Fundamentos Moleculares de las Enfermedades 1

1.165 visualizaciones

Publicado el

Presentación aún no adaptada para Slideshare, espero les sea de utilidad.

Publicado en: Educación, Viajes
0 comentarios
0 recomendaciones
Estadísticas
Notas
  • Sé el primero en comentar

  • Sé el primero en recomendar esto

Sin descargas
Visualizaciones
Visualizaciones totales
1.165
En SlideShare
0
De insertados
0
Número de insertados
83
Acciones
Compartido
0
Descargas
0
Comentarios
0
Recomendaciones
0
Insertados 0
No insertados

No hay notas en la diapositiva.
  • Las bases nitrogenadas son PMO son varias familias de los vastos compuestos heterociclos (ciclos simples o fusionados de 5 ó 6 vértices que incluyen heteroátomos (O, S, N) y dobles enlaces (comúnmente conjugados)) que incluyen N. Ejemplos: Pirroles, Piridinas, Indoles, etc. Las Purinas (2 heterociclos nitrogenados fusionados de 6 y 5 vértices) y las Pirimidinas (1 heterociclo nitrogenado de 6 vértices) son fundamentales para la síntesis de los nucleósidos, nucleótidos y ácidos nucleicos.
  • Las bases nitrogenadas son PMO son varias familias de los vastos compuestos heterociclos (ciclos simples o fusionados de 5 ó 6 vértices que incluyen heteroátomos (O, S, N) y dobles enlaces (comúnmente conjugados)) que incluyen N. Ejemplos: Pirroles, Piridinas, Indoles, etc. Las Purinas (2 heterociclos nitrogenados fusionados de 6 y 5 vértices) y las Pirimidinas (1 heterociclo nitrogenado de 6 vértices) son fundamentales para la síntesis de los nucleósidos, nucleótidos y ácidos nucleicos.
  • Las bases nitrogenadas son PMO son varias familias de los vastos compuestos heterociclos (ciclos simples o fusionados de 5 ó 6 vértices que incluyen heteroátomos (O, S, N) y dobles enlaces (comúnmente conjugados)) que incluyen N. Ejemplos: Pirroles, Piridinas, Indoles, etc. Las Purinas (2 heterociclos nitrogenados fusionados de 6 y 5 vértices) y las Pirimidinas (1 heterociclo nitrogenado de 6 vértices) son fundamentales para la síntesis de los nucleósidos, nucleótidos y ácidos nucleicos.
  • Las bases nitrogenadas son PMO son varias familias de los vastos compuestos heterociclos (ciclos simples o fusionados de 5 ó 6 vértices que incluyen heteroátomos (O, S, N) y dobles enlaces (comúnmente conjugados)) que incluyen N. Ejemplos: Pirroles, Piridinas, Indoles, etc. Las Purinas (2 heterociclos nitrogenados fusionados de 6 y 5 vértices) y las Pirimidinas (1 heterociclo nitrogenado de 6 vértices) son fundamentales para la síntesis de los nucleósidos, nucleótidos y ácidos nucleicos.
  • Las bases nitrogenadas son PMO son varias familias de los vastos compuestos heterociclos (ciclos simples o fusionados de 5 ó 6 vértices que incluyen heteroátomos (O, S, N) y dobles enlaces (comúnmente conjugados)) que incluyen N. Ejemplos: Pirroles, Piridinas, Indoles, etc. Las Purinas (2 heterociclos nitrogenados fusionados de 6 y 5 vértices) y las Pirimidinas (1 heterociclo nitrogenado de 6 vértices) son fundamentales para la síntesis de los nucleósidos, nucleótidos y ácidos nucleicos.
  • F 15-14 Alberts
  • F 15-15 Alberts
  • F 15-16 Alberts
  • F 15-18 y 19 Alberts
  • F 15-23 Alberts
  • F 15-23 Alberts
  • F 15-23 Alberts
  • F 15-23 Alberts
  • F 15-23 Alberts
  • F 15-23 Alberts
  • F 15-25 Alberts
  • F 15-39 y 41 Alberts
  • F 15-25 Alberts
  • Fundamentos Moleculares de las Enfermedades 1

