“Desarrollo de paneles de SNPs       autosómicos y estudio de su      aplicación con fines forenses”                      ...
Introducción
INTRODUCCIÓN
INTRODUCCIÓN                                 Situación actual de la genética forenseResistencia a degradación             ...
INTRODUCCIÓN                  Los “Short Tandem Repeats”                              STRs     ADN Repetitivo Microsatélit...
INTRODUCCIÓN                 Los “Short Tandem Repeats”                             STRsProbabilidad de coincidencia al az...
INTRODUCCIÓN                Desventajas de los STRsSLIPAGE DE LA POLIMERASA                              * Tasa de mutació...
INTRODUCCIÓN Necesidad de ampliar la batería de marcadores• Metodologías de alto rendimiento para:        Bases de datos d...
INTRODUCCIÓN          SNPs: Single Nucleotide Polymorphisms               + Coexistencia de dos o más posibilidades       ...
INTRODUCCIÓN         P. Gill (2005)Para obtener una probabilidad de exclusión del 99.9%se necesitarían 50 SNPs con frecuen...
INTRODUCCIÓN                 SNPs: Single Nucleotide Polimorphism• Es la variación mas frecuente en el genoma humano• Pres...
OBJETIVOS DEL TRABAJO               • SELECCIÓN DE BATERÍAS DE SNPsDESARROLLO               • OPTIMIZACIÓN DE LOS MULTIPLE...
INTRODUCCIÓNUTILIDADES DE LOS SNPs EN GENÉTICA FORENSE           * ADN severamente degradado           * Predicción de ori...
INTRODUCCIÓNUTILIDADES DE LOS SNPs EN GENÉTICA FORENSE           * ADN severamente degradado           * Predicción de ori...
INTRODUCCIÓN                 ADN severamente degradadoTras la muerte actúan sobre el ADN una serie de proceso acumulativos...
INTRODUCCIÓN                     ADN severamente degradado* Cuanto mayor es el fragmento de ADN, menores son las probabili...
INTRODUCCIÓNUTILIDADES DE LOS SNPs EN GENÉTICA FORENSE           * ADN severamente degradado           * Predicción de ori...
INTRODUCCIÓNDeterminación de origen geográfico y poblacional
INTRODUCCIÓN               DIÁSPORA ANCESTRAL DE LA                      HUMANIDAD
INTRODUCCIÓN               Fuerzas evolutivas                            La migración: como un factor                     ...
INTRODUCCIÓN
INTRODUCCIÓNUTILIDADES DE LOS SNPs EN GENÉTICA FORENSE           * ADN severamente degradado           * Predicción de ori...
INTRODUCCIÓN           Casos de parentesco complejosLos individuos emparentados tienen una alta probabilidad de que superf...
INTRODUCCIÓN        Distribución de SNPs en el genoma• Amplia distribución de marcadores en el genoma• Mayor número de mar...
Resultados y Discusión
RESULTADOS    Y DISCUSIÓN                  RESULTADOS Y DISCUSIÓNBloque 1: Método, selección y optimización del tipadoBloq...
RESULTADOS  Y DISCUSIÓN               Bloque 1:       Método, selección y optimización del tipadoSe ha desarrollado y opti...
RESULTADOS      Y DISCUSIÓN                    Bloque 1:                          Selección de SNPs                       ...
RESULTADOSY DISCUSIÓN               Bloque 1:        Selección de SNPs para identificación humana                 Human Id...
RESULTADOSY DISCUSIÓN             Bloque 1:       Selección de SNPs: Frecuencia alélica mínimaLa informatividad esperada n...
RESULTADOS     Y DISCUSIÓN              Bloque 1:              Validación de la selección de SNPs del multiplex• Se ha rea...
RESULTADOSY DISCUSIÓN              Bloque 1: Validación del Human specific 52plex: Frecuencias observadas    • Las frecuen...
RESULTADOS     Y DISCUSIÓN                 Bloque 1:                   Tecnología SNaPshot: El método de tipadoReproducibi...
RESULTADOS   Y DISCUSIÓN   Bloque 1:Original                             Concentración                                  20...
RESULTADOS  Y DISCUSIÓN              Bloque 1:                Desventajas del método de SNaPshotDerivan de la detección me...
RESULTADOS    Y DISCUSIÓN                  Bloque 1:                  El método de Genplex: Estrategia alternativaAnálisis...
RESULTADOS    Y DISCUSIÓN              Bloque 1:                  GENPLEX: Análisis de mezclas• ADN extraído de toma de mu...
RESULTADOSY DISCUSIÓN          Bloque 1:      Método, selección y optimización del tipado
RESULTADOS  Y DISCUSIÓN          Bloque 2:Aplicación de los SNPs a casos de ADN        severamente degradado              ...
