SlideShare una empresa de Scribd logo
1 de 145
Next Generation Sequencing Nantes, January 14 ,  2011 Pierre Lindenbaum PhD [email_address] http://plindenbaum.blogspot.com Twitter:  @yokofakun Insititut du Thorax -  INSERM UMR915
http://en.wikipedia.org/wiki/File:The_Thinker,_Rodin.jpg About me
This presentation will be posted on http://www.slideshare.net/lindenb
Thank you Biostar (  Istvan Albert,Jeremy Leipzig... ) http://biostar.stackexchange.com/questions/3355
“Next” Generation ?
http://en.wikipedia.org/wiki/File:ST_TOS_Cast.jpg Note: I don't remember where I found this awesome idea of mixing Star-Trek and NGS.
http://commons.wikimedia.org/wiki/File:Frederick_Sanger2.jpg 1977
http://en.wikipedia.org/wiki/File:Sequencing.jpg
http://en.wikipedia.org/wiki/Star_Trek:_The_Motion_Picture
http://www.flickr.com/photos/widdowquinn/4119516803/
http://commons.wikimedia.org/wiki/File:Sanger_sequencing_read_display.gif
 
http://www.nature.com/
http://en.wikipedia.org/wiki/Star_Trek_Next_Generation
3 Main Technologies Solid
 
http://www.dkfz.de/gpcf/850.html
Credit: Illumina
 
http://www.dkfz.de/gpcf/850.html
http://www.illumina.com/technology/paired_end_sequencing_assay.ilmn
 
http://www.dkfz.de/gpcf/849.html
 
 
 
http://www.flickr.com/photos/doe_jgi/4093644608
 
The development and impact of 454 sequencing  Jonathan M Rothberg & John H Leamon Nature Biotechnology 26, 1117 - 1124 (2008) Published online: 9 October 2008 doi:10.1038/nbt1485
 
 
 
Genome Biol. 2009; 10(3): R32. Published online 2009 March 27. doi: 10.1186/gb-2009-10-3-r32. Evaluation of next generation sequencing platforms for population targeted sequencing studies
 
Published online 20 November 2008 | Nature | doi:10.1038/news.2008.1245  Human genomes in minutes? Not yet, but biotechnology company is on track for 2013.
 
Sequencing technologies — the next generation  Michael L. Metzker Nature Reviews Genetics 11, 31-46 (January 2010) doi:10.1038/nrg2626
Storage
 
http://blogs.forbes.com/sciencebiz/2010/06/03/your-genome-is-coming/
Genome Biol. 2010;11(5):207. Epub 2010 May 5.  The case for cloud computing in genome informatics.
http://www.flickr.com/photos/esquimo_2ooo/5241744434/
http://www.flickr.com/photos/jpf/152611490/
http://commons.wikimedia.org/wiki/File:Torchlight_zip.png
http://www.flickr.com/photos/coreburn/487357814/
 
http://www.cloudera.com/what-is-hadoop/hadoop-overview/
 
 
FASTQ
@IL31_4368:1:1:996:8507/2 TCCCTTACCCCCAAGCTCCATACCCTCCTAATGCCCACACCTCTTACCTTAGGA + FFCEFFFEEFFFFFFFEFFEFFFEFCFC<EEFEFFFCEFF<;EEFF=FEE?FCE @IL31_4368:1:1:996:21421/2 CAAAAACTTTCACTTTACCTGCCGGGTTTCCCAGTTTACATTCCACTGTTTGAC + >DBDDB,B9BAA4AAB7BB?7BBB=91;+*@;5<87+*=/*@@?9=73=.7)7* @IL31_4368:1:1:997:10572/2 GATCTTCTGTGACTGGAAGAAAATGTGTTACATATTACATTTCTGTCCCCATTG + E?=EECE<EEEE98EEEEAEEBD??BE@AEAB><EEABCEEDEC<<EBDA=DEE @IL31_4368:1:1:997:15684/2 CAGCCTCAGATTCAGCATTCTCAAATTCAGCTGCGGCTGAAACAGCAGCAGGAC + EEEEDEEE9EAEEDEEEEEEEEEECEEAAEEDEE<CD=D=*BCAC?;CB,<D@, @IL31_4368:1:1:997:15249/2 AATGTTCTGAAACCTCTGAGAAAGCAAATATTTATTTTAATGAAAAATCCTTAT + EDEEC;EEE;EEE?EECE;7AEEEEEE07EECEA;D6D>+EE4E7EEE4;E=EA @IL31_4368:1:1:997:6273/2 ACATTTACCAAGACCAAAGGAAACTTACCTTGCAAGAATTAGACAGTTCATTTG + EEAAFFFEEFEFCFAFFAFCCFFEFEF>EFFFFB?ABA@ECEE=<F@DE@DDF; @IL31_4368:1:1:997:1657/2 CCCACCTCTCTCAATGTTTTCCATATGGCAGGGACTCAGCACAGGTGGATTAAT (...)
The syntax of Solexa/Illumina read format is almost identical to the FASTQ format, but the qualities are scaled differently. Given a character $sq, the following Perl code gives the Phred quality $Q:  $Q = 10 * log(1 + 10 ** (ord($sq) - 64) / 10.0)) / log(10); http://maq.sourceforge.net/fastq.shtml Solexa/Illumina Read Format
 
