AND DETECTION 2 HOURS (40 CYCLES) 10 MINS 15 10 Reverse Transcription Monitoring 8 6 FAIL PASS 4 2 0 None Mg2+ Addition / Treatment TRIzol® Figure 2: Monitoring Inhibition in Reverse Transcription. Human universal RNA was added with magnesium salt to simulate RNA degradation or added with TRIzol® reagent to simulate contamination that inhibits enzyme activity. RT² First Strand Kit was used for cDNA synthesis. 4 Support@SABiosciences.com
  • 7.
  • 8. RT2 SYBR® Green qPCR Master Mixes The Required High-Performance Master Mix for RT2 Profiler PCR Arrays SYBR Green Detection is a popular approach used in quantifying gene expression analysis with RT-PCR. It relies on the preferential binding of the SYBR green dye to double-stranded DNA, resulting in strong fluorescence emission signals, with the signal intensity proportional to the amount of double-stranded DNA present. Greater Sensitivity Without Sacrificing Specificity 2 RT SYBR Green qPCR Master Mix Primer SYBR Green DNA Template MMP15 Gel MMP13 Gel Competitor I Master Mix Polymerase High quality PCR reaction components are essential for achieving superior amplification specificity and efficiency. SABiosciences offers a complete solution for using SYBR Green PCR Arrays with the RT2 SYBR Green qPCR Master Mixes. Each mix includes a Hot Start Taq DNA polymerase, which provides tighter control over activity, and other proprietary chemical components that significantly minimize primer dimer formation, thereby enhancing amplification efficiencies for even the most difficult-to-amplify genes. The higher SYBR Green signal from our formulations provides greater sensitivity and ensures clean results without sacrificing specificity or amplification efficiency. Brighter SYBR Green Signal MMP15 Gel MMP13 Gel Figure 2: RT2 SYBR Green qPCR Master Mixes Provide Greater Sensitivity Without Sacrificing Specificity. RT2 SYBR Green qPCR Master Mixes and Competitor I Master Mixes were 2 used in qPCR assays to detect the human MMP13 and MMP15 mRNA in reference RNA. RT SYBR Green qPCR Master mixes provide detection of the genes at an earlier threshold cycle value (Ct). The real-time dissociation curves and agarose gel electrophoresis characterization reveal the presence of a non-specific 2 secondary product generated with the competitor’s master mix which is not amplified by the RT SYBR Green qPCR Master Mix. 2 RT SYBR Green qPCR Master Mix from SABiosciences A Amplification Plots 10 Compatible PCR Instruments Applied Biosystems (ABI): 5700, 7000, 7300, 7500, 7500 FAST, 7700, 7900HT, StepOnePlus (96- and 384-well blocks) Bio-Rad: CFX96, CFX384, iCycler, iQ5, MyiQ, MyiQ 2, Chromo4, Opticon 2 Stratagene: Mx3000P, Mx3005P, Mx4000 Roche: LightCycler 480 (96- and 384-well blocks) Eppendorf: Mastercycler ep realplex 2/2S, 4/4S TaKaRa: TP-800 ∆RN 8 6 4 2 0 Signal [-d(RFU)/dT] B 4 0 8 12 16 20 24 Cycle Number 28 32 36 40 RT qPCR Master Mixes 2 Dissociation Curves 0.5 Product RT SYBR Green w/ ROX qPCR Master Mix 2 0.4 0.3 0.2 RT SYBR Green w/ Fluorescein qPCR Master Mix 2 0.1 0 60 65 70 75 80 85 Melting Temperature [oC] 90 95 RT SYBR Green qPCR Master Mix 2 Figure 1: RT2 SYBR Green qPCR Master Mixes Provide Greater Sensitivity with a Brighter SYBR Green Signal. Four commercial master mixes were used to detect the expression of human ACTB from the same universal reference RNA. The amplification (A) and the dissociation curves (B) for the master mix from SABiosciences demonstrate a sharper amplification curve and a brighter SYBR Green signal than observed with three competing master mixes. 6 Support@SABiosciences.com Without Reference Dye * Plate format is 384-well. Size Catalog # SABio # 2 Arrays 12 Arrays 24 Arrays 4 Arrays* 25 mL 2 Arrays 12 Arrays 24 Arrays 4 Arrays* 25 mL 2 Arrays 12 Arrays 24 Arrays 4 Arrays* 25 mL 330520 330522 330523 330521 330529 330510 330512 330513 330511 330519 330500 330502 330503 330501 330509 PA-012 PA-012-12 PA-012-24 PA-012-8 PA-112 PA-011 PA-011-12 PA-011-24 PA-011-8 PA-111 PA-010 PA-010-12 PA-010-24 PA-010-8 PA-110
  • 9. RT2 Profiler PCR ARRAY Performance Reliable and Reproducible Pathway-focused Gene Expression Analysis B 9.95 Fluorescence RT2 Profiler PCR Arrays are used and trusted by thousands of research scientists for pathway-focused gene expression analysis. Several factors, including the RT2 Primer Assay design algorithm, the proprietary control panel, and the strict manufacturing and quality control procedures, ensure the outstanding performance and reliability of our PCR Arrays. Each PCR Array and every qPCR Primer Assay is wet-bench verified to guarantee their performance, with results demonstrating several performance parameters illustrated here. 7.95 5.95 108 109 3.95 107 106 0.5 0 2 4 8 6 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 Cycle Number Uniform PCR Amplification Efficiency One prerequisite for PCR Array technology is that the amount of template product doubles with every cycle. The more the assays deviate from this ideal, the error in the fold change calculation (∆Ct) increases exponentially. Only with consistently high amplification efficiencies can PCR Arrays yield meaningful comparison of gene expression levels of all genes simultaneously. The unique combination of SABiosciences' proprietary primer design algorithm and rigorous testing of every primer assay by hand guarantees the high performance of every primer assay on the PCR Arrays. Regardless of user or instrument used, the complete PCR Array System demonstrates strong correlations across technical replicates, lots, and instruments with average correlation coefficients > 0.99 insuring reliable detection of differences in expression between biological samples. 0.1 0 50 40 60 70 90 80 TM [ C] 99 120 PreAMP 100 Unamp % Increase in Positive Call Rate 80 60 40 20 0 100 50 25 10 Input RNA [ng] 1 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 % Increase Positive Call Rate A key benefit of using pathway-focused PCR Arrays for gene expression analysis is that genes that are over expressed can be measured as reliably as those that are under expressed. The complete PCR Array System yields > 85% positive call with 25 ng - 5 µg RNA or >90% with as a little as 1 ng PreAMP RNA. The 8-log wide dynamic range provided by real-time PCR is unparalleled when comparing a pathway-focused gene panel of varying expression levels across a variety of samples. Figure 2: PCR Arrays Detect as Little as 1 ng RNA. Different amounts of universal total RNA were characterized using the Human Inflammatory Cytokines and Receptors PCR Array (PAHS-011) with or without PreAMP. The percentage of detectable genes was calculated for each RNA amount, with 1ng RNA analysis enabled with the new pathway-focused PreAMP technology. A1 A2 Ct from User A High Sensitivity and Wide Dynamic Range A4 Universal total RNA was characterized for four chemokine and chemokine receptors using RT2 Primer Assays, followed by a dissociation (melt) curve analysis. PCR Arrays specifically detect individual genes despite the expression of related gene family members in the same RNA sample. % Positive Call B1 o Figure 1: PCR Arrays Amplify A Single Gene-Specific Product in Every Reaction. A 1 Superb Reproducibility 0.2 -0.1 101 102 Figure 3: PCR Arrays Detect RNA Across a Wide Dynamic Range. Ten-fold serial dilutions of Human CHRNA5 were characterized with the respective RT2 qPCR Primer Assay. A3 Signal [-d(RFU)/dT] CXCL3 CXCR1 CXCR2 CXCL2 CXCL3 0.3 CXCR1 CXCR2 CXCL2 Agarose Gel 0.4 103 104 19 .5 Distinct Specificity The complete PCR Array System , with high quality input RNA, is guaranteed to yield single bands without primer dimers or other secondary products. The proprietary primer design algorithm incorporates more than ten thermodynamic and sequence alignment criteria, and our wet-bench verification provides confidence that every real-time qPCR Assay accurately represents the expression of the queried gene. Over 20,000 gene-specific RT2 PCR Primer Assays have been designed and shipped to satisfied customers. 105 40 30 20 10 0 0 40 30 20 10 0 0 40 30 20 10 0 0 40 30 20 10 0 0 10 20 30 10 20 30 10 20 30 10 20 30 40 30 20 10 0 40 0 40 30 20 10 0 40 0 40 30 20 10 0 40 0 40 30 20 10 0 40 0 B2 10 20 30 10 20 30 10 20 30 10 20 30 40 30 20 10 0 40 0 40 30 20 10 0 40 0 40 30 20 10 0 40 0 40 30 20 10 0 40 0 B3 10 20 30 40 10 20 30 40 10 20 30 40 10 20 30 40 40 30 20 10 0 0 40 30 20 10 0 0 40 30 20 10 0 0 40 30 20 10 0 0 B4 10 20 30 40 10 20 30 40 10 20 30 40 10 20 30 40 Ct from User B Figure 4: PCR Arrays Yield Highly Reproducible Results. Four replicate sets of raw threshold data (1-4) obtained by two different scientists (A & B) at two different times on Human Drug Metabolism RT2 Profiler PCR Arrays are directly compared. The results demonstrate a high degree of correlation (R2 > 0.990). RT2 Profiler PCR Arrays: A Trusted & Reliable System PCR Arrays have been used by thousands of researchers who have successfully submitted and published their PCR Array results in very high impact journals, including Science, PNAS, Cancer Research, the Nature & Cell family of journals, and others (See Pages 24-27). www.SABiosciences.com 7