RESULTADOSY DISCUSIÓN    Bloque 2: SNPs versus STRs                Métodos de STRs utilizados PowerPlex16 system          ...
RESULTADOS   Y DISCUSIÓN     Bloque 2: SNPs versus STRs    Métodos de SNPs utilizadosHuman identification 52plex* 52plex P...
RESULTADOS    Y DISCUSIÓN    Bloque 2: SNPs versus STRs                     SELECCIÓN DE MUESTRAS* 15 muestras analizadas:...
RESULTADOS      Y DISCUSIÓN       Bloque 2: SNPs versus STRs                                                              ...
RESULTADOS         Y DISCUSIÓN            Bloque 2: SNPs versus STRsRESULTADOS DE CUANTIFICACIÓN * Valores de IPC mayores ...
RESULTADOS  Y DISCUSIÓN   Bloque 2: SNPs versus STRs                                                 uncorrected ordered b...
RESULTADOSY DISCUSIÓN                     Bloque 2: SNPs versus STRs                                     uncorrected order...
RESULTADOSY DISCUSIÓN           Bloque 2: SNPs versus STRs                                                                ...
RESULTADOS Y DISCUSIÓN   Bloque 2: SNPs versus STRs                          DEGRADACIÓN EXTREMA                         7...
Identifiler   Powerplex 1670-06         Identifiler   Powerplex 1678P-03
Reduced amplicon STRs      SNPs                     Mini-Filer               Auto 1                   Success 50%         ...
RESULTADOS         Y DISCUSIÓN   Bloque 2: SNPs versus STRs                       RESOLUCIÓN DE LOS CASOS                 ...
RESULTADOS      Y DISCUSIÓN              Bloque 3: Origen Poblacional          PREDICCIÓN DE ORIGEN GEOGRÁFICO Y POBLACION...
RESULTADOS       Y DISCUSIÓN     Bloque 3: Origen Poblacional                     SNPs INCLUIDOS EN EL MULTIPLEX    Búsque...
RESULTADOS   Y DISCUSIÓN   Bloque 3: Origen Poblacional                      Pool de SNPs seleccionadosMultiplex optimizad...
RESULTADOS        Y DISCUSIÓN           Bloque 3: Origen Poblacional       GENOTIPADO DE MUESTRAS POBLACIONALES: VALIDACIÓ...
RESULTADOSY DISCUSIÓN     Bloque 3: Origen Poblacional              Utilidad matemática: Resultado de salida              ...
RESULTADOSY DISCUSIÓN     Bloque 3: Origen Poblacional              Utilidad matemática: Resultado de salida              ...
RESULTADOS     Y DISCUSIÓN   Bloque 3: Origen PoblacionalClasificación en poblaciones con mestizaje: Posible fuente de err...
RESULTADOS     Y DISCUSIÓN        Bloque 3: Origen Poblacional     Problemas cuando se analizan poblaciones similares     ...
RESULTADOS     Y DISCUSIÓN   Bloque 3: Origen Poblacional      Población mestiza: Genotipado de población Afro-      ameri...
RESULTADOSY DISCUSIÓN   Bloque 3: Origen Poblacional                               34plex: Aplicación real                ...
RESULTADOSY DISCUSIÓN   Bloque 3: Origen Poblacional
RESULTADOS    Y DISCUSIÓN   Bloque 3: Origen Poblacional                            3 muestras clasifican como norte-afric...
RESULTADOS   Y DISCUSIÓN   Bloque 4: Parentesco ComplejoBloque 4: Casos de parentesco complejos     Los SNPs autosómicos, ...
RESULTADOS Y DISCUSIÓN      Bloque 4: Parentesco Complejo        Un número creciente de casos de aplicación exitosa       ...
Conclusiones
CONCLUSIONES          Conclusiones BLOQUE 1:               1.-Sobre la adaptación forense del tipado de SNPsLa reproducibi...
CONCLUSIONES          Conclusiones BLOQUE 1:          1.3. - Sobre la tecnología Genplex como sucesora al SNaPshot.-      ...
CONCLUSIONES          Conclusiones BLOQUE 2:            2.- El uso de SNPs en muestras altamente degradadas.La posibilidad...
CONCLUSIONES          Conclusiones BLOQUE 2:2.2.- Sobre el efecto de la fragmentación del ADN en la PCR de muestras      d...
CONCLUSIONES          Conclusiones BLOQUE 3:3.- La aplicación del tipado de SNPs a la predicción de origen geográficoLos i...
CONCLUSIONES        Conclusiones BLOQUE 4:       4.- La resolución de casos complejos mediante el uso de SNPsHabida cuenta...