Mapping the short reads on A reference genome
“ Running these accurate alignment algorithms as a full search of all possible places where the sequence may map is computationally infeasible.” Sense from sequence reads: methods for alignment and assembly  Paul Flicek & Ewan Birney  Nature Methods 6, S6 - S12 (2009) Published online: 15 October 2009 Corrected online: 6 May 2010  doi:10.1038/nmeth.1376
HashTable Sense from sequence reads: methods for alignment and assembly  Paul Flicek & Ewan Birney  Nature Methods 6, S6 - S12 (2009)  doi:10.1038/nmeth.1376
SOAP1 BFAST MOSAIK Hash Reads MAQ Illumina's ELAND Hash Reference
Burrows-Wheeler Sense from sequence reads: methods for alignment and assembly  Paul Flicek & Ewan Birney  Nature Methods 6, S6 - S12 (2009)  doi:10.1038/nmeth.1376
SOAP2 Bowtie BWA
http://www.broadinstitute.org/gsa/wiki/index.php/File:ExampleDiagram.png
DE NOVO  SEQUENCING
Bruijn graphs Velvet: Algorithms for de novo short read assembly using de Bruijn graphs doi: 10.1101/gr.074492.107 Genome Res. 2008. 18: 821-829
Sense from sequence reads: methods for alignment and assembly  Paul Flicek & Ewan Birney  Nature Methods 6, S6 - S12 (2009)  doi:10.1038/nmeth.1376
CNV detection Genome Res. 2009 Sep;19(9):1586-92. Epub 2009 Aug 5. Sensitive and accurate detection of copy number variants using read depth of coverage.
RNA-SEQ http://en.wikipedia.org/wiki/File:RNA-Seq-alignment.png gene regulation protein information
Exome Sequencing http://en.wikipedia.org/wiki/File:Exome_Sequencing_Workflow_1a.png
SAM A generic nucleotide alignment format Bioinformatics. 2009 Aug 15;25(16):2078-9. Epub 2009 Jun 8. The Sequence Alignment/Map format and SAMtools.
human-readable, scriptable
Field 1: Query name Field 2: Flag Field 3: Reference sequence name Field 4: 1-based leftmost coordinate of the clipped sequence Field 5: Mapping quality Field 6: CIGAR strings Field 7: Mate reference sequence name Field 8: 1-based leftmost coordinate of the clipped sequence Field 9: Insert size (5’ to 5’) Field 10: Query sequence Field 11: Sequence qualities
1 name: SRR018111.1786  2 flag: 83 (read paired/mapped/reverse strand/first in pair) 3 refseq: chr22  4 position: 31232437 5 qual : 17 6 cigar: 76M 7 = 8 clipped pos: 31232403 9 insert size: -110 10 GGCCCTTAAAATCACAAACTATGCTCAACTCACTCTCTACAGCTCTCATAATTTCCAAAATCTATTTTCTT 11 41===@B=AA??B?B@A?BAAAABBBA@B@C<B>B@BBACBBBBBBCBBCABABBCCCBBBBCBABBBCBB 12 XT:A:U 13 NM:i:4 14 SM:i:17 15 AM:i:17 16 X0:i:1 17 X1:i:0 18 XM:i:4 19 XO:i:0 20 XG:i:0 21 MD:Z:6A34T0T8C24
Text vs. binary format
SAMFileReader inputSam = new SAMFileReader(inputSamOrBamFile); SAMFileWriter outputSam = new SAMFileWriterFactory().makeSAMOrBAMWriter(inputSam.getFileHeader(), true, outputSamOrBamFile); for ( SAMRecord samRecord : inputSam) { samRecord.setReadName(samRecord.getReadName().toUpperCase()); outputSam.addAlignment(samRecord); } outputSam.close(); inputSam.close();
compact, indexed alignments
Is flexible enough to store all the alignment information generated by various alignment programs Is simple enough to be easily generated by alignment programs or converted from existing alignment formats Is compact in file size Allows most of operations on the alignment to work on a stream without loading the whole alignment into memory Allows the file to be indexed by genomic position to efficiently retrieve all reads aligning to a locus.
CIGAR Compact Idiosyncratic Gapped Alignment Report format 'M' shows a match 'I' shows an insertion 'D' shows a deletions 'H' hard clipping 'S' soft clipping http://www.flickr.com/photos/alexbrn/3032428454/
0x0001 the read is paired in sequencing,  no matter whether it is mapped in a pair 0x0002 the read is mapped in a proper pair 0x0004 the query sequence itself is unmapped 0x0008 the mate is unmapped 1 0x0010 strand of the query (0 for forward; 1 for reverse strand) 0x0020 strand of the mate 1 0x0040 the read is the first read in a pair 1,2 0x0080 the read is the second read in a pair 1,2 0x0100 the alignment is not primary (a read having split hits may have multiple primary alignment records) 0x0200 the read fails platform/vendor quality checks 0x0400 the read is either a PCR duplicate or an optical duplicate SAM Flags
SAMTOOLS http://commons.wikimedia.org/wiki/File:Swiss_Army_Knife_Wenger_Opened_20050627.jpg
http://samtools.sourceforge.net/
http://gorgonzola.cshl.edu/pfb/2010/LectureNotes/ngs2/ngs2.pdf
Pileup seq1 272 T 24  ,.$.....,,.,.,...,,,.,..^+. <<<+;<<<<<<<<<<<=<;<;7<& seq1 273 T 23  ,.....,,.,.,...,,,.,..A <<<;<<<<<<<<<3<=<<<;<<+ seq1 274 T 23  ,.$....,,.,.,...,,,.,...  7<7;<;<<<<<<<<<=<;<;<<6 seq1 275 A 23  ,$....,,.,.,...,,,.,...^l.  <+;9*<<<<<<<<<=<<:;<<<< seq1 276 G 22  ...T,,.,.,...,,,.,....  33;+<<7=7<<7<&<<1;<<6< seq1 277 T 22  ....,,.,.,.C.,,,.,..G.  +7<;<<<<<<<&<=<<:;<<&< seq1 278 G 23  ....,,.,.,...,,,.,....^k.  %38*<<;<7<<7<=<<<;<<<<< seq1 279 C 23  A..T,,.,.,...,,,.,..... ;75&<<<<<<<<<=<<<9<<:<< Chrom Position Ref Coverage Read bases Qualities
Genome  (re)sequencing (why ?) http://www.nature.com/news/2008/080122/full/451378b.html
Map to known sequence
 
Exome Sequencing: 30,508,378 reads * 55 bp = 1,677,960,790 bb
http://vcftools.sourceforge.net/specs.html VCF format
GATK
http://www.broadinstitute.org/gsa/wiki/index.php/The_Genome_Analysis_Toolkit
 
Visualizing the alignments
Samtools: TVIEW
http://www.broadinstitute.org/software/igv/
http://www.flickr.com/photos/ohm17/162622755/
 
 
 
