SlideShare una empresa de Scribd logo
1 de 10
Assessing unintended
hybridization induced
biological effects of
oligonucleotides
Based on a position paper by
Oligonucleotide Safety Working Group
Subcommittee on Off-target assessment

Draft position paper has been distributed with meeting materials


NIH RNA Oligonucleotides Meeting, December 2011


Presented by Morten Lindow, mol@santaris.com
The ‘off-target subcommittee’
•   Arthur A. Levin, Santaris Pharma A/S
•   Donald Riley, DNA Consulting, LLC
•   Douglas J. Kornbrust, Preclinsight
•   Hans-Peter Vornlocher, Roche Kulmbach GmbH
•   Husam Younis, Isis Pharmaceuticals
•   James D. Thompson, Quark
•   Joanne Kamens, RXi Pharmaceuticals
•   Joel Parry, GlaxoSmithKline R&D Ltd.
•   Morten Lindow, Santaris Pharma A/S
•   Nicolay Ferrari, Topigen Pharmaceuticals Inc.
•   Sara Nochur, Alnylam
•   Scott P. Henry, Isis Pharmaceuticals
•   Steven Bartz, Merck Inc
Mechanisms of toxicity for
   oligonucleotides




    Scope of this session: off-target toxicity = toxicity caused by the Watson-Crick
    basepairing between an oligonucleotide and an unintended target

Bennett et al. Annu. Rev. Pharmacol. Toxicol. 2010.50:259-293
Predictability of putative off-
targets is a strength
Protein <– small molecule               RNA <- oligonucleotide




                                                  CGCUGUGAGGUG
                                                  GUA
                                         …GGGCGACACUCCACCAUGAAU……
                                                  |||||||||||||||
                                                 ?
                                                             ?
                                …GGGCGACACUCCACCAUAUCCGCUAUCUAGAAU……
                                                                     ?
                                                    …GGGCGACACUCCACCAUAUCCGCUAUCUAGAAU……

                                     …GGGCGACACUCCACCAUAUCCGCUAUCUAGAAU……




In silico drug design and               In silico drug design and
specificity assesment is HARD           specificity assesment is ‘EASY’
Recommendation #1: “Candidate drug sequences (ASO and siRNAs) should
be selected to minimize potential binding to and inhibitory activity on
unintended RNAs“

 • Perhaps not so “EASY”
 • Specificity is a quantitative trait. The objective is to:
    • Maximize effect on intended target knock down, while minimizing
      effect on off-target knockdown
 • Molecular factors governing activity of an oligonucleotide on
   an RNA (off)-target
    • Affinity to (off)-target site
    • Tolerance of RISC and RNAseH
       • Position of mismatches and bulges, possible context requirements
    • Target site accessibility (RNA folding, protein binding)
In silico screening of
candidates
• In silico algorithms will never be perfect
• Algorithms will depend on
  • mechanism (RNAseH, RISC, steric block)
  • chemistry of the oligonucleotide
• Algorithms are under continuous development to align with
  increasing experimental data
  •  Merck talk
  •  Santaris talk
Recommendation #2: Interpretation of
in silico predicted off-targets
• In vivo expression pattern of the off-target RNA
  • Overlap with tissues of drug accumulation
• Function of off-target RNA
  • knock-out / knock-down phenotype
  • OMIM etc
• Is the off-target site also present in species used in toxicity
  studies?
Experimental follow-up on
critical off-target hits
• Validation. Relative potency between on- and off-target
  • E.g. qPCR in human cell lines.
Recommendation #3: in vivo
preclinical tox studies
• Oligonucleotides are not essentially different from other drug
  classes
• Penultimate test of relevance of off-target findings are in vivo
  studies in animal models
• Understanding that the only way to truly test for human
  responses is in carefully controlled and monitored clinical
  trials
Candidate
                                                     oligonucleotide drug


 Summary                 Technology
                            and                        In silico off-target
                         mechanism                                                                Database of
                                                              screen                               transcripts
                           based

• Off-target screening   algorithms




  is only one among           Case by case evaluation of putative off-targets may include:


  many other factors             Comparison of tissue
                                   expression of off-                         Function of putative
                                                                              off-target if known,
                                   target with tissue
  used to select                 accumulation of drug
                                       candidate
                                                                               e.g. phenotype of
                                                                               genetic knock-out

  compounds                       In vitro validation of
                                   critical putative off-                 off-target present in
                                          targets.                            tox species?
                                    Relative IC50 in
                                     human cell line




                                      Penultimate test: Preclinical toxicity studies in vivo




                                                         Proceed to human
                                                              testing

