SlideShare una empresa de Scribd logo
1 de 91
UCSC
genome browsing

        Paco Hulpiau



  http://www.bits.vib.be
TABLE     GET       CURRENT
        BROWSER   DNA       BROWSER
                            GRAPHIC IN PDF




                        TO GET
                        OTHER
CLICK                    DATA
LINE
TO GET
            OTHER
CLICK
LINE    2    DATA
Databases & accession numbers

§
    GenBank exchanges data daily with its two partners in the
    International Nucleotide Sequence Database Collaboration (INSDC):
        European Bioinformatics Institute (EBI, part of EMBL)
        DNA Data Bank of Japan (DDBJ)

§
    Characteristics of GenBank and RefSeq @ NCBI :

    GenBank                          RefSeq

                                     Curated, NCBI creates from existing
    Not curated, author submits
                                     data

    Multiple records for same loci   Single records for each molecule

    No limit to species included     Limited to model organisms
Databases & accession numbers

§




§
    The Ensembl automatic gene annotation system (Curwen et al, 2004) :
        The gene-building system enables fast automated annotation of
    eukaryotic genomes. It annotates genes based on evidence derived
    from known protein, cDNA, and EST sequences
        incl. GenBank sequences shared by INSDC, UniProtKB and NCBI
    RefSeq
Databases & accession numbers

§   Database                   Typical accession numbers

    GenBank                    AAA37420

                               NM_123456 = mRNA
                               NP_123456 = proteins
    RefSeq
                               XM_123456 = predicted mRNA
                               XP_123456 = predicted proteins

    UniProtKB (Swiss-
                               P12345, Q1AAA9
    Prot/TrEMBL)

                               ENSMUSG00000123456 for Genes
    Ensembl                    ENSMUST00000123456 for Transcripts
                               ENSMUSP00000123456 for Proteins
TO GET
            OTHER
CLICK
LINE    2    DATA
zoom in on
exon 1 +
upstream
Exercises (II)


1)   Are there any diseases related to your gene of interest?      (OMIM)
         Which interactions partners are known?         (Entrez Gene)
         Any important SNPs changing the amino acid sequence?


         Get the multiple sequence alignment (MSA, multiz46way)
     showing the nucleotide sequences of human, mouse, chicken,
     Xenopus and zebrafish genes (CDS fasta alignment, exons not
     separate).


         Save your results (e.g. exercises2_1.doc).
3
GET
DNA




          TO GET
          OTHER
           DATA
http://www.visibone.com/colorlab
/
Exercises (II)


2)   Get the DNA sequence for your gene of interest
         including 2000 base pairs upstream and
         use the following extended case/color options:
         » RefSeq and Ensembl genes in bold
         » SNPs (132) underlined
         » Regulatory information e.g. from Oreganno and miRNA sites
          in different colors


         » Save your results (e.g. exercises2_2a.doc).
Exercises (II)


2)   Try to get the DNA sequence for your gene of interest
         in chicken or zebrafish and
         use the following extended case/color options:
         » UCSC, RefSeq and Ensembl genes in bold
         » Other RefSeq genes underlined
         » Human proteins in a specific color


         » Save your results (e.g. exercises2_2b.doc).
4
TABLE
BROWSER




              TO GET
              OTHER
               DATA
COPY (Ctrl+C)
= Accession Number (RefSeq) e.g. NM_001229




= Gene Name (Entrez) e.g. CASP1
Exercises (II)


3)   Get a list of the RefSeq and Ensembl transcripts using the table
         browser with the following selected fields:
         » name, chromosome, exon count, name2
         » Save the results (exercises2_3a.xls)
         Also get the sequences and save as genename_transcripts.fasta


         Search the mouse genome using the filter in the table browser
         to get all family members of a protein family (research interest)
         and save the results in a list (exercises2_3b.xls) containing name,
     chromosome, cds start and end, exon count and name2
TO GET
OTHER
 DATA
TO GET
OTHER
 DATA
BLAT = Blast-Like Alignment Tool
Ø search for high similarity matches by indexing entire
genome
Ø DNA limit = 25000 bases, for multiple seqs 50000 bases

Ø protein limit = 10000 aa, for multiple seqs 25000 aa

Ø total sequences = 25
PASTE (Ctrl+V)
TTTAGCCAACGAACAGTCGCT   TTCTCTTTGCATCTGTCCCAG
§
    The Utilities page contains links to some tools

    created by the UCSC Genome Bioinformatics Group.