    1. 1. Bases Moleculares de las Enfermedades-1 {conceptos generales} M. en C. RAFAEL GOVEA VILLASEÑOR CINVESTAV-IPN Diapo 1380
    2. 2. Reparación de ADN
    3. 3. Desaminación de Nucleótidos
    4. 4. Sitios de Acción de Mutágenos
    5. 5. Reparación del ADN
    6. 6. Transposición (Elementos Genéticos Móviles)
    7. 7. Tipos de Transposición
    8. 8. Rearreglos de ADN debida a Transposones
    9. 9. Señalización Celular <ul><li>S. Paracrina </li></ul><ul><li>S. Autocrina </li></ul><ul><li>S. Endocrina </li></ul><ul><li>S. Sináptica (nerviosa) </li></ul>
    10. 10. Tipos de Receptores Membranales
    11. 11. Tipos principales de transducción de señales
    12. 12. Forma de Integrar Señales
    13. 13. Señalización “Río abajo” de Proteínas G Ca 2+ AMPc
    14. 14. Acoplamiento de Prot. G con Adenilato ciclasa
    15. 15. Acoplamiento de Prot. G con Adenilato ciclasa
    16. 16. Acoplamiento de Prot. G con Adenilato ciclasa
    17. 17. Acoplamiento de Prot. G con Adenilato ciclasa
    18. 18. Acoplamiento de Prot. G con Adenilato ciclasa
    19. 19. Acoplamiento de Prot. G con Adenilato ciclasa
    20. 20. Un ejemplo de activación vía bioquímica Fosfatasa
    21. 21. Un ejemplo del efecto “Cascada” La membrana del bastón se hiperpolariza 1 mv Luz 1 fotón 1 molécula de rodopsina 500 transducinas activadas 10 5 c GMP hidrolizadas 250 canales de Na + cerrados De 10 6 a 10 7 Na + dejan de entrar a la célula por 1 seg. 500 GMP c fosfodiesterasas activadas
    22. 22. ¿Por qué son necesarias las cascadas de señalización? Porque 1 molécula no puede tener efectos macroscópicos Cada cascada es un amplificador de señales
    23. 23. Tipos de herencia <ul><li>Autosómica Dominante </li></ul><ul><li>Autosómica Recesiva </li></ul><ul><li>Ligada al Sexo </li></ul><ul><ul><li>Cromosoma X </li></ul></ul><ul><ul><li>Cromosoma Y </li></ul></ul><ul><li>Línea materna Mitocondrial </li></ul><ul><li>Otros </li></ul>
    24. 24. ¿Qué es una Mutación? Una mutación es cualesquier cambio en la información genética Por lo tanto, la mutación es la fuente primaria de variabilidad para el proceso evolutivo M en C Rafael Govea Villaseñor
    25. 25. ¿Cuáles tipos de Mutación existen? Mutaciones Génicas Mutaciones o Aberraciones Cromosómicas Mutaciones Genómicas Mutaciones Epigenéticas M en C Rafael Govea Villaseñor
    26. 26. ¿Cuál es el soporte de la Información Genética? En la secuencia de pares de bases de Bases del Ácido Desoxirribonucleico, el ADN , se guarda la información necesaria para sintetizar todas las macromoléculas que llevan a cabo las funciones celulares M en C Rafael Govea Villaseñor
    27. 27. ADN 5' 5' 3' 3' Diapo 0052 El ADN es muy delgado, apenas de 2 nm de ancho y muy largo mide de milímetros a centímetros . Hay 10 pares de bases [pb] en cada 3.43 nm Como el genoma humano Tiene 2 juegos de 3.3 Mpb entonces las 46 moléculas miden 1.94 m M en C Rafael Govea Villaseñor El ADN es un polímero de 2 cadenas de nucleótidos unidos por enlaces fosfo-diester formando una doble hélice delgada y muy larga gracias a los puentes de H de sus pares de bases G A C T D P D P D P D P A G T C D P D P D P D P
    28. 28. DNA CGTACATGCATCGATCGATTC 5' 5' 3' 3' CADENA &quot;SENTIDO&quot; CADENA &quot;ANTISENTIDO&quot; Diapo 1152 M en C Rafael Govea Villaseñor El ADN posee 2 cadenas antiparalelas [misma dirección, pero de sentidos opuestos] y complementarias de 5’ a 3’ –la cadena sentido- y 3’ a 5’ –la antisentido. GCATGTACGTAGCTAGCTAAG
    29. 29. Cómo se usa la Información Genética ADN ARN T.1º ARN m Proteína Transcripción Corte y empalme Traducción Réplicación Copiando la secuencia de pb del ADN como secuencia de nucleótidos en moléculas ARN [transcrito primario] que se corta y empalma en diversas moléculas de ARN [ARN de transferencia, ribosomal y mensajero] que permiten construir las moléculas de las proteínas ARN t ARN r
    30. 30. ¿Qué es el Código Genético? Es la tabla que contiene el nombre de los aminoácidos escrito en el alfabeto del ARN M en C Rafael Govea Villaseñor El nombre de los aminoácidos es un triplete de nucleótidos del ARN m [codón] que la célula reconoce y permite tomar c/u de los 20 aminoácidos proteícos y unirlos por enlaces peptídicos. Así pues hay 4x4x4 combinaciones de Bases disponibles, es decir 64 codones para nombrar a 20 aminoácidos.
    31. 31. Código Genético En el código tradicional las BN del codón se anotan a los lados izquierdo, la 1ª BN; superior, la 2ª BN y derecho, la 3ª BN. En el punto de intersección del renglón, columna y línea se encuentra el nombre del aminoácido codificado por el codón M en C Rafael Govea Villaseñor
    32. 32. En esta representación moderna del código genético, los codones se anotan radialmente en 3 círculos concéntricos. La línea que pasa desde el centro por los 3 ruedas indica el aminoácido codificado por el codón. UCU = Ser M en C Rafael Govea Villaseñor

    ×