AGRADECIMIENTOS“Generally, I dislike fixedness in both long swords and hands. Fixednessmeans a dead hand. Pliability is a ...
Presentacion tesis blanco ver10
Próxima SlideShare
Cargando en…5
×

Presentacion tesis blanco ver10

468 visualizaciones

Publicado el

Publicado en: Tecnología
0 comentarios
0 recomendaciones
Estadísticas
Notas
  • Sé el primero en comentar

  • Sé el primero en recomendar esto

Sin descargas
Visualizaciones
Visualizaciones totales
468
En SlideShare
0
De insertados
0
Número de insertados
2
Acciones
Compartido
0
Descargas
3
Comentarios
0
Recomendaciones
0
Insertados 0
No insertados

No hay notas en la diapositiva.

Presentacion tesis blanco ver10

  1. 1. “Desarrollo de paneles de SNPs autosómicos y estudio de su aplicación con fines forenses” INSTITUTO DE MEDICINA LEGALManuel Fondevila Álvarez Facultade de Medicina
  2. 2. Introducción
  3. 3. INTRODUCCIÓN
  4. 4. INTRODUCCIÓN Situación actual de la genética forenseResistencia a degradación * ADN MITOCONDRIAL MUTACIONES EN LA REGION CONTROL SNPs EN EL RESTO DE LA MOLECULA * ADN NUCLEAR: STRs y SPNs del Cromosoma y * ADN NUCLEAR: STRs y SNPs del cromosoma X * ADN NUCLEAR: STRs AUTOSÓMICOS Informatividad
  5. 5. INTRODUCCIÓN Los “Short Tandem Repeats” STRs ADN Repetitivo Microsatélite Secuencias repetidas en tándem Unidades de repetición: entre 2-7 bpATTACTGATCGGTAGCTGAGCCAATGGCAGTGATGGGATA GATA GATA GATA GATA GATA GATA GATAATGGTAGCTGAGTGCTGGACAT
  6. 6. INTRODUCCIÓN Los “Short Tandem Repeats” STRsProbabilidad de coincidencia al azar:~1 in 3 trillones con 15 STRs Resultado obtenido en 5 horas con una muestra de sangre del tamaño de la cabeza de un alfiler
  7. 7. INTRODUCCIÓN Desventajas de los STRsSLIPAGE DE LA POLIMERASA * Tasa de mutación de hasta 1x10-3DEGRADACIÓN DE LA MUESTRA * Longitud de amplicón elevada * En condiciones de ADN degradado el ADN de alto peso molecular es eliminado de la muestra.
  8. 8. INTRODUCCIÓN Necesidad de ampliar la batería de marcadores• Metodologías de alto rendimiento para: Bases de datos de ADN (1 millón de perfiles por año) Necesidad de grandes estudios de mt-ADN/ cromosoma Y Automatización-Miniaturización• Mayor sensibilidad• Mayor información (origen geográfico)• Características físicas• Análisis de ADN degradado
  9. 9. INTRODUCCIÓN SNPs: Single Nucleotide Polymorphisms + Coexistencia de dos o más posibilidades nucleotídicas en un locus determinado del genoma. + Limitado uso en genética forense - Estrategia de tipado mas compleja que en STRs - Menor informatividad individual con respecto a los STRs
  10. 10. INTRODUCCIÓN P. Gill (2005)Para obtener una probabilidad de exclusión del 99.9%se necesitarían 50 SNPs con frecuencias de entre0.5-0.5 y 0.2-0.8 respectivamente
  11. 11. INTRODUCCIÓN SNPs: Single Nucleotide Polimorphism• Es la variación mas frecuente en el genoma humano• Presentan una tasa de mutación baja (Mutation rate 10-9)• Son marcadores facilmente amplificables en multiplex• Se analizan facilmente con técnicas de alto rendimiento• Tamaño de amplicón reducible al mínimo G ATTACTGATCGGTAGCTGAG CCAATGGCAGTGATGG T .