  • 10. RT2 Nano PreAMP cDNA Synthesis Technology TM Enabling the Analysis of 1 Nanogram of RNA with RT2 ProfilerTM PCR ARRAYS 2 TM What Is the RT Nano PreAMP cDNA Synthesis Kit? RT² Nano PreAMP cDNA Synthesis Kit and Primer Mixes are a breakthrough technology enabling expression analysis starting from as little as 1 ng of total RNA. It employs a proprietary preamplification process to faithfully increase the amount of targeted cDNA for PCR Array analysis. This technology empowers RT² Profiler PCR Arrays to accurately analyze nanogram levels of total RNA. 2 How RT Nano PreAMP cDNA Synthesis Kits Work Two Simple Steps: AAAAA AAAAA AAAAA AAAAA 1. cDNA First Strand Synthesis Samples that can NOW be characterized with real-time PCR Arrays include: Laser Captured Microdissection Samples (LCM) mRNA This kit provides enough reagents for synthesizing first strand cDNA from 12 different samples of as little as 1 ng total RNA. 2. Preamplification of cDNA for Pathway Specific Genes Fine Needle Aspiration Biopsies (FNAB) Each first strand cDNA synthesis reaction can be amplified by 4 different sets of PCR Array-specific Primer Mixes, allowing gene expression analysis for one sample on as many as 4 different PCR Arrays. Stem Cell Clusters or Embryoid Bodies Flow Cytometry / Fluorescent-Activated Cell Sorting (FACS) Combined with PCR Arrays, the RT² Nano PreAMP cDNA Synthesis Kit and Primer Mixes extends the PCR Array System to accurately analyze a pathway-focused set of genes with as little as 1 ng of total RNA. ∆Ct - PreAMP cDNA Unbiased Amplification Process & Comparison of ∆Ct Values Between Preamplified and Unamplified cDNA RT 2 Nano PreAMP cDNA Synthesis Kit: Proprietary kits include optimized reagents for first strand cDNA synthesis and preamplification from only 1 ng of total RNA. RT 2 Nano PreAMP cDNA Synthesis Primer Mixes: Ready-to-use primer mixes for amplifying pathway-specific cDNA templates on corresponding RT2 Profiler PCR Arrays. Benefits of RT2 Nano PreAMP cDNA Synthesis Technology Robust Performance on Small Samples: Arrays starting with as little as 1 ng of Total RNA. Analyze up to 4 different PCR Easy Workflow and Designed for Routine Use: Simple and quick procedures with minimal hands-on time to preamplify target templates in under 2 hrs. Superior Sensitivity: Maximally enhances the sensitivity of RT Profiler PCR Arrays to analyze limited amounts of RNA. 2 100 Unamp % Increase in Positive Call Rate 80 60 40 20 0 100 50 25 10 Input RNA [ng] 1 0.4 0.35 0.3 0.25 0.2 0.15 0.1 0.05 0 Support@SABiosciences.com 5 10 15 Figure 2. Unbiased Amplification Process - Highly Comparable ∆Ct Values Between Preamplified and Unamplified cDNA from Human Liver Tumor RNA. First strand cDNA was synthesized from 5 ng of human liver tumor RNA. One-quarter of each RT product was used for preamplification with the RT2 Nano PreAMP cDNA Synthesis Kit plus the Human Cancer PathwayFinderTM Nano PreAMP Primer Mix. Unamplified cDNA synthesized from 500 ng of the same liver tumor RNA sample was used as the control. PreAMP amplified and unamplified cDNA samples were then analyzed on the Human Cancer PathwayFinderTM PCR Array, and the threshold cycle values (Ct) were obtained. The ∆Ct value for each gene was calculated by subtracting the average Ct value of the five reference genes (B2M, HPRT1, RPL13A, GAPDH, and ACTB) on the PCR Array from the Ct value of each gene of interest. The dashed line represents the ideal slope of 1.0. The solid line shows a linear regression fit with the R2 and slope indicated. Product (red) or without (blue) RT Nano preamplification. The unamplified and preamplified samples were then analyzed on the Human Inflammatory Cytokines and Receptors PCR Array (PAHS-011), which contains 84 pathway-specific assays, plus controls, including 5 assays for housekeeping genes. Threshold cycle values (Ct) were obtained and any genes with a Ct < 35 were considered to be present. Results indicate that with Nano preamplification, a 33.7% increase in positive call rate is observed in samples with as little as 1 ng RNA. 8 -5 2 Figure 1. RT2 Nano Preamplification Significantly Increases Sensitivity of Detection from 1 ng RNA Samples. Different amounts of human universal RNA were converted to cDNA with 2 -5 RT Nano PreAMP Products % Increase Positive Call Rate % Positive Call PreAMP R2 = 0.95 Slope = 1.01 5 ∆Ct - Unamplified cDNA Nano PreAMP Further Increases the Sensitivity of PCR ARRAYS 120 15 10 RT Nano PreAMP cDNA Synthesis Kit 2 RT Nano PreAMP cDNA Synthesis Primer Mixes* Human Cancer PathwayFinderTM Human Apoptosis Human Angiogenesis Human Mesenchymal Stem Cell Human Embryonic Stem Cell Human Extracellular Matrix and Adhesion Molecules Human Inflammatory Cytokines and Receptors Mouse Inflammatory Cytokines and Receptors Human Toll-like Receptor Signaling Pathway Mouse Toll-like Receptor Signaling Pathway 2 RT Nano PreAMP Primer Mixes for All PCR Arrays 2 * PreAMP Primer Mixes for Custom PCR Arrays available Catalog # SABio # 330454 330241 330241 330241 330241 330241 330241 330241 330241 330241 330241 330241 Inquire 330454 PBH-033 PBH-012 PBH-024 PBH-082 PBH-081 PBH-013 PBH-011 PBM-011 PBH-018 PBM-018 Inquire
  • 11. RT2 FFPE PreAMP cDNA Synthesis Technology TM Enabling the Analysis of FFPE Samples with RT2 Profiler PCR Arrays RNA Extraction from FFPE Samples (330471) The combination of a simplified Xylene-Free RNA extraction and a high-fidelity amplification process maximizes recovery of RNA and microRNA (miRNA). RT² Profiler PCR Arrays facilitate easy and reliable expression analysis of genes associated with a biological pathway or a diseased state from FFPE samples. First Strand cDNA Synthesis and Preamplification (330461 + 330251:PFX-####) Benefits of RT FFPE PreAMP PCR ARRAY System Quick and Efficient: High quality and high-yield total RNA and miRNA isolation from FFPE samples in 70 minutes Superior Sensitivity: Simple Xylene-Free procedure and robust performance PCR ARRAY Detection RT2 FFPE Preamplification Faithfully Represents Biological Changes 30 . Real-time PCR Detection RT2 ProfilerTM PCR Array -3. 0 30 25 Figure 1. Highly Comparable Gene Expression Fold Change Results between FFPE Preamplified and Unamplified Samples. RNA extracted from FFPE spleen and intestine samples were extracted using the RT2 FFPE RNA Extraction Kit and converted to cDNA with and without preamplification. All four cDNAs were analyzed on the Human Cancer PathwayFinderTM PCR Array. The ∆∆Ct comparison and genes with raw Ct values lower than 33 in both unpreamplified spleen and intestine samples are presented. JUN IFNB1 FFPE PreAMP ∆∆Ct CDC25A 15 -5. 0 ANGPT1 -4. 0 TIMP3 20 TWIST1 -2. 0 35 TERT 3. 0 MET 2. 0 MMP1 1. 0 IFNA1 -1. 0 RT Only RT + PreAMP E2F1 -1. 0 RT2 SYBR® Green Master Mix 40 FGFR2 -2. 0 10 . CDKN2A -. 30 45 First-Strand cDNA Synthesis and PreAMP Multiplex PCR RT2 FFPE PreAMP Increases Detection of Genes Previously Classified as “Absent” CASP8 -. 40 20 . Raw Ct FFPE ∆∆Ct -. 50 Nucleic Acid Extraction 2 HOURS PreAMP protocol significantly enhances qRT-PCR detection sensitivity for FFPE samples y = 0.9749x - 0.0589 R2 = 0.9187 Proteinase K Digestion Column Clean-up 2 Easy Workflow: Cut FFPE Sections / Slides (10 - 80 µm) 70 MINUTES An innovative solution enabling the accurate qRT-PCR analysis of Formalin-fixed Paraffin-embedded (FFPE) samples. The RT² FFPE PreAMP technology utilizes multiplex tandem PCR to preamplify gene-specific cDNA with minimal bias. This kit is intended for preamplification of first-strand cDNA from fragmented total RNA from FFPE samples for gene expression analysis with RT² Profiler PCR Arrays. How the RT2 FFPE PreAMP PCR System Works 90 MINUTES Gene Expression Analysis from FFPE Samples Figure 2. Genes extracted from FFPE samples previously classified as “Absent” are now detectable after RT2 FFPE Preamplification. RNA was extracted from FFPE spleen sample (human) with the RT2 FFPE RNA Extraction Kit and reverse transcribed to cDNA using RT2 FFPE preamplification (red bars) and without PreAMP (blue bars). Results of the Human Cancer PathwayFinder PCR Array showed 55% of unpreamplified genes were virtually undetectable with no genes in the 10-20 Ct range. Preamplified genes with Ct values > 30, shift into the reliably quantitative range (Ct = 10-30). RT FFPE PreAMP & RNA Extraction Products 2 RT2 FFPE PreAMP Performance Increased positive call rate from FFPE samples Increased detection of genes previously classified as “Absent” Unbiased amplification of preamplified genes Faithful conservation of biological changes Product Catalog # RT FFPE RNA Extraction Kit 2 RT FFPE PreAMP cDNA Synthesis Kit 2 RT FFPE PreAMP Primer Mixes for All PCR ARRAYS 2 RT FFPE PreAMP Primer Mixes for Custom PCR ARRAYS 2 RT Profiler PCR ARRAYS 2 RT SYBR® Green qPCR Master Mixes 330471 330461 330251 2 www.SABiosciences.com 9
  • 12. Data Analysis Quick and Easy Software Service Core Gene Expression Analysis Services FREE Web-Based PCR ARRAY Data Analysis Software Genomic & Gene Expression Analysis This integrated web-based software package for the PCR Array System automatically performs all ΔΔCt based fold-change calculations from your uploaded raw threshold cycle data. Simply providing the array's catalog number annotates the results to the correct gene list. The web portal delivers results not only in a tabular format but also in scatter, volcano, cluster-gram, and multi-group plots. Perform any pair-wise comparison between groups of experimental replicates by defining your own fold-change and statistical significance thresholds, or compare all of the groups side-by-side. The web portal also helps you correctly interpret the genomic DNA, reverse transcription efficiency, and positive PCR control well data. Make your pathway-focused gene expression analysis quick and painless with the PCR Array System and the PCR Array Data Analysis Suite. SABiosciences provides genomic and expression analysis services that deliver robust and reproducible results. The Service Core accepts and processes a variety of biological samples and then leverages cutting-edge tools for either pathway-focused or genome-wide analysis yielding superior results for scientists in academic, government and industrial settings. Available Analysis Services DNA Service Whole Genome Simple: Just upload your data and define your parameters* Convenient: No downloading or installation required RNA Service Illumina Genotyping Illumina Expression Profiling Methylation Illumina DASL (fixed samples) Methylation Individual Gene / Locus Methylation qPCR - SYBR® Green Cells Cells Tissue or Blood Tissue or Blood Fixed Tissue Fixed Tissue Small Sample Small