1. DNA Structure 1950s – James Watson & Francis Crick use molecular modeling to determine that DNA is a double helix

2. DNA Structure Each strand of DNA is made of linked nucleotides Each nucleotide contains: a phosphate group a five-carbon sugar (deoxyribose) a nitrogen- containing base

3. Nitrogen-containing Bases Adenine Guanine Thymine Cytosine Purines (double ring) Pyrimidines (single ring)

5. What would happen if G paired up with A on the double helix? Lumpy DNA! The G and A are larger than the T and C because they are both double ring structures. A purine and a pyrimidine bond to one another for a uniform connection between the two strands of DNA.

6. What is the complement to the sequence below: ATTCGCTAATATATACCGCCG TAAGCGATTATATATGGCGGC

7. DNA Replication One strand serves as a template, or pattern, on which the other strand is built