  12. 12. OBJETIVOS DEL TRABAJO • SELECCIÓN DE BATERÍAS DE SNPsDESARROLLO • OPTIMIZACIÓN DE LOS MULTIPLEXESDEMULTIPLEXES • VALIDACIÓN DE LOS MULTIPLEXES • VALIDACIÓN DE LA TECNOLOGÍA DE TIPADO • APLICACIÓN A MUESTRAS DEGRADADASVIABILIDAD DELOS • APLICACIÓN A PREDICCIÓN DE ORIGEN POBLACIONALMULTIPLEXES • APLICACIÓN A CASOS DE PARENTESCO COMPLEJOS
  13. 13. INTRODUCCIÓNUTILIDADES DE LOS SNPs EN GENÉTICA FORENSE * ADN severamente degradado * Predicción de origen poblacional * Casos de parentesco complejos
  14. 14. INTRODUCCIÓNUTILIDADES DE LOS SNPs EN GENÉTICA FORENSE * ADN severamente degradado * Predicción de origen poblacional * Casos de parentesco complejos
  15. 15. INTRODUCCIÓN ADN severamente degradadoTras la muerte actúan sobre el ADN una serie de proceso acumulativosque conducen a la degradación de la molécula:* Fragmentación enzimática aleatoria* Daño oxidativo* Acumulación de sustancias inhibidoras
  16. 16. INTRODUCCIÓN ADN severamente degradado* Cuanto mayor es el fragmento de ADN, menores son las probabilidades deencontrarlo íntegro y útil* Las reacciones de PCR de amplicón reducido, aumentan la posibilidad dehallar los fragmentos de interés intactos SNP 1 SNP 2 SNP 3 SNP 4 SNP 5 SNP 6 SNP 7
  17. 17. INTRODUCCIÓNUTILIDADES DE LOS SNPs EN GENÉTICA FORENSE * ADN severamente degradado * Predicción de origen poblacional * Casos de parentesco complejos
  18. 18. INTRODUCCIÓNDeterminación de origen geográfico y poblacional
  19. 19. INTRODUCCIÓN DIÁSPORA ANCESTRAL DE LA HUMANIDAD
  20. 20. INTRODUCCIÓN Fuerzas evolutivas La migración: como un factor homogenizador, introduciendo cambios antes inexistentes, o aumentando su frecuencia. La deriva génica se debe al emparejamiento al azar en la población. En general actuará aumentando la varianza entre grupos y disminuyendo la varianza intragrupal. La mutación ocurre con una determinada probabilidad en cada posición, de forma que es muy probable que aparezca un cambio en una población y no en otras.
  21. 21. INTRODUCCIÓN
  22. 22. INTRODUCCIÓNUTILIDADES DE LOS SNPs EN GENÉTICA FORENSE * ADN severamente degradado * Predicción de origen poblacional * Casos de parentesco complejos
  23. 23. INTRODUCCIÓN Casos de parentesco complejosLos individuos emparentados tienen una alta probabilidad de que superfil presente identidad por descendencia Tendencia a aumentar la resolución con mas marcadores Mayor número de reacciones Riesgo de Riesgo de contaminación error humano Excesivo gasto de muestra
  24. 24. INTRODUCCIÓN Distribución de SNPs en el genoma• Amplia distribución de marcadores en el genoma• Mayor número de marcadores en una única reacción• Mayor posibilidad de captar diferente pauta de recombinación
  25. 25. Resultados y Discusión
  26. 26. RESULTADOS Y DISCUSIÓN RESULTADOS Y DISCUSIÓNBloque 1: Método, selección y optimización del tipadoBloque 2: Aplicación a casos de ADN degradadoBloque 3: Aplicación a predicción de origen poblacionalBloque 4: Aplicación a casos de parentesco complejos
  27. 27. RESULTADOS Y DISCUSIÓN Bloque 1: Método, selección y optimización del tipadoSe ha desarrollado y optimizado con éxito el tipado multiplex dedos ensayos de SNPs Human Identification 52plex Population Specific 34plexPCR 52plex o 23plex-Auto1 & 29plex-Auto2 PCR 34plex Tipado 23plex & 29plex Tipado 34plex Auto1-23plex Auto2-29plex Pop.Spec.34plex
  28. 28. RESULTADOS Y DISCUSIÓN Bloque 1: Selección de SNPs Uso de bases de datos on-line Calidad de secuencia flanqueante African Asian European 0.92 - 0.08 - 0.45 - 0.55 0.90 - 0.10 0.50 - 0.50 0.50 - 0.50 0.91 - 0.09 0.59 - 0.41 0.79 - 0.21 0.92 - 0.08 0.92 - 0.09 0.57 - 0.43 Selección de marcadores bien Adecuada distribución de espaciados en el genomaAusencia de amplificación frecuencias inespecífica