§
    DNA Duster & Protein Duster remove non-sequence

    related characters from an input sequence.
Exercises (II)


4)   Use BLAT to find orthologs of your gene in chicken, zebrafish
         and fruit fly. What is the genomic location?
         Are the flanking genes the same?


         Perform an in silico PCR to see what happens when more than 1
     PCR product may arise and determine product size and Tm:
         species: human
         forward primer: TTC AAG GAG GCC TTC TCC CT
         reverse primer: CTG GGG GAG AAG CTG A (+click flip reverse)

Más contenido relacionado

La actualidad más candente

100505 koenig biological_databases
100505 koenig biological_databases100505 koenig biological_databases
100505 koenig biological_databases
Meetika Gupta
 

La actualidad más candente (20)

NCBI
NCBINCBI
NCBI
 
Biological databases
Biological databasesBiological databases
Biological databases
 
Major biological nucleotide databases
Major biological nucleotide databasesMajor biological nucleotide databases
Major biological nucleotide databases
 
Rishi
RishiRishi
Rishi
 
Biological databases
Biological databasesBiological databases
Biological databases
 
Biological databases
Biological databasesBiological databases
Biological databases
 
BITS: Overview of important biological databases beyond sequences
BITS: Overview of important biological databases beyond sequencesBITS: Overview of important biological databases beyond sequences
BITS: Overview of important biological databases beyond sequences
 
Tools and database of NCBI
Tools and database of NCBITools and database of NCBI
Tools and database of NCBI
 
Biological databases
Biological databasesBiological databases
Biological databases
 
Intro to databases
Intro to databasesIntro to databases
Intro to databases
 
Databases ii
Databases iiDatabases ii
Databases ii
 
TOOLS AND DATA BASES OF NCBI
TOOLS AND DATA BASES OF NCBITOOLS AND DATA BASES OF NCBI
TOOLS AND DATA BASES OF NCBI
 
B.sc biochem i bobi u 2 database
B.sc biochem i bobi u 2 databaseB.sc biochem i bobi u 2 database
B.sc biochem i bobi u 2 database
 
Genomic databases
Genomic databasesGenomic databases
Genomic databases
 
Ensembl genome
Ensembl genomeEnsembl genome
Ensembl genome
 
Protein database ..... of NCBI
Protein database ..... of NCBI Protein database ..... of NCBI
Protein database ..... of NCBI
 
Biological databases
Biological databasesBiological databases
Biological databases
 
Biological data base
Biological data baseBiological data base
Biological data base
 
100505 koenig biological_databases
100505 koenig biological_databases100505 koenig biological_databases
100505 koenig biological_databases
 
Protein Sequence Databases
Protein Sequence Databases Protein Sequence Databases
Protein Sequence Databases
 

Destacado (7)

EMBL-EBI
EMBL-EBIEMBL-EBI
EMBL-EBI
 
GenomeBrowser
GenomeBrowserGenomeBrowser
GenomeBrowser
 
Presentation on Biological database By Elufer Akram @ University Of Science ...
Presentation on Biological database  By Elufer Akram @ University Of Science ...Presentation on Biological database  By Elufer Akram @ University Of Science ...
Presentation on Biological database By Elufer Akram @ University Of Science ...
 
databases in bioinformatics
databases in bioinformaticsdatabases in bioinformatics
databases in bioinformatics
 
Biological databases
Biological databasesBiological databases
Biological databases
 
Biological Databases
Biological DatabasesBiological Databases
Biological Databases
 
Protein databases
Protein databasesProtein databases
Protein databases
 

Similar a BITS training - UCSC Genome Browser - Part 2

Bioinformatics.Practical Notebook
Bioinformatics.Practical NotebookBioinformatics.Practical Notebook
Bioinformatics.Practical Notebook
Naima Tahsin
 
L14 human genome
L14 human genomeL14 human genome
L14 human genome
MUBOSScz
 
Informal presentation on bioinformatics
Informal presentation on bioinformaticsInformal presentation on bioinformatics
Informal presentation on bioinformatics
Atai Rabby
 

Similar a BITS training - UCSC Genome Browser - Part 2 (20)