Más contenido relacionado

La actualidad más candente

Target selection lead discovery medicinal drug discovery strategy style desig...
Target selection lead discovery medicinal drug discovery strategy style desig...Target selection lead discovery medicinal drug discovery strategy style desig...
Target selection lead discovery medicinal drug discovery strategy style desig...
SlideTeam.net
 
Target selection lead discovery medicinal drug discovery strategy style desig...
Target selection lead discovery medicinal drug discovery strategy style desig...Target selection lead discovery medicinal drug discovery strategy style desig...
Target selection lead discovery medicinal drug discovery strategy style desig...
SlideTeam.net
 
Target selection lead discovery medicinal drug discovery process design 5 pow...
Target selection lead discovery medicinal drug discovery process design 5 pow...Target selection lead discovery medicinal drug discovery process design 5 pow...
Target selection lead discovery medicinal drug discovery process design 5 pow...
SlideTeam.net
 
Target selection lead discovery medicinal drug discovery strategy design 5 po...
Target selection lead discovery medicinal drug discovery strategy design 5 po...Target selection lead discovery medicinal drug discovery strategy design 5 po...
Target selection lead discovery medicinal drug discovery strategy design 5 po...
SlideTeam.net
 
Target selection lead discovery medicinal drug discovery process style design...
Target selection lead discovery medicinal drug discovery process style design...Target selection lead discovery medicinal drug discovery process style design...
Target selection lead discovery medicinal drug discovery process style design...
SlideTeam.net
 
Target selection lead discovery medicinal drug discovery strategy design 5 po...
Target selection lead discovery medicinal drug discovery strategy design 5 po...Target selection lead discovery medicinal drug discovery strategy design 5 po...
Target selection lead discovery medicinal drug discovery strategy design 5 po...
SlideTeam.net
 
Target selection lead discovery medicinal drug discovery strategy style desig...
Target selection lead discovery medicinal drug discovery strategy style desig...Target selection lead discovery medicinal drug discovery strategy style desig...
Target selection lead discovery medicinal drug discovery strategy style desig...
SlideTeam.net
 
Target selection lead discovery medicinal drug discovery strategy design 5 po...
Target selection lead discovery medicinal drug discovery strategy design 5 po...Target selection lead discovery medicinal drug discovery strategy design 5 po...
Target selection lead discovery medicinal drug discovery strategy design 5 po...
SlideTeam.net
 
Drug discovery process style 5 powerpoint presentation slides db ppt templates
Drug discovery process style 5 powerpoint presentation slides db ppt templatesDrug discovery process style 5 powerpoint presentation slides db ppt templates
Drug discovery process style 5 powerpoint presentation slides db ppt templates
SlideTeam.net
 
Target selection lead discovery medicinal drug discovery process design 5 pow...
Target selection lead discovery medicinal drug discovery process design 5 pow...Target selection lead discovery medicinal drug discovery process design 5 pow...
Target selection lead discovery medicinal drug discovery process design 5 pow...
SlideTeam.net
 
Target selection lead discovery medicinal drug discovery process design 5 pow...
Target selection lead discovery medicinal drug discovery process design 5 pow...Target selection lead discovery medicinal drug discovery process design 5 pow...
Target selection lead discovery medicinal drug discovery process design 5 pow...
SlideTeam.net
 
Promiscuous patterns and perils in PubChem and the MLSCN
Promiscuous patterns and perils in PubChem and the MLSCNPromiscuous patterns and perils in PubChem and the MLSCN
Promiscuous patterns and perils in PubChem and the MLSCN
Jeremy Yang
 
Drug discovery process style 3 powerpoint presentation templates
Drug discovery process style 3 powerpoint presentation templatesDrug discovery process style 3 powerpoint presentation templates
Drug discovery process style 3 powerpoint presentation templates
SlideTeam.net
 

La actualidad más candente (14)

Target selection lead discovery medicinal drug discovery strategy style desig...
Target selection lead discovery medicinal drug discovery strategy style desig...Target selection lead discovery medicinal drug discovery strategy style desig...
Target selection lead discovery medicinal drug discovery strategy style desig...
 
Target selection lead discovery medicinal drug discovery strategy style desig...
Target selection lead discovery medicinal drug discovery strategy style desig...Target selection lead discovery medicinal drug discovery strategy style desig...
Target selection lead discovery medicinal drug discovery strategy style desig...
 