  29. 29. RESULTADOSY DISCUSIÓN Bloque 1: Selección de SNPs para identificación humana Human Identification 52plex • Frecuencia del alelo mínimo al menos 0.3 en un grupo poblacional • Frecuencia del alelo 0.2, en máximo 2 de los grandes grupos • Posibilidad de diseño de amplicón menor de 120bp • Baja interacción entre primers
  30. 30. RESULTADOSY DISCUSIÓN Bloque 1: Selección de SNPs: Frecuencia alélica mínimaLa informatividad esperada no cae significativamente hasta valoresde 0.3
  31. 31. RESULTADOS Y DISCUSIÓN Bloque 1: Validación de la selección de SNPs del multiplex• Se ha realizado un tipado masivo de muestras de poblaciones de distribución mundial• Los datos de número creciente de nuevas poblaciones, se añaden a una base de datos on-line www.snpforid.org SNPforID frequency browser
  32. 32. RESULTADOSY DISCUSIÓN Bloque 1: Validación del Human specific 52plex: Frecuencias observadas • Las frecuencias observadas coinciden con las esperadas • Alta informatividad en los tres grandes grupos • La informatividad decrece ligeramente en población Africana
  33. 33. RESULTADOS Y DISCUSIÓN Bloque 1: Tecnología SNaPshot: El método de tipadoReproducibilidad La tecnología SNaPshot cumpleExactitud con estos requerimientosSensibilidad necesarios para la adecuación forense del métodoAdaptación a ensayos multiplex
  34. 34. RESULTADOS Y DISCUSIÓN Bloque 1:Original Concentración 20ngDilución1:8 Dilución 1:32Dilución1:132 50pg
  35. 35. RESULTADOS Y DISCUSIÓN Bloque 1: Desventajas del método de SNaPshotDerivan de la detección mediante marcaje fluorescente diferente paracada base • El desequilibrio entre señales de los heterocigotos (1) • Y la pérdida alélica (2) presentan mayor dificultad • La aparición de bandas inespecíficas (3) tiene solución
  36. 36. RESULTADOS Y DISCUSIÓN Bloque 1: El método de Genplex: Estrategia alternativaAnálisis por clusters de datos El método de Genplex añadealtamente reproducibles. estas ventajas a lasLectura en la misma longitud características ya mostradasde onda de ambos alelos. por el SNaPshotMayor constancia de la ratio deseñal en los picos deheterocigotos
  37. 37. RESULTADOS Y DISCUSIÓN Bloque 1: GENPLEX: Análisis de mezclas• ADN extraído de toma de muestra postcoital• Diferentes tiempos de toma de muestra tras el coito• Comparación con los perfiles individuales de los sujetos
  38. 38. RESULTADOSY DISCUSIÓN Bloque 1: Método, selección y optimización del tipado
  39. 39. RESULTADOS Y DISCUSIÓN Bloque 2:Aplicación de los SNPs a casos de ADN severamente degradado * Se ha realizado un estudio comparativo de los métodos de análisis disponibles, mediante el tipado de una colección de restos óseos. * Centrando parte de la atención en la resolución de casos de ADN extremadamente degradado, en los que solo el genotipado de SNPs autosómicos dio resultado.
  40. 40. RESULTADOSY DISCUSIÓN Bloque 2: SNPs versus STRs Métodos de STRs utilizados PowerPlex16 system AmpFlSTR Identifiler AmpFlSTR Minifiler NIST’s MiniNC01
  41. 41. RESULTADOS Y DISCUSIÓN Bloque 2: SNPs versus STRs Métodos de SNPs utilizadosHuman identification 52plex* 52plex PCR* Dos reaciones de extensión en tandem: Auto1 (23 SNPs) Auto2 (29 SNPs)* Posibilidad de usar dos PCR inicialesseparadas Auto1&Auto2 – Mejora losresultadosPopulation Specific 34plex* 34plex PCR* 34plex reacción de minisecuenciación
  42. 42. RESULTADOS Y DISCUSIÓN Bloque 2: SNPs versus STRs SELECCIÓN DE MUESTRAS* 15 muestras analizadas: 6 juegos de dientes y 9 fémures.* Se analizaron parientes vivos.* Todas la muestras eran de origen caucásico, de procedencia del nordestede la península ibérica.* Las condiciones climáticas de este área se caracterizan por precipitacionesfrecuentes durante todo el año, temperatura suave y suelos ricos en materiaorgánica y de pH ácido.