Sample Publication-Ready Output: Export all results as FREE EXCEL files or PNG image files * EXCEL-based data analysis templates are available from our website. INSTRUCTIONS 1 2 3 PCR Array Pathway-focused Sample Preparation Upload your data in a simple EXCEL file format. Define your housekeeping genes and experimental groups. Choose an automatically generated data analysis result Take a test run with pre-loaded sample data set today: www.SABiosciences.com/pcrarraydataanalysis.php OR Join our next live webinar entitled: “PCR Array Data Analysis Tutorial” at: www.SABiosciences.com/seminarlist.php Volcano Plot Scatter Plot miRNA PCR Array Nucleic Acid Isolation Sample isolation and integrity are fundamental to the success of any biological analysis. The Service Core provides qualified expertise in RNA and DNA isolation from a variety of biological samples. Each sample is evaluated for concentration and degradation to ensure successful future analysis. • RNA / DNA Isolation from Cells, Tissue or Biofluids (USA only) • Integrity/Degradation Checked for Every Sample Whole Genome Analysis LOG10 [p-Value] LOG10 [Group 1] LOG10 [Control Group] Figure 1: The Scatter Plot Compares Gene Expression Levels Between Two Experimental Conditions. The graph plots the log10 of normalized gene expression levels in a control condition (x-axis) versus an experimental condition (y-axis). Symbols outside the gray area indicate fold-differences larger than a threshold that you can define. The red symbols in the upper-left corner readily identify up-regulated genes, and the green symbols in the lower right corner readily identify down-regulated genes. 10 The Service Core uses the Illumina Platform to provide whole genome expression profiling, cytogenetic analysis, methylation and single nucleotide polymorphism (SNP) genotyping. As an Illumina CSPro (certified service provider), scientists are receiving results from a trained and tested scientific staff. LOG2 [Group 1/Control Group] Figure 2: The Volcano Plot Indicates the Statistical Significance of Gene Expression Changes. The x-axis plots the log2 of the fold-differences, while the y-axis plots their p-values based on student’s t-test of your replicate raw Ct data. The red and green symbols outside the gray area conveniently have the same meaning as the Scatter Plot. Symbols in the Volcano Plot above the blue line readily identify fold-differences at least as statistically significant as a threshold that you can define. Support@SABiosciences.com • Expression Profiling (Human, Mouse or Rat) • SNP Genotyping & Copy Number Variation Analysis • Whole Genome Methylation Analysis (Human) Pathway-focused Analysis Real-time PCR is a powerful tool for validating results from whole genome expression profiling, methylation or pathway analysis. An experienced leader in providing qPCR services, the Service Core delivers rapid and reproducible results. • Custom PCR Array Analysis • Pathway-focused PCR Array • Methyl-Profiler PCR Array
  • 13. QIAGEN® RNeasy® Kits Purification of High-quality Total RNA from a Range of Biological Samples A RNeasy Kits are a proven technology for rapid and convenient purification of ® high-quality RNA. Reproducible yields of intact RNA with high Agilent RIN (RNA Integrity Number) values are obtained, ensuring reliable results in downstream applications such as real-time RT-PCR. Kits are available for cells and easy-tolyse tissues as well as for more challenging samples, such as fiber-rich or fatty tissues, fine needle aspirates, and cryosections. Why Use RNeasy Kits? QIAGEN QIAxcel® Rel. FI Units [RFU, x1E+000] What Are RNeasy Kits? 1799.4 nt 20 4628.7 nt 10 131.0 nt 10 min 5 min B Agilent Bioanalyzer 400 How Do RNeasy Kits Work? Biological samples are first lysed in a lysis buffer that contains a guanidine salt, which fully denatures RNases to prevent RNA degradation. RNA is then specifically bound to a silica membrane, either in an RNeasy spin column or the well of an RNeasy 96 plate. Other cellular material is efficiently washed away using a series of wash buffers before pure, intact RNA is eluted in RNase-free water. 300 FU When purifying RNA, it is important to use a method that maintains RNA integrity and removes contaminants. Degradation of RNA makes reliable analysis of gene expression impossible, while the presence of contaminants in the purified RNA can inhibit enzymes in downstream applications such as real-time RT-PCR and microarray analysis. RNeasy Kits overcome these challenges through the combination of a specialized lysis buffer and silica-membrane technology. 200 100 0 25 200 500 1000 2000 4000 Figure 1. Highly Intact RNA. RNA was purified from Jurkat cells using the RNeasy Mini Kit. The purified RNA was analyzed on the [A] QIAxcel system (ratio of 28S to 18S rRNA: 1.55) and [B] Agilent 2100 Bioanalyzer (ratio of 28S to 18S rRNA: 1.7). A high RNA Integrity Number (RIN) of 9.6 was obtained, indicating highly intact RNA. QIAGEN RNeasy Kits* Product Catalog # RNeasy Mini Kit (50) For purification of RNA from cells & easy-to-lyse tissues Sample Lyse, homogenize, and add ethanol Bind total RNA to RNeasy membrane 74104 RNeasy Fibrous Tissue Mini Kit (50) For purification of RNA from fiber-rich tissues RNeasy Procedure 74704 RNeasy Lipid Tissue Mini Kit (50) For purification of RNA from all tissue types 74804 RNeasy 96 Kit (12) For purification of RNA from cells in 96-well format 74182 QIAzol Lysis Reagent (200 mL) For lysis of fatty & standard tissues before RNA isolation. 79306 * See also page 22 for RNeasy Protect Kits for stabilization and purification of RNA from tissues, cells, 2 saliva, and blood. See page 7 for for details on the RT FFPE RNA Extraction Kit. Wash RNeasy Fibrous Tissue Mini Kit Elute in small volume Ready-to-use RNA The RNeasy Fibrous Tissue Mini Kit includes proteinase K for removing abundant protein in fiber-rich tissue samples, and RNeasy spin columns for purifying up to 100 µg of high-quality RNA. Fibrous tissue samples can be conveniently stabilized using RNAlater RNA Stabilization Reagent or Allprotect Tissue Reagent, and efficiently disrupted using a TissueRuptor or TissueLyser system. www.SABiosciences.com 11
  • 14. QIAGEN® Products for Sample Disruption Fast and Effective Disruption of Biological Samples at a Range of Throughputs What Is Sample Disruption? QIAGEN Sample Disruption Products Effective disruption and homogenization of a biological sample is an absolute requirement for all RNA purification procedures. Disruption releases the RNA contained in a sample, while homogenization reduces sample viscosity to facilitate subsequent RNA purification. Product QIAshredder (50) For homogenization of cell lysates ® Catalog # 79654 TissueRuptor For disruption of individual samples 9001271 TissueRuptor Disposable Probes (25) Disposable probes for use with the TissueRuptor 990890 TissueLyser LT For disruption of up to 12 samples 85600 TissueLyser LT Adapter, 12-tube Adapter for use with the TissueLyser LT 69980 300 TissueLyser II For disruption of up to 48 or 192 samples 85300 200 TissueLyser Adapter Set 2 x 24 Adapter set for use with the TissueLyser II; holds 48 tubes 69982 TissueLyser Adapter Set 2 x 96 Adapter set for use with the TissueLyser II; holds 192 tubes 69984 Stainless Steel Beads, 5mm (200) 69989 Stainless Steel Beads, 7mm (200) 69990 Tungsten Carbide Beads, 3mm (200) 69997 TissueLyser Single-Bead Dispenser, 5mm 69965 The QIAshredder is a biopolymer-shredding system in a spin-column format. Cell lysate is applied to a QIAshredder spin column, which is then briefly centrifuged to homogenize the lysate. TissueLyser Single-Bead Dispenser, 7mm 69967 TissueLyser 3 mm Bead Dispenser, 96-Well 69973 The TissueRuptor is a handheld device that provides simultaneous disruption and homogenization using TissueRuptor Disposable Probes, which contain a blade that rotates at very high speeds. As the probes are both disposable and transparent, the risk of cross-contamination is minimized and the sample disruption process can be visually monitored. Use of disposable probes also saves time as there is no need to clean the same probe after disrupting each sample. TissueLyser 5 mm Bead Dispenser, 96-Well 69975 Why Use QIAGEN Sample Disruption Products? QIAGEN provides a range of technologies for disruption and homogenization — from QIAshredder spin columns for fast and simple homogenization of cell lysates to TissueRuptor and TissueLyser systems for mechanical disruption and homogenization of tougher tissue samples at a range of throughputs. TissueRuptor and TissueLyser systems deliver fast and effective disruption, and replace tedious and time-consuming methods such as disruption using a mortar and pestle. RNA Concentration [ng/µL] 400 TissueLyser LT TissueLyser II 100 0 Skin Heart Lung Brain Figure 1. Effective Tissue Disruption. Various rat tissues were disrupted using the TissueLyser LT or TissueLyser II. RNA was purified from 20 mg samples on the QIAcube using the RNeasy Fibrous Tissue Mini Kit (skin, heart, and lung) or RNeasy Lipid Tissue Mini Kit (brain). RNA was eluted in a volume of 50 µL, and concentration was determined using a spectrophotometer. How Do QIAGEN Sample Disruption Products Work? TissueLyser instruments are bead mills that simultaneously disrupt and homogenize samples through high-speed shaking with grinding beads in plastic tubes. Using an adapter that holds several tubes, the instruments disrupt multiple samples at the same time — up to 12 samples with the TissueLyser LT, and up to 48 or 192 samples with the TissueLyser II. 12 Support@SABiosciences.com The TissueLyser LT The TissueLyser LT is a small bead mill which provides fast, effective disruption of up to 12 samples at the same time. Simultaneous disruption and homogenization is achieved through high-speed shaking of samples in 2 mL microcentrifuge tubes with stainless steel or glass beads.