Target selection lead discovery medicinal drug discovery process design 5 pow...
Target selection lead discovery medicinal drug discovery process design 5 pow...Target selection lead discovery medicinal drug discovery process design 5 pow...
Target selection lead discovery medicinal drug discovery process design 5 pow...
 
Target selection lead discovery medicinal drug discovery strategy design 5 po...
Target selection lead discovery medicinal drug discovery strategy design 5 po...Target selection lead discovery medicinal drug discovery strategy design 5 po...
Target selection lead discovery medicinal drug discovery strategy design 5 po...
 
Target selection lead discovery medicinal drug discovery process style design...
Target selection lead discovery medicinal drug discovery process style design...Target selection lead discovery medicinal drug discovery process style design...
Target selection lead discovery medicinal drug discovery process style design...
 
Target selection lead discovery medicinal drug discovery strategy design 5 po...
Target selection lead discovery medicinal drug discovery strategy design 5 po...Target selection lead discovery medicinal drug discovery strategy design 5 po...
Target selection lead discovery medicinal drug discovery strategy design 5 po...
 
Target selection lead discovery medicinal drug discovery strategy style desig...
Target selection lead discovery medicinal drug discovery strategy style desig...Target selection lead discovery medicinal drug discovery strategy style desig...
Target selection lead discovery medicinal drug discovery strategy style desig...
 
Target selection lead discovery medicinal drug discovery strategy design 5 po...
Target selection lead discovery medicinal drug discovery strategy design 5 po...Target selection lead discovery medicinal drug discovery strategy design 5 po...
Target selection lead discovery medicinal drug discovery strategy design 5 po...
 
Drug discovery process style 5 powerpoint presentation slides db ppt templates
Drug discovery process style 5 powerpoint presentation slides db ppt templatesDrug discovery process style 5 powerpoint presentation slides db ppt templates
Drug discovery process style 5 powerpoint presentation slides db ppt templates
 
Target selection lead discovery medicinal drug discovery process design 5 pow...
Target selection lead discovery medicinal drug discovery process design 5 pow...Target selection lead discovery medicinal drug discovery process design 5 pow...
Target selection lead discovery medicinal drug discovery process design 5 pow...
 
Target selection lead discovery medicinal drug discovery process design 5 pow...
Target selection lead discovery medicinal drug discovery process design 5 pow...Target selection lead discovery medicinal drug discovery process design 5 pow...
Target selection lead discovery medicinal drug discovery process design 5 pow...
 
Promiscuous patterns and perils in PubChem and the MLSCN
Promiscuous patterns and perils in PubChem and the MLSCNPromiscuous patterns and perils in PubChem and the MLSCN
Promiscuous patterns and perils in PubChem and the MLSCN
 
Idealp Pharma Hits &amp; Leads Optimisation Case Study 1
Idealp Pharma Hits &amp; Leads Optimisation Case Study 1Idealp Pharma Hits &amp; Leads Optimisation Case Study 1
Idealp Pharma Hits &amp; Leads Optimisation Case Study 1
 
Drug discovery process style 3 powerpoint presentation templates
Drug discovery process style 3 powerpoint presentation templatesDrug discovery process style 3 powerpoint presentation templates
Drug discovery process style 3 powerpoint presentation templates
 

Destacado

Destacado (6)

Measurement and Prediction of Hybridization-induced Off-target Effects of Oli...
Measurement and Prediction of Hybridization-induced Off-target Effects of Oli...Measurement and Prediction of Hybridization-induced Off-target Effects of Oli...
Measurement and Prediction of Hybridization-induced Off-target Effects of Oli...
 
What Is Bioinformatics?
What Is Bioinformatics?What Is Bioinformatics?
What Is Bioinformatics?
 
Specificity Assessment At Santaris Pharma
Specificity Assessment At Santaris PharmaSpecificity Assessment At Santaris Pharma
Specificity Assessment At Santaris Pharma
 
RNA Drugs Informatics - 90 min lecture with questions
RNA Drugs Informatics - 90 min lecture with questionsRNA Drugs Informatics - 90 min lecture with questions
RNA Drugs Informatics - 90 min lecture with questions
 
Oligoinformatics And Drug Development
Oligoinformatics And Drug DevelopmentOligoinformatics And Drug Development
Oligoinformatics And Drug Development
 
Oligonucleotide Therapeutics: Brief Overview of the State of the Market
Oligonucleotide Therapeutics: Brief Overview of the State of the MarketOligonucleotide Therapeutics: Brief Overview of the State of the Market
Oligonucleotide Therapeutics: Brief Overview of the State of the Market
 