Understanding Genome
Understanding Genome Understanding Genome
Understanding Genome
 
Bioinformatics final
Bioinformatics finalBioinformatics final
Bioinformatics final
 
Genome comparision
Genome comparisionGenome comparision
Genome comparision
 
RNA sequencing analysis tutorial with NGS
RNA sequencing analysis tutorial with NGSRNA sequencing analysis tutorial with NGS
RNA sequencing analysis tutorial with NGS
 
Exploring DNA/RNA-Seq Analysis Results with Golden Helix GenomeBrowse and SVS
Exploring DNA/RNA-Seq Analysis Results with Golden Helix GenomeBrowse and SVSExploring DNA/RNA-Seq Analysis Results with Golden Helix GenomeBrowse and SVS
Exploring DNA/RNA-Seq Analysis Results with Golden Helix GenomeBrowse and SVS
 
Bioinformatics.Practical Notebook
Bioinformatics.Practical NotebookBioinformatics.Practical Notebook
Bioinformatics.Practical Notebook
 
Apollo Introduction for the Chestnut Research Community
Apollo Introduction for the Chestnut Research CommunityApollo Introduction for the Chestnut Research Community
Apollo Introduction for the Chestnut Research Community
 
Role of bioinformatics in life sciences research
Role of bioinformatics in life sciences researchRole of bioinformatics in life sciences research
Role of bioinformatics in life sciences research
 
Introduction to Apollo for i5k
Introduction to Apollo for i5kIntroduction to Apollo for i5k
Introduction to Apollo for i5k
 
Microarray biotechnologg ppy dna microarrays
Microarray biotechnologg ppy dna microarraysMicroarray biotechnologg ppy dna microarrays
Microarray biotechnologg ppy dna microarrays
 
EMBL- European Molecular Biology Laboratory
EMBL- European Molecular Biology LaboratoryEMBL- European Molecular Biology Laboratory
EMBL- European Molecular Biology Laboratory
 
Apollo : A workshop for the Manakin Research Coordination Network
Apollo: A workshop for the Manakin Research Coordination NetworkApollo: A workshop for the Manakin Research Coordination Network
Apollo : A workshop for the Manakin Research Coordination Network
 
Race against the sequencing machine: processing of raw DNA sequence data at t...
Race against the sequencing machine: processing of raw DNA sequence data at t...Race against the sequencing machine: processing of raw DNA sequence data at t...
Race against the sequencing machine: processing of raw DNA sequence data at t...
 
Dgaston dec-06-2012
Dgaston dec-06-2012Dgaston dec-06-2012
Dgaston dec-06-2012
 
L14 human genome
L14 human genomeL14 human genome
L14 human genome
 
Genome Assembly
Genome AssemblyGenome Assembly
Genome Assembly
 
Informal presentation on bioinformatics
Informal presentation on bioinformaticsInformal presentation on bioinformatics
Informal presentation on bioinformatics
 
Introduction to databases.pptx
Introduction to databases.pptxIntroduction to databases.pptx
Introduction to databases.pptx
 
Genome editing with engineered nucleases
Genome editing with engineered nucleasesGenome editing with engineered nucleases
Genome editing with engineered nucleases
 
Bioinformaatics for M.Sc. Biotecchnology.pptx
Bioinformaatics for M.Sc. Biotecchnology.pptxBioinformaatics for M.Sc. Biotecchnology.pptx
Bioinformaatics for M.Sc. Biotecchnology.pptx
 

Más de BITS

Más de BITS (20)

RNA-seq for DE analysis: detecting differential expression - part 5
RNA-seq for DE analysis: detecting differential expression - part 5RNA-seq for DE analysis: detecting differential expression - part 5
RNA-seq for DE analysis: detecting differential expression - part 5
 
RNA-seq for DE analysis: extracting counts and QC - part 4
RNA-seq for DE analysis: extracting counts and QC - part 4RNA-seq for DE analysis: extracting counts and QC - part 4
RNA-seq for DE analysis: extracting counts and QC - part 4
 
RNA-seq for DE analysis: the biology behind observed changes - part 6
RNA-seq for DE analysis: the biology behind observed changes - part 6RNA-seq for DE analysis: the biology behind observed changes - part 6
RNA-seq for DE analysis: the biology behind observed changes - part 6
 