  43. 43. RESULTADOS Y DISCUSIÓN Bloque 2: SNPs versus STRs Extracción de ADN * Método 1: Extracción por el método de Fenol-Cloroformo Purificación con Millipore Centricon * Método 2: Lalueza-Fox C et al. (2000) Modificación para ADN antiguo por Nuria NaveránMétodo de cuantificación:Applied Biosystems’ Quantifiler Human DNA quantification kit
  44. 44. RESULTADOS Y DISCUSIÓN Bloque 2: SNPs versus STRsRESULTADOS DE CUANTIFICACIÓN * Valores de IPC mayores de 28 indican la Internal Cycle Concent presencia de inhibidores. PCR Muestra threshold ración control * Un resultado indeterminado generalmente IPC Ct (ng/ul) significa una concentración desconocida pero 70-06 Undet 37 0.04 elevada de inhibidores. 78p03 Undet 36.45 0.533 * los inhibidores pueden afectar a la 71p04 28.03 29.1 0.666 cuantificación. 126p04 28.43 28.45 1.03 122p04 Undet 25.79 5.88 * En casos de ADN degradado, una alta 23p04 27.73 33.63 0.034 concetración no implica presencia de ADN de alto peso molecular . 72p03 31.69 29.26 0.599 60 77p04 28.56 28.64 0.902 50 50p04 27.76 31.75 0.117 40 12p05 28 31.31 0.156 IPC cycle 45p04 28.12 28.99 0.717 30 Ct Qty 24p05 28.3 28.51 0.981 20 11p05 35.55 26.85 2.93 10 105-05 35.15 25.21 8.63 0 5p04 35.49 23.97 19.51 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 sample
  45. 45. RESULTADOS Y DISCUSIÓN Bloque 2: SNPs versus STRs uncorrected ordered by Powerplex/QtyRESULTADOS DEL TIPADO 120 100 powerplex identifiler 80 % success auto1 60 auto2 34plex 40 NC01 20 Minifiler 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 sample ordered by powerplex/Qty 120 100 powerplex identifiler 80 % success auto1 60 auto2 34plex 40 NC01 20 minifiler 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 sample
  46. 46. RESULTADOSY DISCUSIÓN Bloque 2: SNPs versus STRs uncorrected ordered by Powerplex/Qty 120 100 powerplex identifiler 80 % success auto1 60 auto2 34plex 40 NC01 20 Minifiler 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 sample* Los sistemas de amplicón largo parecen ser afectados con unamayor agresividad por la inhibición.* Los SNPs muestran una elevada resistencia a la inhibición.* Una mayor concentración de ADN diana, polimerización más corta,y secuencias flanqueantes no repetitivas pueden ser lasexplicaciones mas plausibles para este fenómeno.
  47. 47. RESULTADOSY DISCUSIÓN Bloque 2: SNPs versus STRs Inhibición Sin inhibición Powerplex Identifiler Minifiler Auto1 34plex Auto2 NC01 * tasa media de éxito antes y después de aplicar las medidas contra la inhibición. * Los resultados corregidos muestran una tendencia, cuanto mayor el amplicón, mayores las posibilidades de fallo.
  48. 48. RESULTADOS Y DISCUSIÓN Bloque 2: SNPs versus STRs DEGRADACIÓN EXTREMA 70-06 • 10 años enterrado en un bosque • Descubierto tras un incendio forestal • Restos calcinados 78p03 • 35 Años de degradación • Ambiente de degradación agresivo • Abundante crecimiento de mohos • Epífisis ausentes y tejido pulverulento Se aplicaron ambos métodos de extracción a estas piezas.70-06 78p03
  49. 49. Identifiler Powerplex 1670-06 Identifiler Powerplex 1678P-03
  50. 50. Reduced amplicon STRs SNPs Mini-Filer Auto 1 Success 50% Success 100% NC01:3 STRs Auto 2 success 100% Success 100%70-06 Mini-Filer Auto 1 Success 30% Success 100% NC01:3 STRs Auto 2 success 100% Success 100%78P-03
  51. 51. RESULTADOS Y DISCUSIÓN Bloque 2: SNPs versus STRs RESOLUCIÓN DE LOS CASOS STRs +SNPs 19años 9/17 52/52 P: 98.28 99.998320p07 10años 0/17 52/52 P: - 99.993 70p06 4/8 MiniFiler 3/3 Mini-NC01 1/6 Mini-SGM
  52. 52. RESULTADOS Y DISCUSIÓN Bloque 3: Origen Poblacional PREDICCIÓN DE ORIGEN GEOGRÁFICO Y POBLACIONALEnviado a PloS-One, in press
  53. 53. RESULTADOS Y DISCUSIÓN Bloque 3: Origen Poblacional SNPs INCLUIDOS EN EL MULTIPLEX Búsqueda en bases de datos on-line 34 SNPs Frecuencias alélicas• SNPs específicos de población 14• AIMs 15• SNPs no binarios 2• SNPs fijados 3 Selección en base a: •La adecuada distribución de frecuencias interpoblacionales • Calidad de secuencia flanqueante
  54. 54. RESULTADOS Y DISCUSIÓN Bloque 3: Origen Poblacional Pool de SNPs seleccionadosMultiplex optimizado Utilidad matématica on-lineoperativo en ADN degradado para el cálculo estadístico