  • 15. QIAGEN® Products for RNA Stabilization Convenient and Immediate Stabilization of RNA in a Range of Biological Samples What Is RNA Stabilization? QIAGEN RNA Stabilization Products* Once a biological sample is harvested, its RNA becomes extremely unstable. The RNA is degraded by RNases, and gene induction or downregulation triggered by sample manipulation will also occur. Immediate stabilization of cellular RNA to preserve mRNA levels is critical for accurate gene expression analysis. RNA stabilization is usually achieved by rapidly freezing samples in liquid nitrogen or on dry ice. However, the use of such chemicals is hazardous, and care should be taken to avoid thawing of samples prior to sample disruption and RNA purification. Why Use QIAGEN RNA Stabilization Products? QIAGEN provides a broad range of reagents for convenient stabilization of RNA in cells, tissues, blood, and saliva at room temperature. The use of hazardous liquid nitrogen or dry ice to freeze samples is avoided. Samples are simply submerged in the reagents to immediately preserve the gene expression profile, and can then be conveniently handled and transported at ambient temperature prior to RNA purification. For further convenience, stabilization reagents are also available as part of QIAGEN kits for RNA purification. Fold Change in Transcript Level Allprotect Tissue Reagent (100 mL) For stabilization of RNA, DNA, and protein in tissues ® AllPrep DNA/RNA Mini Kit (50) For simultaneous purification of DNA and RNA from cells and tissues ® Catalog # 76405 80204 RNAlater RNA Stabilization Reagent (250 mL) For stabilization of RNA in tissues 76106 RNeasy Protect Mini Kit (50) For stabilization of RNA in tissues and purification of RNA 74124 ® RNAprotect Cell Reagent (250 mL) For stabilization of RNA in cells 76526 RNeasy Protect Cell Mini Kit (50) For stabilization of RNA in cells and purification of RNA 74624 RNeasy Protect Saliva Mini Kit (50) For stabilization of RNA in saliva and purification of RNA 74324 RNAprotect Animal Blood Tubes (50 x 100 µL) For collection of 100 µL animal blood with RNA stabilization 76544 RNAprotect Animal Blood Tubes (50 x 500 µL) For collection of 500 µL animal blood with RNA stabilization 76554 RNeasy Protect Animal Blood Kit (50) For purification of RNA from blood collected in RNAprotect Animal Blood Tubes 73224 miRNeasy Protect Animal Blood Kit (50) For purification of RNA, including miRNA, from blood collected in RNAprotect Animal Blood Tubes c-fos Transcript in Lung 100 217304 80 60 40 20 0 2 Hours 4 Hours Allprotect 24 Hours 2 Hours 4 Hours PBS 24 Hours Madh7 Transcript in Intestine 10 Fold Change in Transcript Level Product 1 * For collection of human blood with RNA stabilization and purification, use the PAXgene Blood RNA System. For collection of tissues with preservation of histomorphology and nucleic acids and nucleic acid purification, use the PAXgene Tissue System. For details, visit www.PreAnalytiX.com. 0.1 0.01 0.001 2 Hours 4 Hours Allprotect 24 Hours 2 Hours 4 Hours PBS 24 Hours Figure 1. Effective RNA Stabilization. Rat tissues were stored at 25ºC for 2–24 hours in Allprotect Reagent or PBS prior to real-time RT-PCR analysis. Transcript levels relative to those in liquid nitrogen stabilized tissues were calculated. Changes in transcript levels were prevented by Allprotect Reagent. Allprotect Tissue Reagent Allprotect Tissue Reagent provides immediate stabilization of DNA, RNA, and protein in tissue samples at room temperature. It is ideal for use prior to simultaneous purification of DNA, RNA, and protein using AllPrep Kits. www.SABiosciences.com 13
  • 16. APOPTOSIS BIOMARKERS CANCER CELL CYCLE PATHWAY-POWERED RT2 PROFILERTM PCR ARRAYS • Technology Overview (page 2) • Over 100 Pathways Available (page 28) Breast Cancer and Estrogen Receptor Signaling Apoptosis Autophagy Cancer PathwayFinder TM Cell Cycle DNA Damage Signaling Pathway Endothelial Cell Biology • Start With as Little as 1 ng of RNA (page 8) • Analyze FFPE Samples with PCR Arrays (page 9) • Over 1,000 Peer-reviewed Publications • Custom PCR Arrays Available for Human, Mouse, Rat, Rhesus Macaque and Drosophila Heat Shock Proteins NFκB Signaling Pathway Oxidative Stress and Antioxidant Defense p53 Signaling Pathway PI3K-AKT Signaling Pathway Stress and Toxicity PathwayFinder Angiogenesis Apoptosis Cell Surface Markers Apoptosis Autophagy Breast Cancer and Estrogen Receptor Signaling Cancer PathwayFinder Cancer Drug Resistance and Metabolism DNA Damage Signaling Pathway Dendritic and Antigen Presenting Cell Epigenetic Chromatin Modification Enzymes Epigenetic Chromatin Remodeling Factors Epithelial to Mesenchymal Transition (EMT) Extracellular Matrix and Adhesion Molecules Glucose Metabolism Hematopoietic Stem Cells and Hematopoiesis Homeobox (HOX) Genes TNF Ligand and Receptor Mesenchymal Stem Cell Unfolded Protein Response Stem Cell T-cell and B-cell Activation • To Learn More, Please Visit the PCR Product Web Page: Th1-Th2-Th3 • Accurate Detection of DNA Methylation at CpG Islands Without Bisulfite (page 20) RT2 MicroRNA PCR ARRAYS • Regulation of Gene Transcription and Translation (page 16) • Human, Mouse & Rat (Sanger miRBase 14) ChampionChIPTM PCR ARRAYS • Analyze DNA-Protein (histone) Interactions (page 19) 14 Cell Cycle Epithelial to Mesenchymal Transition (EMT) DNA Damage Signaling Pathway MAP Kinase Signaling Pathway Epithelial to Mesenchymal Transition (EMT) Neurogenesis and Neural Stem Cell EGF / PDGF Signaling Pathway NFκB Signaling Pathway MAP Kinase Signaling Pathway PI3K-AKT Signaling Pathway p53 Signaling Pathway Protein Phosphatases PI3K-AKT Signaling Pathway TGFβ BMP Signaling Pathway Tumor Metastasis www.SABiosciences.com/RTPCR.php Methyl-ProfilerTM PCR ARRAYS Cancer PathwayFinder Cell Cycle p53 Signaling Pathway Protein Phosphatases Signal Transduction PathwayFinder Transcription Factors Ubiquitination Pathway Wnt Signaling Pathway Breast, Colon, Gastric, Liver, Lung, & Prostate Cancer Breast, Colon, Gastric, Liver, Lung, & Prostate Cancer Breast, Colon, Gastric, Liver, Lung, & Prostate Cancer Tumor Suppressor Genes* Tumor Suppressor Genes* Cancer Cancer Cancer Cancer Cell Differentiation and Development Cell Differentiation and Development miFinderTM Cell Differentiation and Development miFinderTM miFinderTM Genome v2.0* Genome v2.0* Oncogenes and Tumor Suppressor Genes Oncogenes and Tumor Suppressor Genes Breast, Colon, Gastric, Liver, Lung, & Prostate Cancer (Signature & Complete Panels) Support@SABiosciences.com (Signature & Complete Panels) (Signature & Complete Panels) Genome v2.0* (Signature & Complete Panels) miFinderTM Genome v2.0* Oncogenes and Tumor Suppressor Genes T Helper Cell Differentiation
  • 17. CYTOKINES / INFLAMMATION NEUROSCIENCE STEM CELL / SIGNAL TRANSDUCTION DEVELOPMENT Angiogenic Growth Factors & Angiogenesis Inhibitors Alzheimer's Disease cAMP / Ca2+ Signaling PathwayFinderTM Dendritic and Antigen Presenting Cell Cancer Drug Resistance and Metabolism Inflammatory Cytokines and Receptors Atherosclerosis Embryonic Stem Cells Embryonic Stem Cells Cancer PathwayFinderTM Inflammatory Response and Autoimmunity Common Cytokine GPCR Signaling PathwayFinder EGF / PDGF Signaling Pathway Hedgehog Signaling Pathway DNA Damage Signaling Pathway Embryonic Stem Cells Heat Shock Proteins Endothelial Cell Biology Hedgehog Signaling Pathway Hematopoietic Stem Cells and Hematopoiesis Drug Metabolism Interferon and Receptor Chemokines & Receptors Common Cytokine Interferon α, β Response JAK / STAT Signaling Pathway NFκB Signaling Pathway T Cell Anergy & Immune Tolerance T-cell and B-cell Activation TGFβ BMP Signaling Pathway Th17 for Autoimmunity and Inflammation Th1-Th2-Th3 Toll-Like Receptor Signaling Pathway ECM / ADHESION Chemokines and Receptors Extracellular Matrix and Adhesion Molecules Apoptosis Hypoxia Signaling Pathway GPCR Signaling PathwayFinderTM Hedgehog Signaling Pathway Homeobox (HOX) Genes Mesenchymal Stem Cell MAP Kinase Signaling Pathway Neurogenesis and Neural Stem Cell Mesenchymal Stem Cell Neuroscience Ion Channels and Transporters Osteogenesis TGFβ BMP Signaling Pathway Tumor Metastasis TNF Ligand and Receptor Neurotransmitter Receptors and Regulators Neurotrophin and Receptors Nitric Oxide Signaling Pathway Notch Signaling Pathway Hepatotoxicology Notch Signaling Pathway Nuclear Receptors and Coregulators GPCR Signaling PathwayFinder Neurotrophin & Receptors NFκB Signaling Pathway NFκB Signaling Pathway Drug Transporters Neurogenesis and Neural Stem Cell MAP Kinase Signaling Pathway Drug Metabolism: Phase II Enzymes Mesenchymal Stem Cell JAK / STAT Signaling Pathway Drug Metabolism: Phase I Enzymes Lipoprotein Signaling and Cholesterol Metabolism Insulin Signaling Pathway Glycosylation Lipoprotein Signaling & Cholesterol Metabolism Osteogenesis PI3K-AKT Signaling Pathway Stem Cell Signaling T-cell and B-cell Activation Signal Transduction PathwayFinder Terminal Differentiation Marker TGFβ BMP Signaling Pathway Transcription Factors Inflammatory Response T Cell Activation Cytokine Production Breast, Colon, Gastric, Liver, Lung, & Prostate Cancer Inflammatory Response (Signature & Complete Panels) Cancer Genome v2.0 miFinder Immunopathology Breast, Colon, Gastric, Liver, Lung, & Prostate Cancer Stem Cell Transcription Factors (Signature & Complete Panels) Homeobox* (HOX) Polycomb* (PcG) Mitochondria Nephrotoxicity Oxidative Stress and Antioxidant Defense Stress and Toxicity PathwayFinder Inflammatory Response T Cell Activation Cytokine Production Cancer Cancer miFinderTM Genome v2.0* Cell Differentiation and Development Cell Differentiation and Development Genome v2.0* miFinderTM miFinderTM Genome v2.0* Genome v2.0* Oncogenes and Tumor Suppressor Genes Stem Cell Transcription Factors Genome v2.0* TM Inflammation T Helper Cell Differentiation Wnt Signaling Pathway Molecular Toxicology 384HT miFinderTM miFinderTM Inflammatory Response TGFβ BMP Signaling Pathway Wnt Signaling Pathway TNF Ligand and Receptor TOXICOLOGY / DRUG ADME Stem Cell Transcription Factors Inflammatory Response T Helper Cell Differentiation www.SABiosciences.com 15
  • 18. RT2 MicroRNA PCR ARRAYS Simultaneous Detection of Genome-Wide or Pathway-Focused miRNA How miRNA PCR ARRAYS Work As Easy as a Real-time PCR Experiment MicroRNAs are endogenous single-stranded RNA molecules 19-25 nucleotides in length, synthesized in a regulated manner from larger RNA molecules. Many miRNA sequences have been found in a variety of species [miRBase Release 14: >760 miRNAs in humans, >575 in mice, and >370 in rats]. 1. Convert miRNA to cDNA via Universal Tailing and Reverse Transcription. miRNA Sample 1 Why Use SABiosciences miRNA PCR ARRAYS? miRNA Sample2 miRNA 5’ Identification of miRNAs that potentially regulate your genes of interest is possible with our powerful yet simple bioinformatic algorithm at: www.SABiosciences.com/miRNAsearch.php 3. Functional Studies: The function of individual miRNAs can be identified via miRNA over expression or suppression of miRNA function. 16 Support@SABiosciences.com 1 hr Universal Priming AAAAAA 5’ TTTTTT Universal RT Primer Reverse Transcription AAAAAA cDNA 5’ TTTTTT 2 hr cDNA 5’ TTTTTT 3’ qPCR using miRNASpecific Primer and Universal qPCR Primer 4. Data Analysis. Specificity 120 Single Nucleotide Mismatch Specificity Targeted Template 80 72.2 20 0 0.54 hsa-miR-99a 0.07 hsa-miR-100 miR-99a miR-100 hsa-miR-99a 21.76 O F F 40 O T R E N A G T 60 SABiosciences Assay B Off-Target Template 100 O F T R E F A G T A Expression Analysis: Bioinformatic Prediction: Polyadenylation 3’ 3. Run in Your Real-Time PCR Instrument. The best technology for determining the expression of miRNA is the SABiosciences miRNA PCR Array System. 2. 5’ 3’ O T R E N A G T 1. Analyze 96 - 384 miRNAs in Each PCR Array O T R E N A G T MicroRNA represents a new layer of regulation in endogenous gene transcription and translation. Since there are hundreds of miRNAs in each species, with each miRNA potentially having hundreds of targets, the majority of genes may be subject to regulation by one or more miRNAs. miRNAs are already being considered as cancer biomarkers, and their importance is being realized in a variety of other research areas, such as differentiation, neurobiology and immunology. There are three major ways to start studying miRNA: AAAAAA Poly(A) tail 2. Add cDNA to RT2 qPCR Master Mix. Aliquot Mixture Across PCR Array. Sensitivity: As little as 0.5 µg total RNA needed Multi-Sequence Flexibility: Analyze up to 384 sequences simultaneously Simplicity: As easy as a real-time PCR Array experiment Why Study miRNA? Single Tube Reaction 5’ 3’ 2 The RT miRNA PCR Array accurately analyzes the expression of up to 96 or 384 microRNA sequences simultaneously on ANY real-time PCR instrument. SABiosciences' patent-pending miRNA technology integrates a universal-tailing and reverse transcription reaction specific for miRNA with accurate expression level measurement of distinct miRNA sequences that may differ by a single nucleotide base. RT2 miRNA PCR Arrays are the most specific and sensitive technology for analyzing genome-wide miRNA expression. 3’ 5’ Relative Detection [% Correct] Detecting every miRNA across the entire genome in a specific and sensitive way is a very technologically challenging task. Many miRNA family members and otherwise distinct miRNA species have very similar sequences. Moreover, other RNA species such as snRNA, tRNA, mRNA, and rRNA can cause non-specific amplification, making the specific analysis of mature miRNA even more problematic. SABiosciences' proprietary miRNA detection technologies enable uniformly high PCR amplification efficiencies, allowing simultaneous detection of miRNA under uniform cycling conditions. O T R E N A G T What are miRNAs? hsa-miR-100 Competitor Assay AACCCGUAGAUCCGAUCUUGUG AACCCGUAGAUCCGAACUUGUG Figure 1: miRNA qPCR Assays Distinguish Single Nucleotide Mismatches. RT2 miRNA PCR Assays and a competitor’s assays for miR-99a and miR-100 were used to detect both corresponding synthetic templates, whose sequences differ by only one nucleotide (B). Relative detection of the off-target template is calculated as a percentage of the correct template detection (A). RT2 miRNA PCR Assays’ proprietary primer design specifically discriminates closely related sequences better than competing assays.