Download FASTA sequence for chr22 (hg18)
curl --proxy ${PROXY} &quot;http://hgdownload.cse.ucsc.edu/goldenPath/hg18/chromosomes/chr22.fa.gz&quot; |gunzip -c > chr22.fa
What's the length of chr22 ?
Index chr22 with samtools
${sam.bin} faidx chr22.fa
chr22 49691432  7 50  51
Get some FastQ files (simulation via samtools)
${sam.dir}/misc/wgsim chr22.fa reads_1.fastq reads_2.fastq > _rand.txt
Index chr22 for BWA
${bwa.bin} index -p chr22db -a bwtsw chr22.fa
5, 4 ,3 ,2 , 1 .... Align !
${bwa.bin} aln chr22db reads_1.fastq > aln1.sai ${bwa.bin} aln chr22db reads_2.fastq > aln2.sai
Generate alignments in the SAM format given paired-end reads
${bwa.bin} sampe chr22db aln1.sai aln2.sai reads_1.fastq  reads_2.fastq |  > aln.sam
Convert SAM to BAM
${sam.bin} view -b -T chr22.fa  aln.sam > aln.bam
Sort the alignments by position
${sam.bin} sort  aln.bam sorted1
Remove the PCR duplicates
${sam.bin}  rmdup sorted1.bam sorted2.bam
Index the alignment
${sam.bin} index  sorted2.bam
What's the coverage/depth ?
java -jar ${gatk.jar} -T DepthOfCoverage-o file.depth -R chr22.fa -I sorted2.bam
GATK: recalibration
http://www.broadinstitute.org/gsa/wiki/index.php/Base_quality_score_recalibration
GATK: local realignment
http://www.broadinstitute.org/gsa/wiki/index.php/File:IndelRealignmentAlgorithm.png
java -jar ${gatk.jar} -T RealignerTargetCreator -R chr22.fa -o outputs.intervals -I sorted2.bam java -jar  ${gatk.jar} -T IndelRealigner -I sorted2.bam -targetIntervals outputs.intervals -o $@ -R chr22.fa .... http://www.flickr.com/photos/didier57/2423562782/
Generate a pileup
${sam.bin} pileup -v -c -f chr22.fa realigned.bam > pileup.txt
Filter the pileup
${sam.dir}/misc/samtools.pl varFilter -d 5 pileup.txt > pileup.filtered.txt
Create a VCF
${sam.dir}/misc/sam2vcf.pl -r chr22.fa < pileup.filtered.txt > pileup.vcf
View the alignment with tview
http://sift.jcvi.org/www/SIFT_chr_coords_submit.html
$1 Coordinates : 4,99981527,1,G/A $2 Codons : - $3 Transcript ID :  $4 Protein ID :  $5 Substitution : NA $6 Region : NON-GENIC $7 dbSNP ID : NA $8 SNP Type : NA $9 Prediction : Not scored $10 Score : NA $11 Median Info : NA $12 # Seqs at position : NA $13 Gene ID : !N/A $14 Gene Name : !N/A $15 Gene Desc : !N/A $16 Protein Family ID : !N/A $17 Protein Family Desc : !N/A $18 Transcript Status : !N/A $19 Protein Family Size : !N/A $20 OMIM Disease : !N/A $21 Average Allele Freqs : !N/A $22 CEU Allele Freqs : !N/A $23 User Comment : !N/A
http://genetics.bwh.harvard.edu/pph2/bgi.shtml
$1 #o_snp_id : chr19:1779391.TC.uc010dsr.1  $2 snp_id : chr19:1779391.TC.uc010dsr.1  $3 acc : Q05DB0 $4 pos : 87 $5 aa1 : N $6 aa2 : D $7 prediction : benign $8 pph2_prob : 0.001 $9 pph2_FPR : 0.86 $10 pph2_TPR : 0.994 $11 Comments : !N/A
Give Galaxy a try
http://main.g2.bx.psu.edu/ Galaxy: A platform for interactive large-scale genome analysis: Genome Res. 2005. 15: 1451-1455
Use UCSC Table Browser to find the SNPs
Use UCSC mysql server to find the SNPs, the genes,...
Create a UCSC Custom Track
http://ged.msu.edu/angus/tutorials/ucsc-visualization.html
Wig example browser position chr19:59304200-59310700 browser hide all track type=wiggle_0 name=&quot;variableStep&quot; description=&quot;variableStep format&quot; visibility=full autoScale=off viewLimits=0.0:25.0 color=50,150,255 yLineMark=11.76 yLineOnOff=on priority=10 variableStep chrom=chr19 span=150 59304701 10.0 59304901 12.5 59305401 15.0 59305601 17.5 59305901 20.0 59306081 17.5 59306301 15.0 59306691 12.5 59307871 10.0
Create a ROR database from the VCF file
mkdir -p RAILS rails RAILS/rails4pileup  awk -F ' ' 'BEGIN {printf(&quot; create table vcfs(id integer primary key,chrom varchar(50), position int, ref varchar(2), alt varchar(50),depth int);&quot;);} {printf(&quot;insert into vcfs(chrom,position,ref,alt,depth) values(amp;quot;%samp;quot;,%s,amp;quot;%samp;quot;,amp;quot;%samp;quot;,%s);&quot;,$$1,$$2,$$3,$$4,$$5);}' pileup.filtered.txt | sqlite3 RAILS/rails4pileup/db/vcf.sqlite3 ruby RAILS/rails4pileup/script/generate scafold vcf chrom:string position:int ref:string alt:string  depth:int cat RAILS/rails4pileup/config/database.yml | sed 's/testdevelopmentproductionsqlite3/vcf.sqlite3/' > /tmp/tmp.yml mv /tmp/tmp.yml RAILS/rails4pileup/config/database.yml echo &quot;http://localhost:3000/vcfs&quot;
The end.

Más contenido relacionado

La actualidad más candente

ch8-pv1-the-virtual-filesystem
ch8-pv1-the-virtual-filesystemch8-pv1-the-virtual-filesystem
ch8-pv1-the-virtual-filesystemyushiang fu
 
ch6-pv2-device-drivers
ch6-pv2-device-driversch6-pv2-device-drivers
ch6-pv2-device-driversyushiang fu
 
System Hacking Tutorial #1 - Introduction to Vulnerability and Type of Vulner...
System Hacking Tutorial #1 - Introduction to Vulnerability and Type of Vulner...System Hacking Tutorial #1 - Introduction to Vulnerability and Type of Vulner...
System Hacking Tutorial #1 - Introduction to Vulnerability and Type of Vulner...sanghwan ahn
 
System Hacking Tutorial #2 - Buffer Overflow - Overwrite EIP
System Hacking Tutorial #2 - Buffer Overflow - Overwrite EIPSystem Hacking Tutorial #2 - Buffer Overflow - Overwrite EIP
System Hacking Tutorial #2 - Buffer Overflow - Overwrite EIPsanghwan ahn
 
TDOH x 台科 pwn課程
TDOH x 台科 pwn課程TDOH x 台科 pwn課程
TDOH x 台科 pwn課程Weber Tsai
 
NTUSTxTDOH - Pwn基礎 2015/12/27
NTUSTxTDOH - Pwn基礎 2015/12/27NTUSTxTDOH - Pwn基礎 2015/12/27
NTUSTxTDOH - Pwn基礎 2015/12/27Sheng-Hao Ma
 