  55. 55. RESULTADOS Y DISCUSIÓN Bloque 3: Origen Poblacional GENOTIPADO DE MUESTRAS POBLACIONALES: VALIDACIÓN• El 34plex distingue Europeos/africanos/asiáticos• Clasifica con un error Cercano a 0• Se puede asociar con SNPs para identificación• Alta sensibilidad y robustez• Conocimiento preciso de un mayor número de poblacionesMuestras analizadas.- 34SNP plex SET INICIAL BOOTSTRAPPING SET DE CHEQUEO Mozambique Muestreo CEPH PANEL Somalia sintètico Galicia Dinamarca China Taiwan120 muestras 1000X1000 1048 muestrasde cada grupo
  56. 56. RESULTADOSY DISCUSIÓN Bloque 3: Origen Poblacional Utilidad matemática: Resultado de salida Pigmeos (Blaka) – perfil completo Incluso los pigmeos que no forman parte de los grupos conocidos se clasifican sin error como africanos
  57. 57. RESULTADOSY DISCUSIÓN Bloque 3: Origen Poblacional Utilidad matemática: Resultado de salida Mozambiqueño: 14 SNPs, 18 gaps Aún con 18 gaps si tenemos una muestra de un africano la clasificación es correcta (con error 0)
  58. 58. RESULTADOS Y DISCUSIÓN Bloque 3: Origen PoblacionalClasificación en poblaciones con mestizaje: Posible fuente de error Africa Cerdeña Europa Asia Europeo (Cerdeña) – perfil completo La población Sarda se clasifica correctamente pero con una LR mas baja. Esto sugiere la influencia de la emigración norte africana a Cerdeña
  59. 59. RESULTADOS Y DISCUSIÓN Bloque 3: Origen Poblacional Problemas cuando se analizan poblaciones similares Africanos Africanos Este Asia (Chinos) Europeos Sur Asia (Bengalíes)Europeos Asiáticos 2 poblaciones similares pueden erosionar la clasificación
  60. 60. RESULTADOS Y DISCUSIÓN Bloque 3: Origen Poblacional Población mestiza: Genotipado de población Afro- americana•El tipado de muestras de población afro-americana revela que para esta población mestiza, la predicción sigue siendo fiable en un altísimo número de casos• Solo tres individuos clasifican como europeos• La historia sociopolítica de estas poblaciones y la auto-designación del origen étnico dificultan la correcta valoración de estos resultados
  61. 61. RESULTADOSY DISCUSIÓN Bloque 3: Origen Poblacional 34plex: Aplicación real Enviado a PloS-One, in press •7 perfiles de STRs no se corresponden con los sospechosos • Pregunta.- Son norte-Africanos o Europeos? - Poblaciones geográficamente próximas - Historia reciente común - Cierto grado de mestizaje con población sub-sahariana
  62. 62. RESULTADOSY DISCUSIÓN Bloque 3: Origen Poblacional
  63. 63. RESULTADOS Y DISCUSIÓN Bloque 3: Origen Poblacional 3 muestras clasifican como norte-africanas RESULTADO DE 1 clasifica como europea LA PRUEBA 3 no dan una estima con suficiente confianzaEl test y su aplicación matemática, ofrecen para eltrabajo de rutina forense un sistema de clasificaciónefectivo
  64. 64. RESULTADOS Y DISCUSIÓN Bloque 4: Parentesco ComplejoBloque 4: Casos de parentesco complejos Los SNPs autosómicos, ofrecen una serie de ventajas que explican su mayor efectividad en este campo: • Reducida tasa de mutación • Posiciones genómicas bien espaciadas en el genoma • Resistencia a la degradación
  65. 65. RESULTADOS Y DISCUSIÓN Bloque 4: Parentesco Complejo Un número creciente de casos de aplicación exitosa STRs +SNPs39p04 21/21 52/52 P: 99.799 99.99451p08 STRs +SNPs 21/21 52/52 P: 98.3 99.98Debido a los casos resueltos con éxito gracias a la incorporación de SNPsautosómicos, se puede asegurar que su adición constituye una soluciónadecuada para este tipo de casos.
  66. 66. Conclusiones
  67. 67. CONCLUSIONES Conclusiones BLOQUE 1: 1.-Sobre la adaptación forense del tipado de SNPsLa reproducibilidad, exactitud, robustez, la sensibilidad y la informatividad nos permitenllegar a la conclusión de que la adecuación del tipado de SNPs al trabajo forense quedaprobada. 1.1.- Sobre la selección de los marcadores.- * El grado de información suministrada por los dos multiplexes de SNPs permite realizar con la suficiente confianza el cálculo probabilístico aún con los exigentes requerimientos del trabajo forense. 1.2.- Sobre el método de SNaPshot en casuística forense.- * El estudio demuestra que es posible y operativo el diseño de reacciones multiplex de alto rango (mas de 50 SNPs) para muestras forenses. * La sensibilidad del método de SNaPshot y su robustez quedan demostradas * La existencia de una serie de desventajas inherentes a la técnica de SNaPshot nos llevan a concluir que su substitución por otra alternativa, como el Genplex, podría ser beneficiosa.