  • 19.
  • 20. QIAGEN® miRNeasy Kits Purification of Total RNA from a Range of Biological Samples A What Are miRNeasy Kits? miRNeasy Kits are a special adaptation of proven RNeasy technology, allowing purification of total RNA longer than approximately 18 nucleotides. The purified RNA includes large RNAs, such as mRNA and rRNA, as well as small RNAs, such as microRNA (miRNA), Piwi-interacting RNA (piRNA), small nucleolar RNA (snoRNA), and small nuclear RNA (snRNA). High-throughput Ct Value 32 Why Use miRNeasy Kits? Threshold Cycles 25 22 12 1x107 1x106 1x103 1x102 2 µg 200 ng Low-throughput 32 Ct Value Consistent Results 1x104 1x105 Cell Number B The miRNeasy Mini Kit and miRNeasy 96 Kit allow efficient purification of miRNA from all types of cells and tissues. Effective lysis, even with difficult-tolyse tissues, and removal of contaminants by organic-phase extraction is ® achieved using QIAzol Lysis Reagent. RNA is then purified in spin-column format (miRNeasy Mini Kit) or in 96-well format (miRNeasy 96 Kit). 30 27 17 Copurification of large and small RNAs allows real-time RT-PCR detection of both mRNA and miRNA using, for example, the miScript PCR System and RT2 Profiler PCR Arrays. For certain applications where large RNAs need to be removed, supplementary protocols are available for purification of an RNA fraction rich in small RNAs. How Do miRNeasy Kits Work? Copurification miRNA-enriched Fraction Copurification miRNA-enriched Fraction 27 22 17 QIAcube Manual 12 20 20 mg 2 mg 200 µg 20 µg Amount of Tissue 15 Figure 2. Effective Purification from a Range of Starting Amounts. Total RNA was purified from [A] 102–107 Jurkat cells using the miRNeasy 96 Kit or [B] a dilution series of rat lung tissue homogenate from 20 mg to 200 ng using the miRNeasy Mini Kit. miRNA-enriched fractions (<200 nucleotides) were also isolated from the same samples. Purified RNA was used as a template in quantitative, real-time RT-PCR assays for the miRNA miR-16. 10 5 0 miR-16 miR-25 Figure 1. Reliable miRNA Detection. Rat kidney (25 mg) was stabilized in RNAlater RNA Stabilization Reagent and disrupted using the TissueLyser II. Total RNA (with miRNA) was purified using the miRNeasy Mini Kit, either manually or on the QIAcube®. Real-time RT-PCR using the miScript PCR System was carried out to detect miR-16 and miR-25. miRNeasy Mini Kit The miRNeasy Mini Kit enables purification of total RNA which includes RNA from approximately 18 nucleotides (nt) upwards from all types of animal tissues and cells, including difficult-to-lyse tissues. The miRNeasy Mini Kit is used for low-throughput RNA purification using spin columns. QIAGEN miRNeasy Kits* Product miRNeasy Mini Kit (50) For purification of RNA, including miRNA, from cells and tissues 217004 miRNeasy 96 Kit (4) For purification of RNA, including miRNA, from cells and tissues in 96-well format 217061 * See also page 22 for stabilization and purification of RNA, including miRNA, from blood. 2 for for details on the RT FFPE RNA Extraction Kit that also recovers miRNA. 18 Support@SABiosciences.com Catalog # See page 7
  • 21. ChampionChIP qPCR System TM 40% 35% 30% 25% The ChampionChIP One-Day Kit simplifies the usual two- to five-day ChIP protocol down to a manageable six to eight hours. Its crosslink reversal step is much faster and less tedious than conventional methods, and its DNA purification step yields a larger quantity and higher quality ChIP DNA than other one-day kits. 20% 15% 10% 5% 0% CDKN1A Gene Region (kb Relative to TSS) ChampionChIP antibodies for modified histones (H3Ac, H3K4me2, H3K27me3) or control IgG were used for precipitating chromatin from one million HeLa cells. Each ChIP DNA fraction was analyzed with a ChampionChIP Tiling Array representing 30 one-kb tile intervals across the genomic sequence of the CDKN1A gene. The results obtained from three independent experiments are consistent with active transcription of the CDKN1A gene. 8 30 min 30 min 40 min Optional: Quickly Evaluate Fragmentation Size 2. Immunoprecipitation Pre-Clear Anti-TF or -Histone Antibody & Control IgG Save Input Protein A Beads Fraction Wash 3. ChIP and Input Fraction DNA Isolation Reverse Cross-Linking and Elution DNA Spin-Column Purification B. Real-Time PCR C. Data Analysis (ChIP PCR Array Analysis Software) 50 min 1-2 hr 1 hr 30 min 30 min 10 min 2 hr 15 min Fold Change 7 A. Chromatin Immunoprecipitation (ChIP) 1. ChIP-Ready Chromatin Preparation Fix and Harvest Cells Sonicate Chromatin 6 5 4 The ChampionChIP System includes a simplified high-performance One-Day ChIP Kit, ChIP-Grade Antibodies, real-time PCR primers, and a FREE ChIP PCR Array Data Analysis Suite. Percent of DNA Input [%] Euchromatin and Heterochromatin Markers H3K4me2 H3K27me3 H3K9me3 Control IgG 6 4 2 0 A549 HepG2 PC3 0 p53 Binding CDKN1A mRNA Expression Figure 4: Treatment with 5-Fluorouracil Increases CDKN1A Gene Expression and p53 Binding in Cell Lines Expressing Wild-Type But Not Mutant p53. Triplicate samples from A549, HepG2, and PC3 cells were treated with 5-FU (300 µM, 6 h), and either subjected to ChIP with an anti-p53 antibody followed by qPCR analysis of the CDKN1A-2kb p53 binding site, or harvested for RNA to analyze CDKN1A expression by real-time RT-PCR. The results of both assays are expressed as the fold-increase upon 5-FU treatment. ChampionChIP qPCR System Catalog # Human Mouse ChampionChIP PCR Arrays Stem Cell Transcription Genes Oncogene & Tumor Suppressor Genes T Helper Cell Differentiation Inflammatory Responses ChampionChIP One-Day Kit ChampionChIP Antibody Kits Human RNA Polymerase II, p53 Histones (H3Ac, H4Ac, H3Kme2, etc.) 330454 330454 330454 330454 330454 334471 GH-501 GH-502 GH-503 GH-504 GA-101 GM-501 GM-502 GM-503 GM-504 GA-101 334481 Inquire Inquire ChampionChIP qPCR Primers High Specificity 8 Transcription Factor Binding and mRNA Expression Analysis 3 2 1 Figure 1: The Entire ChampionChIP System Protocol Can Be Completed in a Single Day. 10 H3Ac H3K4me2 H3K27me3 Control IgG Figure 3: Differential Histone Modification Tiling Across the Sequence of Any Gene. How the ChampionChIPTM System Works 12 Differential Histone Modification Across Any Gene +10 +9 +8 +7 +6 +5 +4 +3 +2 +1 -1 -2 -3 -4 -5 -6 -7 -8 -9 -10 -11 -12 -13 -14 -15 -16 -17 -18 -19 -20 The ChampionChIPTM System provides the first complete platform for the analysis of in vivo protein-DNA interactions using Chromatin Immunoprecipitation (ChIP) and real-time PCR (qPCR) detection. With validated high-quality ChIP-grade antibodies and PCR primers for any genes’ promoter region, a simple and robust one-day preparation assay quickly delivers reliable and biologically relevant results. ChIP qPCR is a powerful and versatile method for the analysis of chromatin DNA bound by transcription factors, co-regulators, modified histones, chromatin remodeling proteins, or other nuclear factors from live cells. However, the tedious process and variable results have limited many researchers’ ability to adopt this technique to study dynamic protein-DNA interactions in native chromatin environments. The ChampionChIPTM System, yields the most reliable ChIP assay results with qPCR precision in just a single day. Percent of DNA Input [%] Reliable Chromatin IP with Real-Time PCR Precision Achieved in Only ONE DAY! 334001 Inquire Inquire Custom ChampionChIP qPCR Arrays Inquire Inquire Inquire Product Any Promoter Region for Human, Mouse or Rat ALDOA MYO-D Genomic Loci SAT2 TF Binding Sites or Promoter Tiling 330520 RT SYBR Green w/ ROX Master Mix 2 330510 RT SYBR Green w/ Fluorescein Master Mix 2 330500 RT SYBR Green Only Master Mix ChampionChIP PCR Array Data Analysis Software 2 Figure 2. The ChampionChIP System Readily and Correctly Identifies Different Euchromatin and Heterochromatin Loci. ChampionChIP antibodies against modified histones (H3K4me2, H3K27me3, H3K9me3) or control IgG were used for precipitating chromatin from HeLa cells. Each ChIP DNA fraction was analyzed by real-time PCR using primers specific for the ALDOA, MYO-D, and SAT2 loci to calculate percentages of co-precipitating DNA relative to input. www.SABiosciences.com FREE 19
  • 22. Methyl-Profiler PCR ARRAY System TM Simple, Fast and Reliable DNA Methylation Analysis The Methyl-ProfilerTM DNA Methylation PCR Array System is an innovative technology enabling fast and accurate detection of DNA methylation status at CpG islands. This technology complements the bisulfite-based methods with simple and simultaneous selective restriction digests of either methylated or unmethylated DNA, and takes advantage of the quantitative power of real-time PCR. The PCR Array format reveals the DNA methylation status of gene panels related to diseases or pathways. The individual primer pairs allow analysis of the DNA methylation status of any human or mouse gene. The reliability and simplicity of the procedure makes this technology ideal for profiling DNA methylation and biomarkers of stem cell growth and differentiation, cancer, and other human diseases. How DNA Methylation PCR ARRAYS Work 1. DNA Digestion. Mix DNA + Digestion Buffer Split into 4 Fractions Why Use the Methyl-ProfilerTM PCR ARRAY System? Simple, Fast and Reliable: No bisulfite conversion and ready-to-use. Disease- or Pathway-Focused Gene Sets: Simultaneously detect DNA methylation of 24 or 96 genes. Genome-wide Coverage: Primers to detect methylation of your favorite genes. The Methyl-Profiler PCR Array System relies on the differential cleavage of target sequences by two different restriction endonucleases whose activities require either the presence or absence of methylated cytosines in their respective recognition sequences. As real-time PCR quantifies the relative amount of intact DNA remaining after each enzyme digestion, the methylation status of individual genes and the methylation profile across a gene panel are reliably and easily calculated. The high yield of DNA from the restriction digests and PCR amplification allow the analysis of smaller, more heterogeneous samples. Results Comparable to Bisulfite Sequencing Add Enzyme: Mock Sensitive Dependent Methylation Sensitive - + - + Methylation Dependent - - + + 37 C (6 hr - overnight) RT SYBR Green qPCR Master Mix 2 ® Mock Sensitive Dependent Double % Total Input DNA Hypermethylated Intermediately Methylated Unmethylated Gene 1 Gene 2 Gene 3 Gene 4 Gene 5 Gene 6 The human genome contains many long hypermethylated stretches of CpG dinucleotide-rich sequences. In this sea of CpG methylation, unmethylated CpG-rich sequences, known as “CpG islands”, are found in the promoters of most transcriptionally active genes. These normal patterns of DNA methylation are perturbed in cancer cells, where specific tumor suppressor genes (TSG) become hypermethylated, causing their expression to be silenced. Since every tumor type has a unique “methylation profile”, or panel of hypermethylated genes, the analysis of TSG hypermethylation has become very important for basic cancer research, clinical diagnostics, and therapeutic applications. The Methyl-Profiler PCR Array System fulfills the need to rapidly and simultaneously determine the methylation status of more genes in more samples in a higher-throughput fashion. The current time- and labor-intensive methodologies require bisulfite conversion of unmethylated cytosines to uracil followed by either sequence analysis or PCR using primers sensitive to the resulting base conversion. Bisulfite conversion is not only tedious but is also inefficient and damages DNA. The resulting low yields of DNA make bisulfite-based methods unsuitable for the analysis of small samples. 