RNA-seq: analysis of raw data and preprocessing - part 2
RNA-seq: analysis of raw data and preprocessing - part 2RNA-seq: analysis of raw data and preprocessing - part 2
RNA-seq: analysis of raw data and preprocessing - part 2
 
RNA-seq: general concept, goal and experimental design - part 1
RNA-seq: general concept, goal and experimental design - part 1RNA-seq: general concept, goal and experimental design - part 1
RNA-seq: general concept, goal and experimental design - part 1
 
RNA-seq: Mapping and quality control - part 3
RNA-seq: Mapping and quality control - part 3RNA-seq: Mapping and quality control - part 3
RNA-seq: Mapping and quality control - part 3
 
Productivity tips - Introduction to linux for bioinformatics
Productivity tips - Introduction to linux for bioinformaticsProductivity tips - Introduction to linux for bioinformatics
Productivity tips - Introduction to linux for bioinformatics
 
Text mining on the command line - Introduction to linux for bioinformatics
Text mining on the command line - Introduction to linux for bioinformaticsText mining on the command line - Introduction to linux for bioinformatics
Text mining on the command line - Introduction to linux for bioinformatics
 
The structure of Linux - Introduction to Linux for bioinformatics
The structure of Linux - Introduction to Linux for bioinformaticsThe structure of Linux - Introduction to Linux for bioinformatics
The structure of Linux - Introduction to Linux for bioinformatics
 
Managing your data - Introduction to Linux for bioinformatics
Managing your data - Introduction to Linux for bioinformaticsManaging your data - Introduction to Linux for bioinformatics
Managing your data - Introduction to Linux for bioinformatics
 
Introduction to Linux for bioinformatics
Introduction to Linux for bioinformaticsIntroduction to Linux for bioinformatics
Introduction to Linux for bioinformatics
 
BITS - Genevestigator to easily access transcriptomics data
BITS - Genevestigator to easily access transcriptomics dataBITS - Genevestigator to easily access transcriptomics data
BITS - Genevestigator to easily access transcriptomics data
 
BITS - Comparative genomics: the Contra tool
BITS - Comparative genomics: the Contra toolBITS - Comparative genomics: the Contra tool
BITS - Comparative genomics: the Contra tool
 
BITS - Comparative genomics on the genome level
BITS - Comparative genomics on the genome levelBITS - Comparative genomics on the genome level
BITS - Comparative genomics on the genome level
 
BITS - Comparative genomics: gene family analysis
BITS - Comparative genomics: gene family analysisBITS - Comparative genomics: gene family analysis
BITS - Comparative genomics: gene family analysis
 
BITS - Introduction to comparative genomics
BITS - Introduction to comparative genomicsBITS - Introduction to comparative genomics
BITS - Introduction to comparative genomics
 
BITS - Protein inference from mass spectrometry data
BITS - Protein inference from mass spectrometry dataBITS - Protein inference from mass spectrometry data
BITS - Protein inference from mass spectrometry data
 
BITS - Overview of sequence databases for mass spectrometry data analysis
BITS - Overview of sequence databases for mass spectrometry data analysisBITS - Overview of sequence databases for mass spectrometry data analysis
BITS - Overview of sequence databases for mass spectrometry data analysis
 
BITS - Search engines for mass spec data
BITS - Search engines for mass spec dataBITS - Search engines for mass spec data
BITS - Search engines for mass spec data
 
BITS - Introduction to proteomics
BITS - Introduction to proteomicsBITS - Introduction to proteomics
BITS - Introduction to proteomics
 

Último

Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Victor Rentea
 
Finding Java's Hidden Performance Traps @ DevoxxUK 2024
Finding Java's Hidden Performance Traps @ DevoxxUK 2024Finding Java's Hidden Performance Traps @ DevoxxUK 2024
Finding Java's Hidden Performance Traps @ DevoxxUK 2024
Victor Rentea
 
Why Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire businessWhy Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire business
panagenda
 

Último (20)

"I see eyes in my soup": How Delivery Hero implemented the safety system for ...
"I see eyes in my soup": How Delivery Hero implemented the safety system for ..."I see eyes in my soup": How Delivery Hero implemented the safety system for ...
"I see eyes in my soup": How Delivery Hero implemented the safety system for ...
 