Code GPU with CUDA - Identifying performance limiters
Code GPU with CUDA - Identifying performance limitersCode GPU with CUDA - Identifying performance limiters
Code GPU with CUDA - Identifying performance limitersMarina Kolpakova
 
This bioinformatics lesson is brought to you by the letter 'D'
This bioinformatics lesson is brought to you by the letter 'D'This bioinformatics lesson is brought to you by the letter 'D'
This bioinformatics lesson is brought to you by the letter 'D'Keith Bradnam
 
TDC2016POA | Trilha Ruby - Stack Level too Deep e Tail Call Optimization: É u...
TDC2016POA | Trilha Ruby - Stack Level too Deep e Tail Call Optimization: É u...TDC2016POA | Trilha Ruby - Stack Level too Deep e Tail Call Optimization: É u...
TDC2016POA | Trilha Ruby - Stack Level too Deep e Tail Call Optimization: É u...tdc-globalcode
 
04 - I love my OS, he protects me (sometimes, in specific circumstances)
04 - I love my OS, he protects me (sometimes, in specific circumstances)04 - I love my OS, he protects me (sometimes, in specific circumstances)
04 - I love my OS, he protects me (sometimes, in specific circumstances)Alexandre Moneger
 
03 - Refresher on buffer overflow in the old days
03 - Refresher on buffer overflow in the old days03 - Refresher on buffer overflow in the old days
03 - Refresher on buffer overflow in the old daysAlexandre Moneger
 
Kernel Recipes 2019 - GNU poke, an extensible editor for structured binary data
Kernel Recipes 2019 - GNU poke, an extensible editor for structured binary dataKernel Recipes 2019 - GNU poke, an extensible editor for structured binary data
Kernel Recipes 2019 - GNU poke, an extensible editor for structured binary dataAnne Nicolas
 
Design and implementation_of_shellcodes
Design and implementation_of_shellcodesDesign and implementation_of_shellcodes
Design and implementation_of_shellcodesAmr Ali
 
Code GPU with CUDA - Applying optimization techniques
Code GPU with CUDA - Applying optimization techniquesCode GPU with CUDA - Applying optimization techniques
Code GPU with CUDA - Applying optimization techniquesMarina Kolpakova
 
09 - ROP countermeasures, can we fix this?
09 - ROP countermeasures, can we fix this?09 - ROP countermeasures, can we fix this?
09 - ROP countermeasures, can we fix this?Alexandre Moneger
 
Debugging Ruby Systems
Debugging Ruby SystemsDebugging Ruby Systems
Debugging Ruby SystemsEngine Yard
 
Debugging Ruby
Debugging RubyDebugging Ruby
Debugging RubyAman Gupta
 

La actualidad más candente (20)

ch8-pv1-the-virtual-filesystem
ch8-pv1-the-virtual-filesystemch8-pv1-the-virtual-filesystem
ch8-pv1-the-virtual-filesystem
 
ch6-pv2-device-drivers
ch6-pv2-device-driversch6-pv2-device-drivers
ch6-pv2-device-drivers
 
System Hacking Tutorial #1 - Introduction to Vulnerability and Type of Vulner...
System Hacking Tutorial #1 - Introduction to Vulnerability and Type of Vulner...System Hacking Tutorial #1 - Introduction to Vulnerability and Type of Vulner...
System Hacking Tutorial #1 - Introduction to Vulnerability and Type of Vulner...
 
System Hacking Tutorial #2 - Buffer Overflow - Overwrite EIP
System Hacking Tutorial #2 - Buffer Overflow - Overwrite EIPSystem Hacking Tutorial #2 - Buffer Overflow - Overwrite EIP
System Hacking Tutorial #2 - Buffer Overflow - Overwrite EIP
 
TDOH x 台科 pwn課程
TDOH x 台科 pwn課程TDOH x 台科 pwn課程
TDOH x 台科 pwn課程
 
TimeCryption
TimeCryptionTimeCryption
TimeCryption
 
NTUSTxTDOH - Pwn基礎 2015/12/27
NTUSTxTDOH - Pwn基礎 2015/12/27NTUSTxTDOH - Pwn基礎 2015/12/27
NTUSTxTDOH - Pwn基礎 2015/12/27
 
BioMake BOSC 2004
BioMake BOSC 2004BioMake BOSC 2004
BioMake BOSC 2004
 
Code GPU with CUDA - Identifying performance limiters
Code GPU with CUDA - Identifying performance limitersCode GPU with CUDA - Identifying performance limiters
Code GPU with CUDA - Identifying performance limiters
 
This bioinformatics lesson is brought to you by the letter 'D'
This bioinformatics lesson is brought to you by the letter 'D'This bioinformatics lesson is brought to you by the letter 'D'
This bioinformatics lesson is brought to you by the letter 'D'
 
TDC2016POA | Trilha Ruby - Stack Level too Deep e Tail Call Optimization: É u...
TDC2016POA | Trilha Ruby - Stack Level too Deep e Tail Call Optimization: É u...TDC2016POA | Trilha Ruby - Stack Level too Deep e Tail Call Optimization: É u...
TDC2016POA | Trilha Ruby - Stack Level too Deep e Tail Call Optimization: É u...
 
04 - I love my OS, he protects me (sometimes, in specific circumstances)
04 - I love my OS, he protects me (sometimes, in specific circumstances)04 - I love my OS, he protects me (sometimes, in specific circumstances)
04 - I love my OS, he protects me (sometimes, in specific circumstances)
 
03 - Refresher on buffer overflow in the old days
03 - Refresher on buffer overflow in the old days03 - Refresher on buffer overflow in the old days
03 - Refresher on buffer overflow in the old days
 
Kernel Recipes 2019 - GNU poke, an extensible editor for structured binary data
Kernel Recipes 2019 - GNU poke, an extensible editor for structured binary dataKernel Recipes 2019 - GNU poke, an extensible editor for structured binary data
Kernel Recipes 2019 - GNU poke, an extensible editor for structured binary data
 
Design and implementation_of_shellcodes
Design and implementation_of_shellcodesDesign and implementation_of_shellcodes
Design and implementation_of_shellcodes
 
Code GPU with CUDA - Applying optimization techniques
Code GPU with CUDA - Applying optimization techniquesCode GPU with CUDA - Applying optimization techniques
Code GPU with CUDA - Applying optimization techniques
 
No more dumb hex!
No more dumb hex!No more dumb hex!
No more dumb hex!
 
09 - ROP countermeasures, can we fix this?
09 - ROP countermeasures, can we fix this?09 - ROP countermeasures, can we fix this?
09 - ROP countermeasures, can we fix this?
 