20 90 Support@SABiosciences.com Hypermethylated Intermediately Methylated Unmethylated 80 70 60 50 40 30 20 10 0 3. Data Analysis. 100 80 60 40 20 0 Percent of Input DNA [%] Double o 2. Real-Time PCR. 100 Bisulfite Sequencing MethylProfiler MCF7 Bisulfite Sequencing MethylProfiler SKBR3 Bisulfite Sequencing MethylProfiler MDA-MB-231 Figure 1: Methyl-Profiler PCR Assays Yield Results Consistent with Bisulfite Sequencing. The methylation status of the cadherin 1 gene (CDH1) was determined using bisulfite sequencing and Methyl-Profiler PCR Assays in three breast cancer cell lines known to have very different CDH1 methylation patterns. To validate the accuracy of the Methyl-Profiler PCR Array System, its results were compared with those generated by bisulfite sequencing, the gold standard for DNA methylation analysis. The methylation status for both the CDH1 (Figure 1) and CDH13 (data not shown) genes observed in three different breast cancer cell lines by the two methods match very closely. Real-time PCR characterization of methylation-dependent and methylation-sensitive restriction enzyme digestions directly quantifies unmethylated and hypermethylated genomic DNA, respectively. The results indicate that the sensitivity and specificity of the MethylProfiler PCR Array System rivals bisulfite sequencing, suggesting that it can provide an alternative to more tedious bisulfite PCR analysis methods. Make your DNA Methylation analysis as quick and painless as possible with the Methyl-Profiler DNA Methylation PCR System and EXCEL-based data analysis. Download our FREE EXCEL Data Analysis Software: www.SABiosciences.com/dna_methylation.php
  • 23. Methyl-ProfilerTM PCR ARRAY System PCR ARRAY Guide v4.0 Novel Breast Cancer Biomarker Discovery 100 Hypermethylated Intermediately Methylated Unmethylated 80 70 60 50 40 30 20 10 0 100 93.75 87.5 75 50 33.33 12.5 6.25 0 and normal blood genomic DNA (encoding hypermethylated and unmethylated HIC1, respectively) were mixed in different ratios. Using Human HIC1 Methyl-Profiler qPCR Primers, the percentage of hypermethylated HIC1 relative to total promoter DNA in each mixture was detectable down to 6.25 percent. Primary tumors are typically very heterogeneous, containing a mixture of both cancerous and noncancerous cells. Therefore, reliable tumor characterization requires detecting smaller amounts of hypermethylated DNA diluted in an unmethylated background. Methyl-Profiler PCR Assays have the sensitivity required to detect hypermethylated DNA from breast cancer cells even when they represent only 6.25 % of the total cell population (Figure 2). Applications MLH1 ATM APC CHFR CAV1 CRBP1 FHIT BRCA1 CDKN2A CDKN1A SFN p14ARF PYCARD GADD45A ZMYND10 GSTP1 CDH1 CALCA MGMT ABCB1 CDH13 WT1 p73 HIC1 % Hypermethylated DNA 30% 40% 50% 60% 70% >80% Blood MCF7 SKBR3 24 Signature Breast Cancer Tumor Suppressor Genes Breast Cancer Biomarker Validation 20% 20% 30% 40% 50% 60% 70% Normal MDA- MDA- UACC812 MDA- SKBR3 SKBR3 MCF7 MCF7 MB-415 MB-231 MB-435 Figure 2: Methyl-Profiler PCR Assays Detect Hypermethylation in Heterogeneous Samples Containing As Little As Five Percent Tumor DNA. SKBR3 breast cancer cell line 10% 10% >80% Percent SKBR3 Genomic DNA [%] <10% 79 Transcription Factor Genes <10% 90 % Hypermethylated DNA Percent of Total Input DNA [%] Sensitivity Comparable to Bisulfite Sequencing MDA-MB-231 Cell Lines Figure 3: Methyl-Profiler PCR Arrays Validate Breast Cancer Gene Methylation Status in Breast Cancer Cell Lines. Heat map comparison of the hypermethylation status of 24 genes in the genomic DNA of three breast cancer cell lines and blood genomic DNA as determined by Human Breast Cancer Signature Panel DNA Methylation PCR Arrays. To demonstrate that Methyl-Profiler PCR Arrays can validate methylation biomarkers, we first scanned published results to design a cataloged PCR Array representing a signature panel of the 24 most frequently methylated genes in human breast tumors. We then analyzed the methylation profile of this gene panel in three different breast cancer cell lines (Figure 3). The results further strengthen the correlation of these biomarkers with breast cancer. Cell Lines Figure 4: Methyl-Profiler PCR Arrays Discover New Candidate Breast Cancer DNA Methylation Biomarkers. Heat map comparison of the hypermethylation status of a panel of 79 transcription factor genes in six breast cancer cell lines and a normal epithelial cell line as determined with Custom DNA Methylation PCR Arrays. To demonstrate that Methyl-Profiler PCR Arrays can also discover new biomarkers, we arranged a custom array containing a panel of candidate transcription factor genes, whose methylation status had not been previously associated with breast cancer (Figure 4). We found that breast cancer cell lines also hypermethylate this gene panel, potentially providing a new discovery source for cancer biomarkers. The Methyl-Profiler DNA Methylation PCR Array System is ideally suited to genomic DNA hypermethylation analysis for both basic research applications and clinical biomarker development. The simple two-step procedure is considerably faster and easier than current bisulfite sequencing and bisulfite PCR methods, and yields closely matching results with equivalent sensitivity. Methyl-Profiler TM DNA Methylation PCR ARRAYS Product* Breast Cancer Gastric Cancer Liver Cancer Lung Cancer Prostate Cancer Colon Cancer Human Stem Cell Transcription Factors Inflammatory Response T Cell Activation Cytokine Production Tumor Suppressor Genes (TSG) Homeobox Genes (HOX) Polycomb Genes (PcG) Custom Methyl-Profiler PCR Arrays Catalog # Human Mouse 335211 335211 335211 335211 335211 335211 335211 335211 335211 335211 335211 335211 335211 MeAH-011 MeAH-021 MeAH-031 MeAH-041 MeAH-051 MeAH-061 MeAH-511 MeaH-521 MeaH-531 MeAH-541 MeAH-551 MeAH-561 MeAH-571 Inquire MeAM-011 MeAM-021 MeAM-031 MeAM-041 MeAM-051 MeAM-061 MeAM-511 MeAM-521 MeAM-531 MeAM-541 MeAM-551 MeAM-561 MeAM-571 Inquire * Methyl-Profiler PCR Arrays are available in Signature Panels (24 genes) & Comprehensive Panels (96 genes). PCR ARRAY Accessories Pack Size Methyl-Profiler qPCR Assays 200 Reactions Methyl-Profiler Enzyme Kit 12 Samples 2 RT SYBR Green Master Mixes (see page 6) 2 Arrays Methyl-Profiler PCR Array Data Analysis Software www.SABiosciences.com Catalog # 335001 335451 Various FREE 21
  • 24. QIAGEN® DNeasy® Blood & Tissue Kits Purification of Total DNA from Cells, Tissues & Blood What Are DNeasy Blood & Tissue Kits? DNeasy Blood & Tissue Kits provide fast and easy silica-based DNA purification in convenient spin-column and 96-well-plate formats. Most samples can be directly lysed with proteinase K, eliminating the need for mechanical disruption and reducing hands-on time. Optimized protocols for specific sample types provide reproducible purification of high-quality DNA for life science, genotyping, and veterinary pathogen research applications. Why Use DNeasy Blood & Tissue Kits? DNeasy Blood & Tissue Kits simplify purification of DNA from a wide range of sample types, including animal species commonly encountered in life science, veterinary, and genotyping applications. The efficient DNeasy Blood & Tissue procedure enables high yields of total DNA from animal blood and tissue samples. Typical Yields Using DNeasy Blood & Tissue Kits Source Amount DNA [µg] Mammalian Blood Bird Blood HeLa Cells Liver Brain Kidney Spleen Mouse Tail Rat Tail Pig Ear Horse Hair Fish Fin Fish Spawn (mackerel) 100 µL 5 µL 2 x 106 25 mg 25 mg 25 mg 10 mg 1.2 cm (tip) 0.6 cm (tip) 25 mg 10 hairs 20 mg 10 mg 3-6 9-40 15-25 10-30 15-30 15-30 5-30 10-25 20-40 10-30 2-4 10-20 5-10 QIAGEN DNeasy Blood & Tissue Kits How Do DNeasy Blood & Tissue Kits Work? Product DNeasy Blood & Tissue Kits use reliable silica-membrane technology, in convenient spin-column or 96-well formats. This technology ensures fast and reproducible DNA purification, eliminating the need for organic extraction and alcohol precipitation. Catalog # 69581 69582 69506 69504 DNeasy 96 Blood & Tissue Kit (4) 4 x 96 DNA minipreps DNeasy 96 Blood & Tissue Kit (12) 12 x 96 DNA minipreps DNeasy Blood & Tissue Kit (250) 250 DNA minipreps DNeasy Blood & Tissue Kit (50) 50 DNA minipreps QIAGEN® QIAamp® DNA Mini Kits Purification of Genomic, Mitochondrial, Bacterial, Parasitic, or Viral DNA What are QIAamp DNA Mini Kits? QIAamp DNA Mini Kits provide silica-membrane-based nucleic acid purification from tissues, swabs, CSF, blood, body fluids, or washed cells from urine. The spin-column procedure does not require mechanical homogenization, so total hands-on preparation time is only 20 minutes. Why use QIAamp DNA Mini Kits? QIAamp DNA technology yields genomic, mitochondrial, bacterial, parasite, or viral DNA from human tissue samples ready to use in PCR and blotting procedures. DNA purified using the QIAamp DNA Mini Kit is sized up to 50 kb. DNA of this length denatures completely and has the highest amplification efficiency. How do QIAamp DNA Mini Kits work? QIAamp DNA Mini Kits use fast spin-column or vacuum procedures. No phenolchloroform extraction is required. DNA binds specifically to the QIAamp silica-gel membrane while contaminants pass through. PCR inhibitors such as divalent cations and proteins are completely removed in two efficient wash steps, leaving purified DNA to be eluted in either water or a buffer provided with the kit. 22 Support@SABiosciences.com Typical Yields Using QIAamp DNA Mini Kits Sample Blood Buffy Coat Cells Liver Brain Lung Heart Kidney Spleen Amount Total Nucleic Acids [µg]* DNA [µg]† 200 µL 200 µL 107 25 mg 25 mg 25 mg 25 mg 25 mg 10 mg 4-12 25-50 40-60 60-115 35-60 25-45 15-40 40-85 25-45 4-12 25-50 30-40 10-30 15-30 5-10 5-10 15-30 5-30 * Nucleic acids obtained without RNase treatment. † DNA obtained with RNase treatment. QIAGEN QIAamp DNA Mini Kits Product Catalog # QIAamp DNA Mini Kit (250) For 250 DNA preps 51306 QIAamp DNA Mini Kit (50) For 50 DNA preps 51304
