1. Lecture 1 CCC -Proteins........
• Modified lecture presentations will also be posted after the
lecture; and may include additional materials, including
problem sets any .
1
2. Proteins:
Make up about 15% of the cell
Have many functions in the cell
Enzymes
Structural
Transport
Motor
Storage
Signaling
Receptors
Gene regulation
Special functions
2
3. DNA : Sequence of Nucleic Acids
TCATCCACACGCTGAATGGCGCCAAGCTCTCGGCCGACACCGAGGTGGT
TTGCGGAG
CCCCTTCAATCTACCTTGATTTTGCCCGCCAGAAGCTTGATGCAAAGAT
TGGAGTTGCAGCACAAAACTGTTACAACGTAC
CGAAGGGTGCTTTCACAGGAGAGATCAGCCCAGCAATGATCAAAGATAT
TGGAGCTGCATGGGTGATCCTGGGCCACTCAG
AGCGGAGGCATGTTTTTGGAGAGTCTGATGAGTTGATTGGGCAGAAGGT
GGCTCATGCTCMTGCTGAAGGC
Transcription and translation (DNA→Protein)
3
11. Peptide Bonds
- α-carboxyl of one amino acid is joined to
α-amino of a second amino acid (with
removal of water)
- only α-carboxyl and α-amino groups are
used, not R-group carboxyl or amino
groups
11
15. Peptide bonds is planar and quite rigid.
Therefore the polypeptide chain has rotational freedom only about
bonds formed by alpha carbons.
These bonds have been termed as Phi (alpha C – N) and
Psi angle (alpha C-C').
However the rotational freedom about these abgles is limited
by steric hindrance between the side chains of the residues and the
peptide bachbone.
15
16. Primary sequence reveals important
clues about a protein
• Evolution conserves amino acids that are important to protein
structure and function across species. Sequence comparison
of multiple “homologs” of a particular protein reveals highly
conserved regions that are important for function.
• Clusters of conserved residues are called “motifs” -- motifs
carry out a particular function or form a particular structure that
is important for the conserved protein.
motif
DnaG hydrophobic
small E. coli ...EPNRLLVVEGYMDVVAL...
DnaG hydrophobic
large S. typ ...EPQRLLVVEGYMDVVAL...
DnaG B. subt
polar ...KQERAVLFEGFADVYTA...
gp4
positive T3
charge ...GGKKIVVTEGEIDMLTV...
gp4
negativeT7charge ...GGKKIVVTEGEIDALTV...
: : : : * * 16 : :
*
17. Secondary structure = local folding of residues into regular
patterns or local conformation of the polypetide chain
independent of the rest of the protein
17
18. Alpha helix and Beta sheets were actually predicted by
Linus Pauling, Robert Corey and H R Branson in 1951.
Alpha helix and Beta sheets are the regular secondary structures.
α-helix can be coiled in two directions, Left or right . Almost all helices
Observed in proteins are Right Handed, as steric hinderance limit the
ability of left handed helices to form.
Among the right handed helices the α-helix is most prevalent.
α-helix= 3.6 resideus per turn of the backbone coil.
18
19. The α-helix
• In the α-helix, the carbonyl
oxygen of residue “i” forms a
hydrogen bond with the
amide of residue “i+4”.
• Although each hydrogen
bond is relatively weak in
isolation, the sum of the
hydrogen bonds in a helix
makes it quite stable.
• The propensity of a peptide
for forming an α-helix also
depends on its sequence.
19
20. The H bonding patterns of different helical secondary structures.
The α-helix Bonding occurs between the carbonyl oxygen of each
residue and the amide proton of the residue 4 residue ahead in the helix.
The 3 helix = the carbonyl oxygen of each residue and the amide proton
10
of the residue 3 residue ahead, forming a more narrow and elongated helix.
Pi helix= ith and i+5 forming a wider helix.
The 2 ribbon is not a regular secondary structure.
7
. 20
21. The β-sheet
• In a β-sheet, carbonyl
oxygens and amides form
hydrogen bonds.
• These secondary
structures can be either
antiparallel (as shown) or
parallel and need not be
planar (as shown) but can be
twisted.
• The propensity of a peptide
for forming β-sheet also
depends on its sequence.
21
26. Example of tertiary and quaternary
structure - PriB homodimer
Example is PriB replication protein solved at UW: Lopper, Holton, and Keck
(2004) Structure 12, 1967-75. 26
27. Examples of other quaternary
structures
Tetramer Hexamer Filament
SSB DNA helicase Recombinase
Allows coordinated Allows coordinated DNA binding Allows complete
DNA binding and ATP hydrolysis coverage of an
27
extended molecule
28. Classes of proteins
Functional definition:
Enzymes: Accelerate biochemical reactions
Structural: Form biological structures
Transport: Carry biochemically important substances
Defense: Protect the body from foreign invaders
Structural definition:
Globular: Complex folds, irregularly shaped tertiary structures
Fibrous: Extended, simple folds -- generally structural proteins
Cellular localization definition:
Membrane: In direct physical contact with a membrane; generally
water insoluble.
Soluble: Water soluble; can be anywhere in the cell. 28
29. Levels of Organization
Primary structure
Amino acid sequence of the protein
Secondary structure
H bonds in the peptide chain backbone
• α-helix and β-sheets
Tertiary structure
Non-covalent interactions between the R groups within
the protein
Quanternary structure
Interaction between 2 polypeptide chains
29
31. Domains
A domain is a basic structural unit of a protein
structure – distinct from those that make up
the conformations
Part of protein that can fold into a stable
structure independently
Different domains can impart different
functions to proteins
Proteins can have one to many domains
depending on protein size
31
32. Proteins other facts...
Non-covalent bonds can form interactions
between individual polypeptide chains
Binding site – where proteins interact with one another
Subunit – each polypeptide chain of large protein
Dimer – protein made of 2 subunits
• Can be same subunit or different subunits
32