Debugging Ruby Systems
Debugging Ruby SystemsDebugging Ruby Systems
Debugging Ruby Systems
 
Debugging Ruby
Debugging RubyDebugging Ruby
Debugging Ruby
 

Destacado

Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencingDayananda Salam
 
Next Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology OverviewNext Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology OverviewDominic Suciu
 
Next Gen Sequencing Technologies Overview
Next Gen Sequencing Technologies OverviewNext Gen Sequencing Technologies Overview
Next Gen Sequencing Technologies OverviewPatrick Merel
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencingTapish Goel
 
New Generation Sequencing Technologies: an overview
New Generation Sequencing Technologies: an overviewNew Generation Sequencing Technologies: an overview
New Generation Sequencing Technologies: an overviewPaolo Dametto
 
NGS technologies - platforms and applications
NGS technologies - platforms and applicationsNGS technologies - platforms and applications
NGS technologies - platforms and applicationsAGRF_Ltd
 
A Comparison of NGS Platforms.
A Comparison of NGS Platforms.A Comparison of NGS Platforms.
A Comparison of NGS Platforms.mkim8
 
NGS - Basic principles and sequencing platforms
NGS - Basic principles and sequencing platformsNGS - Basic principles and sequencing platforms
NGS - Basic principles and sequencing platformsAnnelies Haegeman
 
Biology folding
Biology folding Biology folding
Biology folding Annaortiz95
 
The Game of Bug Bounty Hunting - Money, Drama, Action and Fame
The Game of Bug Bounty Hunting - Money, Drama, Action and FameThe Game of Bug Bounty Hunting - Money, Drama, Action and Fame
The Game of Bug Bounty Hunting - Money, Drama, Action and FameAbhinav Mishra
 
3 nov 2016 sab ki khabren
3 nov 2016 sab ki khabren3 nov 2016 sab ki khabren
3 nov 2016 sab ki khabrenSantosh Tiwari
 
Audioemotion The radiodays Conference 2012 Barcelona
Audioemotion The radiodays Conference 2012 BarcelonaAudioemotion The radiodays Conference 2012 Barcelona
Audioemotion The radiodays Conference 2012 BarcelonaCreaTECH540º
 
Engl 1221 bauer spring 2014
Engl 1221 bauer spring 2014Engl 1221 bauer spring 2014
Engl 1221 bauer spring 2014Traciwm
 
Barco Turanor PlanetSolar pelo mundo!
Barco Turanor PlanetSolar pelo mundo!Barco Turanor PlanetSolar pelo mundo!
Barco Turanor PlanetSolar pelo mundo!Venine Ribas
 
Sd Productions
Sd ProductionsSd Productions
Sd Productionsmdevreede
 

Destacado (20)

Introduction to next generation sequencing
Introduction to next generation sequencingIntroduction to next generation sequencing
Introduction to next generation sequencing
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencing
 
Next Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology OverviewNext Gen Sequencing (NGS) Technology Overview
Next Gen Sequencing (NGS) Technology Overview
 
Ngs ppt
Ngs pptNgs ppt
Ngs ppt
 
Next Gen Sequencing Technologies Overview
Next Gen Sequencing Technologies OverviewNext Gen Sequencing Technologies Overview
Next Gen Sequencing Technologies Overview
 
Next generation sequencing
Next generation sequencingNext generation sequencing
Next generation sequencing
 
New Generation Sequencing Technologies: an overview
New Generation Sequencing Technologies: an overviewNew Generation Sequencing Technologies: an overview
New Generation Sequencing Technologies: an overview
 
NGS technologies - platforms and applications
NGS technologies - platforms and applicationsNGS technologies - platforms and applications
NGS technologies - platforms and applications
 
A Comparison of NGS Platforms.
A Comparison of NGS Platforms.A Comparison of NGS Platforms.
A Comparison of NGS Platforms.
 
NGS - Basic principles and sequencing platforms
NGS - Basic principles and sequencing platformsNGS - Basic principles and sequencing platforms
NGS - Basic principles and sequencing platforms
 
Biology folding
Biology folding Biology folding
Biology folding
 
The Game of Bug Bounty Hunting - Money, Drama, Action and Fame
The Game of Bug Bounty Hunting - Money, Drama, Action and FameThe Game of Bug Bounty Hunting - Money, Drama, Action and Fame
The Game of Bug Bounty Hunting - Money, Drama, Action and Fame
 
Q3 2011 Industrial Report
Q3 2011 Industrial ReportQ3 2011 Industrial Report
Q3 2011 Industrial Report
 
3 nov 2016 sab ki khabren
3 nov 2016 sab ki khabren3 nov 2016 sab ki khabren
3 nov 2016 sab ki khabren
 
Audioemotion The radiodays Conference 2012 Barcelona
Audioemotion The radiodays Conference 2012 BarcelonaAudioemotion The radiodays Conference 2012 Barcelona
Audioemotion The radiodays Conference 2012 Barcelona
 
Engl 1221 bauer spring 2014
Engl 1221 bauer spring 2014Engl 1221 bauer spring 2014
Engl 1221 bauer spring 2014
 
Barco Turanor PlanetSolar pelo mundo!
Barco Turanor PlanetSolar pelo mundo!Barco Turanor PlanetSolar pelo mundo!
Barco Turanor PlanetSolar pelo mundo!
 
Outdoor Training para empresas - Grupo ioe
Outdoor Training para empresas - Grupo ioeOutdoor Training para empresas - Grupo ioe
Outdoor Training para empresas - Grupo ioe
 
Sd Productions
Sd ProductionsSd Productions
Sd Productions
 
Microfiltración apical en piezas dentarias unirradiculares, obturadas con las...
Microfiltración apical en piezas dentarias unirradiculares, obturadas con las...Microfiltración apical en piezas dentarias unirradiculares, obturadas con las...
Microfiltración apical en piezas dentarias unirradiculares, obturadas con las...
 