  • 25. PreAnalytiX® PAXgene® DNA System Collection & Stabilization of Blood or Tissue Samples & Subsequent DNA Purification What Is the PAXgene DNA System? A For blood, the PAXgene Blood DNA System is an integrated and standardized system for collection and stabilization of whole blood specimens and subsequent purification of genomic DNA. The system uses PAXgene Blood DNA Tubes for blood collection and stabilization, and the PAXgene Blood DNA Kit for subsequent DNA purification. For tissue, the PAXgene Tissue DNA System enables molecular and traditional pathology testing from the same specimen, providing a superior alternative to traditional tissue fixation methods. PAXgene Tissue Containers are used for collection, stabilization, and storage of tissue specimens, while preserving tissue morphology. The PAXgene Tissue DNA Kit allows subsequent purification of DNA. Why Use the PAXgene DNA System? The PAXgene Blood DNA System provides blood collection and purification in one system, easy sample transport after collection, and high-quality, high-molecular–weight DNA. The PAXgene Tissue DNA System provides an integrated system for fixation, stabilization, and purification. It both preserves tissue morphology and provides high-quality DNA. How Does the PAXgene DNA System Work? PAXgene Blood DNA Tubes are used for collection under vacuum of 8.5 mL whole blood. These tubes contain a proprietary blend of reagents that both prevents blood coagulation and stabilizes white blood cells. For DNA isolation, the blood is transferred to processing tubes filled with cell lysis buffer and the solution is mixed to lyse red and white blood cells. Cell nuclei and mitochondria are pelleted by centrifugation, washed, and resuspended in digestion buffer. Protein contaminants are removed by incubation with a protease. DNA is precipitated in isopropanol, washed in 70% ethanol, dried, and resuspended in resuspension buffer. For tissue, samples are placed into PAXgene Tissue Containers. These are dual-chamber containers prefilled with 2 reagents: PAXgene Tissue Fix which rapidly penetrates and fixes the tissue and PAXgene Tissue Stabilizer which stops fixation and stabilizes tissue. DNA purification is performed using the PAXgene Tissue DNA Kit which uses silica-based technology in a spin-column format. M M 48.5 kb B M M 145.5 kb 48.5 kb Figure 1. High Quality and High Molecular Weight of Genomic DNA. Genomic DNA was isolated from 8 blood donors using the PAXgene Blood DNA System. [A] Agarose gel analysis; [B] pulsed-field gel electrophoresis for enhanced separation of high-molecular–weight genomic DNA; [M] markers. PreAnalytiX PAXgene DNA Kits Product Catalog # 761133 PAXgene Tissue Containers (10) For 10 tissue samples PAXgene Tissue Containers are dual-cavity containers prefilled with 2 reagents. PAXgene Tissue Fix rapidly penetrates and fixes the tissue, preserving tissue morphology. Fixation is comparable to formalin fixation, but without the destructive nucleic acid crosslinking and degradation. After fixation, the tissue is transferred to PAXgene Tissue Stabilizer in the same container. Nucleic acids and morphology of the sample are stable up to 7 days at room temperature, for longer periods at 2-8°C, or even at -20°C. Stabilized samples can be embedded in paraffin for histological studies. PAXgene Tissue Kits provide efficient subsequent purification of RNA, miRNA, and/or DNA from the same sample. Inquire PAXgene Blood DNA Kit (25) For 25 DNA preparations PAXgene Tissue Containers PAXgene Blood DNA Tubes (100) For collection of 100 samples 765112 PAXgene Tissue DNA Kit (50) For 50 DNA preparations 767134 PAXgene Blood DNA Tubes The PAXgene Blood DNA system consists of PAXgene Blood DNA Tubes, for blood collection and stabilization, and the PAXgene Blood DNA Kit, for DNA purification in a single-tube procedure. www.SABiosciences.com 23
  • 26. RT2 Profiler PCR ARRAY Publications Selected Research Papers Citing RT2 Profiler PCR ARRAYS* References Listed by Pathway-Focused PCR Arrays ANGIOGENESIS APPLICATION: CANCER BIOLOGY Brant KA, Fabisiak JP. Nickel and the microbial toxin, MALP-2, stimulate proangiogenic mediators from human lung fibroblasts via a HIF-1alpha and COX-2-mediated pathway. Toxicol Sci. 2009 Jan;107(1):227-37. Liu Z, Kobayashi K, van Dinther M, van Heiningen SH, Valdimarsdottir G, van Laar T, Scharpfenecker M, Lowik CW, Goumans MJ, Ten Dijke P, Pardali E. VEGF and inhibitors of TGFbeta type-I receptor kinase synergistically promote J Cell Sci. 2009 Sep 15;122(Pt 18):3294-302. McElroy MK, Kaushal S, Tran Cao HS, Moossa AR, Talamini MA, Hoffman RM, Bouvet M. Upregulation of thrombospondin-1 and angiogenesis in an aggressive human Mol Cancer Ther. 2009 Jul;8(7):1779-86. APOPTOSIS Bose RN, Maurmann L, Mishur RJ, Yasui L, Gupta S, Grayburn WS, Hofstetter H, Milton T. Non-DNA-binding platinum anticancer agents: Cytotoxic activities of platinum-phosphato complexes towards human ovarian cancer cells. Proc Natl Acad Sci U S A. 2008 Nov 25;105(47):18314-9. Uetani T, Nakayama H, Okayama H, Okura T, Higaki J, Inoue H, Higashiyama S. Insufficiency of proHB-EGF shedding enhances hypoxic cell death in H9c2 cardiomyoblasts via the activation of Caspase-3 and c-JUN N-terminal kinase. J Biol Chem. 2009 Feb 4. Bok K, Prikhodko VG, Green KY, Sosnovtsev SV. Apoptosis in Murine Norovirus Infected RAW264.7 Cells is Associated with Survivin Downregulation. J Virol. 2009 Feb 11. Mhyre AJ, Marcondes AM, Spaulding EY, Deeg HJ. Stroma-dependent apoptosis in clonal hematopoietic precursors correlates with expression of PYCARD. Blood. 2009 Jan 15;113(3):649-58. Pru JK, Kaneko-Tarui T, Jurisicova A, Kashiwagi A, Selesniemi K, Tilly JL. Induction of proapoptotic gene expression and recruitment of p53 herald ovarian Reprod Sci. 2009 Apr;16(4):347-56. BREAST CANCER & ESTROGEN RECEPTOR SIGNALING Cooper C, Guo J, Yan Y, Chooniedass-Kothari S, Hube F, Hamedani MK, Murphy LC, Myal Y, Leygue E. Increasing the relative expression of endogenous non-coding Steroid Receptor RNA Nucleic Acids Res. 2009 Jul;37(13):4518-31. Adams BD, Cowee DM, White BA. The role of miR-206 in the epidermal growth factor (EGF) induced repression of Mol Endocrinol. 2009 Aug;23(8):1215-30. TM CANCER PATHWAYFINDER Gridley DS, Slater JM, Luo-Owen X, Rizvi A, Chapes SK, Stodieck LS, Ferguson VL, Pecaut MJ. Spaceflight effects on T lymphocyte distribution, function and gene expression. J Appl Physiol. 2009 Jan;106(1):194-202. Das KK, Bajpai M, Kong Y, Liu J, Geng X, Das KM. Mesalamine suppresses the expression of TC22, a novel tropomyosin isoform Mol Pharmacol. 2009 Jul;76(1):183-91. * For a complete list of publications, please visit: www.SABiosciences.com/support_publication.php 24 Support@SABiosciences.com Figure: PIK3CA mRNA Expression in Multiple Lung Cancer Cell Lines. PIK3CA mRNA expression was compared among cell lines having different features, such as PIK3CA alterations or mutations of other genes involved in the EGFR signaling pathway. PIK3CA mRNA expression levels were expressed relative to the mean levels in six HBEC cell lines. PIK3CA mRNA expression in PIK3CA gain or EGFR mutant cell lines were significantly increased compared with that of wild-type cell lines. However, PIK3CA mutant lines do not express increased mRNA levels. Horizonatal bars indicate mean values. The Kruskal-Wallis test with Dunn’s multiple comparison test was used to determine significance. Yamamoto, H., et al. Cancer Research 2008; 68: 6913-6921. CELL CYCLE Chen S, Sims GP, Chen XX, Gu YY, Chen S, Lipsky PE. Modulatory effects of 1,25-dihydroxyvitamin D3 on human B cell differentiation. J Immunol. 2007 Aug 1;179(3):1634-47. Lu SY, Sontag DP, Detillieux KA, Cattini PA. FGF-16 is released from neonatal cardiac myocytes and alters growth-related signaling: a possible role in postnatal development. Am J Physiol Cell Physiol. 2008 May;294(5):C1242-9. Higgins S, Wong SH, Richner M, Rowe CL, Newgreen DF, Werther GA, Russo VC. Fibroblast growth factor 2 reactivates G1 checkpoint in SK-N-MC cells via Endocrinology. 2009 Sep;150(9):4044-55. CHEMOKINES & RECEPTORS Miselis NR, Wu ZJ, Van Rooijen N, Kane AB Targeting tumor-associated macrophages in an orthotopic murine model of diffuse malignant mesothelioma. Mol Cancer Ther. 2008 Apr;7(4):788-99. Lim J, Derrick SC, Kolibab K, Yang AL, Porcelli S, Jacobs WR, Morris SL. Early pulmonary cytokine and chemokine responses in mice immunized with three different vaccines against Mycobacterium tuberculosis determined by PCR array. Clin Vaccine Immunol. 2009 Jan;16(1):122-6. Fukami N, Ramachandran S, Saini D, Walter M, Chapman W, Patterson GA, Mohanakumar T. Antibodies to MHC class I induce autoimmunity: role in the pathogenesis of chronic rejection. J Immunol. 2009 Jan 1;182(1):309-18. Cheung KP, Yang E, Goldrath AW. Memory-like CD8+ T cells generated during homeostatic proliferation defer to J Immunol. 2009 Sep 1;183(5):3364-72. Sundararaj KP, Samuvel DJ, Li Y, Sanders JJ, Lopes-Virella MF, Huang Y. Interleukin-6 released from fibroblasts is essential for up-regulation of matrix J Biol Chem. 2009 May 15;284(20):13714-24.