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
Modular Monolith - a Practical Alternative to Microservices @ Devoxx UK 2024
 
DEV meet-up UiPath Document Understanding May 7 2024 Amsterdam
DEV meet-up UiPath Document Understanding May 7 2024 AmsterdamDEV meet-up UiPath Document Understanding May 7 2024 Amsterdam
DEV meet-up UiPath Document Understanding May 7 2024 Amsterdam
 
AWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of TerraformAWS Community Day CPH - Three problems of Terraform
AWS Community Day CPH - Three problems of Terraform
 
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data DiscoveryTrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
TrustArc Webinar - Unlock the Power of AI-Driven Data Discovery
 
presentation ICT roal in 21st century education
presentation ICT roal in 21st century educationpresentation ICT roal in 21st century education
presentation ICT roal in 21st century education
 
Rising Above_ Dubai Floods and the Fortitude of Dubai International Airport.pdf
Rising Above_ Dubai Floods and the Fortitude of Dubai International Airport.pdfRising Above_ Dubai Floods and the Fortitude of Dubai International Airport.pdf
Rising Above_ Dubai Floods and the Fortitude of Dubai International Airport.pdf
 
MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024
 
Understanding the FAA Part 107 License ..
Understanding the FAA Part 107 License ..Understanding the FAA Part 107 License ..
Understanding the FAA Part 107 License ..
 
DBX First Quarter 2024 Investor Presentation
DBX First Quarter 2024 Investor PresentationDBX First Quarter 2024 Investor Presentation
DBX First Quarter 2024 Investor Presentation
 
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingRepurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
 
Apidays New York 2024 - Passkeys: Developing APIs to enable passwordless auth...
Apidays New York 2024 - Passkeys: Developing APIs to enable passwordless auth...Apidays New York 2024 - Passkeys: Developing APIs to enable passwordless auth...
Apidays New York 2024 - Passkeys: Developing APIs to enable passwordless auth...
 
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
Connector Corner: Accelerate revenue generation using UiPath API-centric busi...
 
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
 
Artificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : UncertaintyArtificial Intelligence Chap.5 : Uncertainty
Artificial Intelligence Chap.5 : Uncertainty
 
Finding Java's Hidden Performance Traps @ DevoxxUK 2024
Finding Java's Hidden Performance Traps @ DevoxxUK 2024Finding Java's Hidden Performance Traps @ DevoxxUK 2024
Finding Java's Hidden Performance Traps @ DevoxxUK 2024
 
Why Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire businessWhy Teams call analytics are critical to your entire business
Why Teams call analytics are critical to your entire business
 
Navigating the Deluge_ Dubai Floods and the Resilience of Dubai International...
Navigating the Deluge_ Dubai Floods and the Resilience of Dubai International...Navigating the Deluge_ Dubai Floods and the Resilience of Dubai International...
Navigating the Deluge_ Dubai Floods and the Resilience of Dubai International...
 
CNIC Information System with Pakdata Cf In Pakistan
CNIC Information System with Pakdata Cf In PakistanCNIC Information System with Pakdata Cf In Pakistan
CNIC Information System with Pakdata Cf In Pakistan
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
 