Similar a 20110114 Next Generation Sequencing Course

Marko Gargenta_Remixing android
Marko Gargenta_Remixing androidMarko Gargenta_Remixing android
Marko Gargenta_Remixing androidDroidcon Berlin
 
Tutorial ESWC2011 Building Semantic Sensor Web - 04 - Querying_semantic_strea...
Tutorial ESWC2011 Building Semantic Sensor Web - 04 - Querying_semantic_strea...Tutorial ESWC2011 Building Semantic Sensor Web - 04 - Querying_semantic_strea...
Tutorial ESWC2011 Building Semantic Sensor Web - 04 - Querying_semantic_strea...Jean-Paul Calbimonte
 
Computer notes data structures - 9
Computer notes   data structures - 9Computer notes   data structures - 9
Computer notes data structures - 9ecomputernotes
 
Introduction to Compiler Development
Introduction to Compiler DevelopmentIntroduction to Compiler Development
Introduction to Compiler DevelopmentLogan Chien
 
The true story_of_hello_world
The true story_of_hello_worldThe true story_of_hello_world
The true story_of_hello_worldfantasy zheng
 
String Comparison Surprises: Did Postgres lose my data?
String Comparison Surprises: Did Postgres lose my data?String Comparison Surprises: Did Postgres lose my data?
String Comparison Surprises: Did Postgres lose my data?Jeremy Schneider
 
(Slightly) Smarter Smart Pointers
(Slightly) Smarter Smart Pointers(Slightly) Smarter Smart Pointers
(Slightly) Smarter Smart PointersCarlo Pescio
 
Open Source Systems Performance
Open Source Systems PerformanceOpen Source Systems Performance
Open Source Systems PerformanceBrendan Gregg
 
Petascale Genomics (Strata Singapore 20151203)
Petascale Genomics (Strata Singapore 20151203)Petascale Genomics (Strata Singapore 20151203)
Petascale Genomics (Strata Singapore 20151203)Uri Laserson
 
Eta lang Beauty And The Beast
Eta lang Beauty And The Beast Eta lang Beauty And The Beast
Eta lang Beauty And The Beast Jarek Ratajski
 
Kamil witecki asynchronous, yet readable, code
Kamil witecki asynchronous, yet readable, codeKamil witecki asynchronous, yet readable, code
Kamil witecki asynchronous, yet readable, codeKamil Witecki
 
Rooted 2010 ppp
Rooted 2010 pppRooted 2010 ppp
Rooted 2010 pppnoc_313
 
Android & PostgreSQL
Android & PostgreSQLAndroid & PostgreSQL
Android & PostgreSQLMark Wong
 
Linuxカーネルを読んで改めて知るプロセスとスレッドの違い
Linuxカーネルを読んで改めて知るプロセスとスレッドの違いLinuxカーネルを読んで改めて知るプロセスとスレッドの違い
Linuxカーネルを読んで改めて知るプロセスとスレッドの違いRetrieva inc.
 
Introduction to Kernel Programming
Introduction to Kernel ProgrammingIntroduction to Kernel Programming
Introduction to Kernel ProgrammingAhmed Mekkawy
 

Similar a 20110114 Next Generation Sequencing Course (20)

Marko Gargenta_Remixing android
Marko Gargenta_Remixing androidMarko Gargenta_Remixing android
Marko Gargenta_Remixing android
 
Tutorial ESWC2011 Building Semantic Sensor Web - 04 - Querying_semantic_strea...
Tutorial ESWC2011 Building Semantic Sensor Web - 04 - Querying_semantic_strea...Tutorial ESWC2011 Building Semantic Sensor Web - 04 - Querying_semantic_strea...
Tutorial ESWC2011 Building Semantic Sensor Web - 04 - Querying_semantic_strea...
 
Computer notes data structures - 9
Computer notes   data structures - 9Computer notes   data structures - 9
Computer notes data structures - 9
 
Odp
OdpOdp
Odp
 
CompilersAndLibraries
CompilersAndLibrariesCompilersAndLibraries
CompilersAndLibraries
 
Introduction to Compiler Development
Introduction to Compiler DevelopmentIntroduction to Compiler Development
Introduction to Compiler Development
 
The true story_of_hello_world
The true story_of_hello_worldThe true story_of_hello_world
The true story_of_hello_world
 
String Comparison Surprises: Did Postgres lose my data?
String Comparison Surprises: Did Postgres lose my data?String Comparison Surprises: Did Postgres lose my data?
String Comparison Surprises: Did Postgres lose my data?
 
(Slightly) Smarter Smart Pointers
(Slightly) Smarter Smart Pointers(Slightly) Smarter Smart Pointers
(Slightly) Smarter Smart Pointers
 
Open Source Systems Performance
Open Source Systems PerformanceOpen Source Systems Performance
Open Source Systems Performance
 
Petascale Genomics (Strata Singapore 20151203)
Petascale Genomics (Strata Singapore 20151203)Petascale Genomics (Strata Singapore 20151203)
Petascale Genomics (Strata Singapore 20151203)
 
Eta lang Beauty And The Beast
Eta lang Beauty And The Beast Eta lang Beauty And The Beast
Eta lang Beauty And The Beast
 
Similarity
SimilaritySimilarity
Similarity
 
Kamil witecki asynchronous, yet readable, code
Kamil witecki asynchronous, yet readable, codeKamil witecki asynchronous, yet readable, code
Kamil witecki asynchronous, yet readable, code
 
Rooted 2010 ppp
Rooted 2010 pppRooted 2010 ppp
Rooted 2010 ppp
 
Android & PostgreSQL
Android & PostgreSQLAndroid & PostgreSQL
Android & PostgreSQL
 
Linuxカーネルを読んで改めて知るプロセスとスレッドの違い
Linuxカーネルを読んで改めて知るプロセスとスレッドの違いLinuxカーネルを読んで改めて知るプロセスとスレッドの違い
Linuxカーネルを読んで改めて知るプロセスとスレッドの違い
 
Scalaxb preso
Scalaxb presoScalaxb preso
Scalaxb preso
 
Introduction to Kernel Programming
Introduction to Kernel ProgrammingIntroduction to Kernel Programming
Introduction to Kernel Programming
 
jvm goes to big data
jvm goes to big datajvm goes to big data
jvm goes to big data
 

Más de Pierre Lindenbaum (20)

Mum, I 3D printed a gel comb !
Mum, I 3D printed a gel comb !Mum, I 3D printed a gel comb !
Mum, I 3D printed a gel comb !
 