  • 27. PUBLICATIONS: PCR ARRAYS COMMON CYTOKINES Silver RF, Walrath J, Lee H, Jacobson BA, Horton H, Bowman MR, Nocka K, Sypek JP. Human Alveolar Macrophage Gene Responses to Mycobacterium tuberculosis Strains H37Ra and H37Rv. Am J Respir Cell Mol Biol. 2008 Sep 11. Nacu N, Luzina IG, Highsmith K, Lockatell V, Pochetuhen K, Cooper ZA, Gillmeister MP, Todd NW, Atamas SP Macrophages produce TGF-beta-induced (beta-ig-h3) following ingestion of apoptotic cells and regulate MMP14 levels and collagen turnover in fibroblasts J Immunol. 2008 Apr 1;180(7):5036-44. Campeau PM, Rafei M, Boivin MN, Sun Y, Grabowski GA, Galipeau J. Characterization of Gaucher disease bone marrow mesenchymal stromal cells reveals Blood. 2009 Oct 8;114(15):3181-90. Shinoda Y, Ogata N, Higashikawa A, Manabe I, Shindo T, Yamada T, Kugimiya F, Ikeda T, Kawamura N, Kawasaki Y, Tsushima K, Takeda N, Nagai R, Hoshi K, Nakamura K, Chung UI, Kawaguchi H. Kruppel-like factor 5 causes cartilage degradation through transactivation of matrix metalloproteinase 9. J Biol Chem. 2008 Jul 10. Myskiw C, Arsenio J, van Bruggen R, Deschambault Y, Cao J. Vaccinia virus E3 suppresses expression of diverse cytokines through inhibition J Virol. 2009 Jul;83(13):6757-68. Lucio-Eterovic AK, Piao Y, de Groot JF. Mediators of glioblastoma resistance and invasion during antivascular endothelial Clin Cancer Res. 2009 Jul 15;15(14):4589-99. CUSTOM PCR ARRAYS Kuhn AR, Schlauch K, Lao R, Halayko AJ, Gerthoffer WT, Singer CA. MicroRNA Expression in Human Airway Smooth Muscle Cells: Role of miR-25 in Am J Respir Cell Mol Biol. 2009 Jun 18. Huang J, Chen K, Huang J, Gong W, Dunlop NM, Howard OM, Bian X, Gao Y, Wang JM. Regulation of the leucocyte chemoattractant receptor FPR in glioblastoma cells by cell differentiation. Carcinogenesis. 2009 Feb;30(2):348-55. ENDOTHELIAL CELL BIOLOGY Chahrour M, Jung SY, Shaw C, Zhou X, Wong ST, Qin J, Zoghbi HY. MeCP2, a Key Contributor to Neurological Disease, Activates and Represses Transcription Science. 2008 May 30;320(5880):1224-9. Peduto L, Dulauroy S, Lochner M, Spath GF, Morales MA, Cumano A, Eberl G. Inflammation recapitulates the ontogeny of lymphoid stromal cells. J Immunol. 2009 May 1;182(9):5789-99. Ianzini F, Kosmacek EA, Nelson ES, Napoli E, Erenpreisa J, Kalejs M, Mackey MA. Activation of meiosis-specific genes is associated with depolyploidization of Cancer Res. 2009 Mar 15;69(6):2296-304. Schreiber TH, Deyev VV, Rosenblatt JD, Podack ER. Tumor-induced suppression of CTL expansion and subjugation by gp96-Ig Cancer Res. 2009 Mar 1;69(5):2026-33. DiMeo TA, Anderson K, Phadke P, Fan C, Perou CM, Naber S, Kuperwasser C. A novel lung metastasis signature links Wnt signaling with cancer cell Cancer Res. 2009 Jul 1;69(13):5364-73. DNA DAMAGE Hoffman AE, Zheng T, Ba Y, Zhu Y. The circadian gene NPAS2, a putative tumor suppressor, is involved in DNA damage response. Mol Cancer Res. 2008 Sep;6(9):1461-8. Chesnokova V, Wong C, Zonis S, Gruszka A, Wawrowsky K, Ren SG, Benshlomo A, Yu R. Diminished pancreatic {beta} cell mass in securin-null mice is caused by {beta} cell apoptosis and senescence. Endocrinology. 2009 Feb 12. Li Z, Suzuki Y, Huang M, Cao F, Xie X, Connolly AJ, Yang PC, Wu JC Comparison of Reporter Gene and Iron Particle Labeling for Tracking Fate of Human Embryonic Stem Cells and Differentiated Endothelial Cells in Living Subjects. Stem Cells. 2008 Apr;26(4):864-73. Asada S, Takahashi T, Isodono K, Adachi A, Imoto H, Ogata T, Ueyama T, Matsubara H, Oh H. Downregulation of Dicer expression by serum withdrawal sensitizes human endothelial cells to apoptosis. Am J Physiol Heart Circ Physiol. 2008 Dec;295(6):H2512-21. GROWTH FACTORS Stirling DP, Liu S, Kubes P, Yong VW Depletion of Ly6G/Gr-1 leukocytes after spinal cord injury in mice alters wound healing and worsens neurological outcome. J Neurosci. 2009 Jan 21;29(3):753-64. HYPOXIA SIGNALING Wendler CC, Amatya S, McClaskey C, Ghatpande S, Fredholm BB, Rivkees SA. A1 adenosine receptors play an essential role in protecting the embryo against hypoxia. Proc Natl Acad Sci U S A. 2007 Jun 5;104(23):9697-702. Mueller BR, Bale TL. Sex-specific programming of offspring emotionality after stress early in pregnancy. J Neurosci. 2008 Sep 3;28(36):9055-65. APPLICATION: INFLAMMATORY CYTOKINES & RECEPTORS Santisteban M, Reiman JM, Asiedu MK, Behrens MD, Nassar A, Kalli KR, Haluska P, Ingle JN, Hartmann LC, Manjili MH, Radisky DC, Ferrone S, Knutson KL. Immune-induced epithelial to mesenchymal transition in vivo generates breast Cancer Res. 2009 Apr 1;69(7):2887-95. DRUG METABOLISM: PHASE I ENZYMES Ning B, Dial S, Sun Y, Wang J, Yang J, Guo L Systematic and simultaneous gene profiling of 84 drug-metabolizing genes in primary human hepatocytes J Biomol Screen. 2008 Mar;13(3):194-201. EXTRACELLULAR MATRIX & ADHESION MOLECULES Johansen LD, Naumanen T, Knudsen A, Westerlund N, Gromova I, Junttila M, Nielsen C, Bottzauw T, Tolkovsky A, Westermarck J, Coffey ET, Jaattela M, Kallunki T. IKAP localizes to membrane ruffles with filamin A and regulates actin cytoskeleton organization and cell migration. J Cell Sci. 2008 Mar 15;121(Pt 6):854-64. Figure: Lineage-dependent Differences in Expression of Treg Functional Genes. Quantitative PCR analysis of selected genes related to Treg function in CD4+CD25+ cells from Mossi, Fulani, and European donors infected with Plasmodium falciparum (malaria). CD4+CD25+ cells were isolated from 12 Mossi (red bars) and 12 Fulani (blue bars) donors included in the study and 10 European donors (gray bars), and lysed to obtain total RNA. Equal amounts of RNA (50 ng) from each donor were reverse-transscribed and amplified in duplicate in RT2 Custom PCR Arrays to simultaneously examine the mRNA levels of nine selected genes related to Treg activity using PPIA, GAPDH, and ACTB as housekeeping genes (HKG). Data was normalized to the mean values of the HKG, and a relative amount of RNA was calculated using the 2-∆C method. t Torcia MG, Santarlasci V,. et al. Proc Natl Acad Sci U S A. 2008 Jan 15;105:646-651. www.SABiosciences.com 25