BITS training - UCSC Genome Browser - Part 2

  • 1. UCSC genome browsing Paco Hulpiau http://www.bits.vib.be
  • 2. TABLE GET CURRENT BROWSER DNA BROWSER GRAPHIC IN PDF TO GET OTHER CLICK DATA LINE
  • 3. TO GET OTHER CLICK LINE 2 DATA
  • 4. Databases & accession numbers § GenBank exchanges data daily with its two partners in the International Nucleotide Sequence Database Collaboration (INSDC): European Bioinformatics Institute (EBI, part of EMBL) DNA Data Bank of Japan (DDBJ) § Characteristics of GenBank and RefSeq @ NCBI : GenBank RefSeq Curated, NCBI creates from existing Not curated, author submits data Multiple records for same loci Single records for each molecule No limit to species included Limited to model organisms
  • 5. Databases & accession numbers § § The Ensembl automatic gene annotation system (Curwen et al, 2004) : The gene-building system enables fast automated annotation of eukaryotic genomes. It annotates genes based on evidence derived from known protein, cDNA, and EST sequences incl. GenBank sequences shared by INSDC, UniProtKB and NCBI RefSeq
  • 6. Databases & accession numbers § Database Typical accession numbers GenBank AAA37420 NM_123456 = mRNA NP_123456 = proteins RefSeq XM_123456 = predicted mRNA XP_123456 = predicted proteins UniProtKB (Swiss- P12345, Q1AAA9 Prot/TrEMBL) ENSMUSG00000123456 for Genes Ensembl ENSMUST00000123456 for Transcripts ENSMUSP00000123456 for Proteins
  • 7. TO GET OTHER CLICK LINE 2 DATA
  • 8.
  • 9.
  • 10.
  • 11.
  • 12.
  • 13.
  • 14.
  • 15.
  • 16.
  • 17.
  • 18.
  • 19.
  • 20.
  • 21.
  • 22.
  • 23.
  • 24.
  • 25.
  • 26.
  • 27. zoom in on exon 1 + upstream
  • 28.
  • 29.
  • 30.
  • 31.
  • 32.
  • 33.
  • 34.
  • 35.
  • 36. Exercises (II) 1) Are there any diseases related to your gene of interest? (OMIM) Which interactions partners are known? (Entrez Gene) Any important SNPs changing the amino acid sequence? Get the multiple sequence alignment (MSA, multiz46way) showing the nucleotide sequences of human, mouse, chicken, Xenopus and zebrafish genes (CDS fasta alignment, exons not separate). Save your results (e.g. exercises2_1.doc).
  • 37. 3 GET DNA TO GET OTHER DATA
  • 38.
  • 39.
  • 41.
  • 42.
  • 43.
  • 44.
  • 45.
  • 46.
  • 47.
  • 48.
  • 49.
  • 50. Exercises (II) 2) Get the DNA sequence for your gene of interest including 2000 base pairs upstream and use the following extended case/color options: » RefSeq and Ensembl genes in bold » SNPs (132) underlined » Regulatory information e.g. from Oreganno and miRNA sites in different colors » Save your results (e.g. exercises2_2a.doc).
  • 51. Exercises (II) 2) Try to get the DNA sequence for your gene of interest in chicken or zebrafish and use the following extended case/color options: » UCSC, RefSeq and Ensembl genes in bold » Other RefSeq genes underlined » Human proteins in a specific color » Save your results (e.g. exercises2_2b.doc).
  • 52. 4 TABLE BROWSER TO GET OTHER DATA
  • 53.
  • 54.
  • 55.
  • 56.
  • 57.
  • 58.
  • 60.
  • 61.
  • 62.
  • 63.
  • 64.
  • 65. = Accession Number (RefSeq) e.g. NM_001229 = Gene Name (Entrez) e.g. CASP1
  • 66.
  • 67.
  • 68.
  • 69.
  • 70.
  • 71. Exercises (II) 3) Get a list of the RefSeq and Ensembl transcripts using the table browser with the following selected fields: » name, chromosome, exon count, name2 » Save the results (exercises2_3a.xls) Also get the sequences and save as genename_transcripts.fasta Search the mouse genome using the filter in the table browser to get all family members of a protein family (research interest) and save the results in a list (exercises2_3b.xls) containing name, chromosome, cds start and end, exon count and name2
  • 74.
  • 75. BLAT = Blast-Like Alignment Tool Ø search for high similarity matches by indexing entire genome Ø DNA limit = 25000 bases, for multiple seqs 50000 bases Ø protein limit = 10000 aa, for multiple seqs 25000 aa Ø total sequences = 25
  • 77.
  • 78.
  • 79.
  • 80.
  • 81.
  • 82.
  • 83.
  • 84.
  • 85. TTTAGCCAACGAACAGTCGCT TTCTCTTTGCATCTGTCCCAG
  • 86.
  • 87.
  • 88. § The Utilities page contains links to some tools created by the UCSC Genome Bioinformatics Group. § DNA Duster & Protein Duster remove non-sequence related characters from an input sequence.
  • 89.
  • 90.
  • 91. Exercises (II) 4) Use BLAT to find orthologs of your gene in chicken, zebrafish and fruit fly. What is the genomic location? Are the flanking genes the same? Perform an in silico PCR to see what happens when more than 1 PCR product may arise and determine product size and Tm: species: human forward primer: TTC AAG GAG GCC TTC TCC CT reverse primer: CTG GGG GAG AAG CTG A (+click flip reverse)