Advanced NCBI
Advanced NCBI Advanced NCBI
Advanced NCBI
 
Building a Simple LIMS with the Eclipse Modeling Framework (EMF) ,my notebook
Building a Simple LIMS with the Eclipse Modeling Framework (EMF) ,my notebookBuilding a Simple LIMS with the Eclipse Modeling Framework (EMF) ,my notebook
Building a Simple LIMS with the Eclipse Modeling Framework (EMF) ,my notebook
 
Make
MakeMake
Make
 
XML for bioinformatics
XML for bioinformaticsXML for bioinformatics
XML for bioinformatics
 
20120423.NGS.Rennes
20120423.NGS.Rennes20120423.NGS.Rennes
20120423.NGS.Rennes
 
Sketching 20120412
Sketching 20120412Sketching 20120412
Sketching 20120412
 
Introduction to mongodb for bioinformatics
Introduction to mongodb for bioinformaticsIntroduction to mongodb for bioinformatics
Introduction to mongodb for bioinformatics
 
Biostar17037
Biostar17037Biostar17037
Biostar17037
 
Tweeting for the BioStar Paper
Tweeting for the BioStar PaperTweeting for the BioStar Paper
Tweeting for the BioStar Paper
 
Variation Toolkit
Variation ToolkitVariation Toolkit
Variation Toolkit
 
Bioinformatician 2.0
Bioinformatician 2.0Bioinformatician 2.0
Bioinformatician 2.0
 
Analyzing Exome Data with KNIME
Analyzing Exome Data with KNIMEAnalyzing Exome Data with KNIME
Analyzing Exome Data with KNIME
 
NOTCH2 backstage
NOTCH2 backstageNOTCH2 backstage
NOTCH2 backstage
 
Bioinfo tweets
Bioinfo tweetsBioinfo tweets
Bioinfo tweets
 
Post doctoriales 2011
Post doctoriales 2011Post doctoriales 2011
Post doctoriales 2011
 
MyWordle.java
MyWordle.javaMyWordle.java
MyWordle.java
 
Biblio2.0
Biblio2.0Biblio2.0
Biblio2.0
 
Me & Biohackathon 2010
Me & Biohackathon 2010Me & Biohackathon 2010
Me & Biohackathon 2010
 
An implementation of Jan Aerts' LocusTree
An implementation of Jan Aerts' LocusTreeAn implementation of Jan Aerts' LocusTree
An implementation of Jan Aerts' LocusTree
 

Último

The Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsThe Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsPixlogix Infotech
 
DSPy a system for AI to Write Prompts and Do Fine Tuning
DSPy a system for AI to Write Prompts and Do Fine TuningDSPy a system for AI to Write Prompts and Do Fine Tuning
DSPy a system for AI to Write Prompts and Do Fine TuningLars Bell
 
Gen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdfGen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdfAddepto
 
Digital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptxDigital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptxLoriGlavin3
 
What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024Stephanie Beckett
 
Dev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio WebDev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio WebUiPathCommunity
 
Hyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdf
Hyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdfHyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdf
Hyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdfPrecisely
 
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024BookNet Canada
 
SAP Build Work Zone - Overview L2-L3.pptx
SAP Build Work Zone - Overview L2-L3.pptxSAP Build Work Zone - Overview L2-L3.pptx
SAP Build Work Zone - Overview L2-L3.pptxNavinnSomaal
 
Unraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdfUnraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdfAlex Barbosa Coqueiro
 
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxMerck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxLoriGlavin3
 
The State of Passkeys with FIDO Alliance.pptx
The State of Passkeys with FIDO Alliance.pptxThe State of Passkeys with FIDO Alliance.pptx
The State of Passkeys with FIDO Alliance.pptxLoriGlavin3
 
Developer Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQLDeveloper Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQLScyllaDB
 
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024BookNet Canada
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 3652toLead Limited
 
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek SchlawackFwdays
 
Scanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsScanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsRizwan Syed
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity PlanDatabarracks
 
Commit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easyCommit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easyAlfredo García Lavilla
 
Streamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project SetupStreamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project SetupFlorian Wilhelm
 

Último (20)

The Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and ConsThe Ultimate Guide to Choosing WordPress Pros and Cons
The Ultimate Guide to Choosing WordPress Pros and Cons
 
DSPy a system for AI to Write Prompts and Do Fine Tuning
DSPy a system for AI to Write Prompts and Do Fine TuningDSPy a system for AI to Write Prompts and Do Fine Tuning
DSPy a system for AI to Write Prompts and Do Fine Tuning
 
Gen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdfGen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdf
 
Digital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptxDigital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptx
 
What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024
 
Dev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio WebDev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio Web
 
Hyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdf
Hyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdfHyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdf
Hyperautomation and AI/ML: A Strategy for Digital Transformation Success.pdf
 
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
 
SAP Build Work Zone - Overview L2-L3.pptx
SAP Build Work Zone - Overview L2-L3.pptxSAP Build Work Zone - Overview L2-L3.pptx
SAP Build Work Zone - Overview L2-L3.pptx
 
Unraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdfUnraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdf
 
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptxMerck Moving Beyond Passwords: FIDO Paris Seminar.pptx
Merck Moving Beyond Passwords: FIDO Paris Seminar.pptx
 
The State of Passkeys with FIDO Alliance.pptx
The State of Passkeys with FIDO Alliance.pptxThe State of Passkeys with FIDO Alliance.pptx
The State of Passkeys with FIDO Alliance.pptx
 
Developer Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQLDeveloper Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQL
 
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365
 
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
"Subclassing and Composition – A Pythonic Tour of Trade-Offs", Hynek Schlawack
 
Scanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsScanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL Certs
 
How to write a Business Continuity Plan
How to write a Business Continuity PlanHow to write a Business Continuity Plan
How to write a Business Continuity Plan
 
Commit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easyCommit 2024 - Secret Management made easy
Commit 2024 - Secret Management made easy
 
Streamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project SetupStreamlining Python Development: A Guide to a Modern Project Setup
Streamlining Python Development: A Guide to a Modern Project Setup
 