  68. 68. CONCLUSIONES Conclusiones BLOQUE 1: 1.3. - Sobre la tecnología Genplex como sucesora al SNaPshot.- * Este método de análisis presenta una enorme reproducibilidad, lo quepermite la comparación de múltiples grupos de datos, incluso entre diferenteslaboratorios. * El método Genplex es robusto y exacto permitiendo el correcto tipado demuestras problemáticas aunque muestren relaciones de intensidad de señal inusuales * El método de Genplex permite una mejor valoración de perfiles de mezclasbiológicas ya que presenta un elevado grado de exactitud, y una relación correctaentre intensidad de señal y cantidad de producto * Sin embargo este método aún no se encuentra lo suficientemente optimizadopara ofrecer una alternativa al SNaPshot en la rutina forense.
  69. 69. CONCLUSIONES Conclusiones BLOQUE 2: 2.- El uso de SNPs en muestras altamente degradadas.La posibilidad de diseño de reacciones de PCR multiplex de amplicón corto hace suponerque el tipado de SNPs presentará una mayor tasa de éxito, en relación al tipado de STRs,en muestras de ADN altamente degradado 2.1.- Sobre el efecto de las sustancias inhibidoras de la PCR en muestras degradadas.- * La presencia de inhibidores en el extracto juega un papel crítico en la dificultad del trabajo con muestras degradadas, y debe ser contemplado incluso por encima de la degradación enzimática * El tipado de SNPs muestra una clara capacidad para soportar los efectos inhibitorios en la PCR. La mayor concentración inicial de ADN blanco sin degradar es laexplicación más probable para esta observación * La inhibición de la reacción de la PCR puede ser limitada a través de la correcta preparación de la muestras y de la elección adecuada del método de extracción.
  70. 70. CONCLUSIONES Conclusiones BLOQUE 2:2.2.- Sobre el efecto de la fragmentación del ADN en la PCR de muestras degradadas* Dependiendo del estado de degradación, el volumen del extracto, y los resultados de cuantificación, el método de análisis deberá ser seleccionado entre STRs, SNPs o ADN mitocondrial.* Se ha comprobado que excepto en los casos de degradación más agresiva, fragmentos de hasta 300bps pueden ser amplificados con éxito con todos los sistemas. Sin embargo los SNPs ofrecen una mayor tasa de éxito si el ADN está severamente degradado.* La aplicación del tipado de marcadores de amplicón reducido, como los SNPs y los miniSTRs, a muestras degradadas ha demostrado ser una solución adecuada para los problemas que acarrea el trabajo con este tipo de muestras.* Para la elección de los marcadores se ha de tener en cuenta la informatividad del análisis, por lo que se recomienda el tipado de SNPs sobre el de miniSTRs.
  71. 71. CONCLUSIONES Conclusiones BLOQUE 3:3.- La aplicación del tipado de SNPs a la predicción de origen geográficoLos individuos pertenecientes a varias poblaciones que fueron tipificados con el multiplexPop.Spec.34plex, resultaron clasificados correctamente. El grado de clasificación errónea del testes cercano a cero. El test y su aplicación matemática, ofrecen para el trabajo de rutina forense un sistema declasificación efectivo, por lo que es razonable esperar que pueda encontrar un lugar entre lasaproximaciones disponibles para la asignación de ancestralidad poblacional. 3.1- Sobre la capacidad de discriminación entre poblaciones geográficamente próximas * La comparación enfrentada, por pares de poblaciones, constituye una estrategia válida para la asignación del origen de una muestra entre poblaciones geográficamente próximas. * Sin embargo cabe destacar que esta comparación depende del que entre las poblaciones a comparar exista una cierta diferencia en las frecuencias génicas de los marcadores implicados, entre las poblaciones. * La selección de marcadores con la distribución de frecuencias adecuada podría permitir una separación mas fina incluso entre poblaciones con una historia común reciente, sin embargo el hallazgo de tales marcadores se presenta como una difícil empresa
  72. 72. CONCLUSIONES Conclusiones BLOQUE 4: 4.- La resolución de casos complejos mediante el uso de SNPsHabida cuenta de los casos resueltos con éxito gracias a la incorporación de los multiplexesde SNPs al pool de marcadores forenses, se puede asegurar que, constituye una soluciónadecuada para el trabajo forense, rápida y fiable
  73. 73. AGRADECIMIENTOS“Generally, I dislike fixedness in both long swords and hands. Fixednessmeans a dead hand. Pliability is a living hand. You must bear this inmind.”Miyamoto Musashi (1584-1645)

×