20110114 Next Generation Sequencing Course

Notas del editor

  1. Samples consisting of longer fragments are first sheared into a random library of 100-300 base-pair long fragments. After fragmentation the ends of the obtained DNA-fragments are repaired and an A-overhang is added at the 3&apos;-end of each strand. Afterwards, adaptors which are necessary for amplification and sequencing are ligated to both ends of the DNA-fragments. These fragments are then size selected and purified.
  2. From the following article Next-generation DNA sequencing Jay Shendure &amp; Hanlee Ji Nature Biotechnology 26, 1135 - 1145 (2008) Published online: 9 October 2008 doi:10.1038/nbt1486 (a) The 454, the Polonator and SOLiD platforms rely on emulsion PCR20 to amplify clonal sequencing features. In brief, an in vitro–constructed adaptor-flanked shotgun library (shown as gold and turquoise adaptors flanking unique inserts) is PCR amplified (that is, multi-template PCR, not multiplex PCR, as only a single primer pair is used, corresponding to the gold and turquoise adaptors) in the context of a water-in-oil emulsion. One of the PCR primers is tethered to the surface (5&apos;-attached) of micron-scale beads that are also included in the reaction. A low template concentration results in most bead-containing compartments having either zero or one template molecule present. In productive emulsion compartments (where both a bead and template molecule is present), PCR amplicons are captured to the surface of the bead. After breaking the emulsion, beads bearing amplification products can be selectively enriched. Each clonally amplified bead will bear on its surface PCR products corresponding to amplification of a single molecule from the template library. (b) The Solexa technology relies on bridge PCR21, 22 (aka &apos;cluster PCR&apos;) to amplify clonal sequencing features. In brief, an in vitro–constructed adaptor-flanked shotgun library is PCR amplified, but both primers densely coat the surface of a solid substrate, attached at their 5&apos; ends by a flexible linker. As a consequence, amplification products originating from any given member of the template library remain locally tethered near the point of origin. At the conclusion of the PCR, each clonal cluster contains approx1,000 copies of a single member of the template library. Accurate measurement of the concentration of the template library is critical to maximize the cluster density while simultaneously avoiding overcrowding.
  3. During sequencing the huge amount of generated clusters are sequenced simultaneously. The DNA-templates are copied base by base using the four nucleotides (ACGT) which are fluorescently-labeled and reversibly terminated. After each synthesis step, the clusters are excited by a laser which causes fluorescence of the last incorporated base. After that, the fluorescence label and the blocking group are removed allowing the addition of the next base. The flourescence signal after each incorporation step is captured by a built-in camera, producing images of the flow cell.
  4. The emPCR amplifies each fragment several million times. After amplification the emulsion shell is broken and the clonally amplified beads are ready for loading onto the fibre-optic PicoTiterDevice for sequencing.
  5. he template strand is represented in red, the annealed primer is shown in black and the DNA polymerase is shown as the green oval. Incorporation of the complementary base (the blue &amp;quot;G&amp;quot;) generates inorganic pyrophosphate (PPi), which is converted to ATP by the sulfurylase (blue arrow). Luciferase (red arrow) uses the ATP to convert luciferin to oxyluciferin, producing light.
  6. Genome Biol. 2009; 10(3): R32. Published online 2009 March 27. doi: 10.1186/gb-2009-10-3-r32. PMCID: PMC2691003 Copyright © 2009 Harismendy et al.; licensee BioMed Central Ltd. Evaluation of next generation sequencing platforms for population targeted sequencing studies Olivier Harismendy,#1 Pauline C Ng,#2 Robert L Strausberg,2 Xiaoyun Wang,1 Timothy B Stockwell,2 Karen Y Beeson,2 Nicholas J Schork,1 Sarah S Murray,1 Eric J Topol,1 Samuel Levy,corresponding author2 and Kelly A Frazercorresponding author1 Performance metrics of NGS technologies. (a-f) Error bars represent minimum and maximum values obtained from the four samples. (g-i) Venn diagram representation of false positive calls (g), false negative calls (h) and discrepant variants calls (i). The inset caption displays the color-coding of each NGS technology and overlaps: for Roche 454 (red), Illumina GA (yellow) and ABI SOLiD (blue). For each NGS platform the number of base calls with errors associated with specific sequence contexts is given (repeat = repetitive element). When two sequence contexts are present they are both listed.
  7. Historical trends in storage prices versus DNA sequencing costs. The blue squares describe the historic cost of disk prices in megabytes per US dollar. The long-term trend (blue line, which is a straight line here because the plot is logarithmic) shows exponential growth in storage per dollar with a doubling time of roughly 1.5 years. The cost of DNA sequencing, expressed in base pairs per dollar, is shown by the red triangles. It follows an exponential curve (yellow line) with a doubling time slightly slower than disk storage until 2004, when next generation sequencing (NGS) causes an inflection in the curve to a doubling time of less than 6 months (red line). These curves are not corrected for inflation or for the &apos;fully loaded&apos; cost of sequencing and disk storage, which would include personnel costs, depreciation and overhead.
  8. Cloud computing and the DNA data race Journal name: Nature Biotechnology Volume: 28, Pages: 691–693 Year published: (2010) DOI: doi:10.1038/nbt0710-691
  9. HWUSI-EAS100R the unique instrument name 6 flowcell lane 73 tile number within the flowcell lane 941 &apos;x&apos;-coordinate of the cluster within the tile 1973 &apos;y&apos;-coordinate of the cluster within the tile #0 index number for a multiplexed sample (0 for no indexing) /1 the member of a pair, /1 or /2 (paired-end or mate-pair reads only)
  10. TDe novo fragment assembly with short mate-paired reads: Does the read length matter?, doi: 10.1101/gr.079053.108 Genome Res. 2009. 19: 336-346 positional profile of base-calling errors for Illumina reads for 2 million 50-nt-long reads from a human BAC. The error rate across reads is shown (solid line) along with the error rate for reads with a fixed number of errors. The erroneous nucleotides in each read are detected by mapping the read to the reference genome. The high error rate in position 6 is due to the bias in our particular data set rather than a systematic problem with the Illumina technology.
  11. Sequence reads with associated read identifiers are shown, with the regions that will be used for seed selection in capital letters and matched seeds of 0011 and 1100. Given read identifiers are associated with the seeds using a hash function (for example, a unique integer representation of each seed). Once such a hash table has been built for either the input read set or the reference genome, the corresponding data can be scanned with the same hash function, resulting in a much smaller subset of reads to more exactly align at each location in the genome.
  12. Schematic representation of our implementation of the de Bruijn graph. Each node, represented by a single rectangle, represents a series of overlapping k-mers (in this case, k = 5), listed directly above or below. (Red) The last nucleotide of each k-mer. The sequence of those final nucleotides, copied in large letters in the rectangle, is the sequence of the node. The twin node, directly attached to the node, either below or above, represents the reverse series of reverse complement k-mers. Arcs are represented as arrows between nodes. The last k-mer of an arc’s origin overlaps with the first of its destination. Each arc has a symmetric arc. Note that the two nodes on the left could be merged into one without loss of information, because they form a chain.
  13. Genome Res. 2009 Sep;19(9):1586-92. Epub 2009 Aug 5. Sensitive and accurate detection of copy number variants using read depth of coverage. Yoon S, Xuan Z, Makarov V, Ye K, Sebat J. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724, USA.
  14. cut -d &apos; &apos; -f 1,2 pileup.filtered.txt | awk &apos;{printf(&amp;quot;%s\\t%d\\t%d\\n&amp;quot;,$1,int($2)-1,int($2));}&apos; &gt; $@