Similar a OSWG Off-target position

How to make create genomic research target molecules drug discovery strategy ...
How to make create genomic research target molecules drug discovery strategy ...How to make create genomic research target molecules drug discovery strategy ...
How to make create genomic research target molecules drug discovery strategy ...
SlideTeam.net
 
How to make create genomic research target molecules drug discovery strategy ...
How to make create genomic research target molecules drug discovery strategy ...How to make create genomic research target molecules drug discovery strategy ...
How to make create genomic research target molecules drug discovery strategy ...
SlideTeam.net
 
Cell based assays (2010)
Cell based assays (2010)Cell based assays (2010)
Cell based assays (2010)
jaayboy69
 
Cell Based Assays (2010) Ella
Cell Based Assays (2010) EllaCell Based Assays (2010) Ella
Cell Based Assays (2010) Ella
Elakeche
 
Biomarker for genotoxicity 2013
Biomarker for genotoxicity 2013Biomarker for genotoxicity 2013
Biomarker for genotoxicity 2013
Elsa von Licy
 
The Trans-NIH RNAi Initiative : Informatics
The Trans-NIH RNAi Initiative: InformaticsThe Trans-NIH RNAi Initiative: Informatics
The Trans-NIH RNAi Initiative : Informatics
Rajarshi Guha
 

Similar a OSWG Off-target position (20)

How to make create genomic research target molecules drug discovery strategy ...
How to make create genomic research target molecules drug discovery strategy ...How to make create genomic research target molecules drug discovery strategy ...
How to make create genomic research target molecules drug discovery strategy ...
 
How to make create genomic research target molecules drug discovery strategy ...
How to make create genomic research target molecules drug discovery strategy ...How to make create genomic research target molecules drug discovery strategy ...
How to make create genomic research target molecules drug discovery strategy ...
 
GENE EXPRESSION
GENE EXPRESSIONGENE EXPRESSION
GENE EXPRESSION
 
Cell based assays (2010)
Cell based assays (2010)Cell based assays (2010)
Cell based assays (2010)
 
Cell Based Assays (2010) Ella
Cell Based Assays (2010) EllaCell Based Assays (2010) Ella
Cell Based Assays (2010) Ella
 
Managing cell based potency assays
Managing cell based potency assaysManaging cell based potency assays
Managing cell based potency assays
 
drug discovery & development
drug discovery & developmentdrug discovery & development
drug discovery & development
 
In silico drug desigining
In silico drug desiginingIn silico drug desigining
In silico drug desigining
 
insilicodrugdesigining-170222171857 (1).pptx
insilicodrugdesigining-170222171857 (1).pptxinsilicodrugdesigining-170222171857 (1).pptx
insilicodrugdesigining-170222171857 (1).pptx
 
High Throughput Screening for Glycogen and Polyglucosan
High Throughput Screening for Glycogen and PolyglucosanHigh Throughput Screening for Glycogen and Polyglucosan
High Throughput Screening for Glycogen and Polyglucosan
 
Biomarker for genotoxicity 2013
Biomarker for genotoxicity 2013Biomarker for genotoxicity 2013
Biomarker for genotoxicity 2013
 
Alternative to Animal Experimentation.pptx
Alternative to Animal Experimentation.pptxAlternative to Animal Experimentation.pptx
Alternative to Animal Experimentation.pptx
 
Discovering drugs (I. Belda)
Discovering drugs (I. Belda)Discovering drugs (I. Belda)
Discovering drugs (I. Belda)
 
The Trans-NIH RNAi Initiative : Informatics
The Trans-NIH RNAi Initiative: InformaticsThe Trans-NIH RNAi Initiative: Informatics
The Trans-NIH RNAi Initiative : Informatics
 
The Comprehensive Guide to Genotoxicity Assessment
The Comprehensive Guide to Genotoxicity AssessmentThe Comprehensive Guide to Genotoxicity Assessment
The Comprehensive Guide to Genotoxicity Assessment
 
Computer aided drug designing (cadd)
Computer aided drug designing (cadd)Computer aided drug designing (cadd)
Computer aided drug designing (cadd)
 
The Comprehensive Guide to Genotoxicity Assessment
The Comprehensive Guide to Genotoxicity AssessmentThe Comprehensive Guide to Genotoxicity Assessment
The Comprehensive Guide to Genotoxicity Assessment
 
Bio cmc development
Bio cmc developmentBio cmc development
Bio cmc development
 
Novel network pharmacology methods for drug mechanism of action identificatio...
Novel network pharmacology methods for drug mechanism of action identificatio...Novel network pharmacology methods for drug mechanism of action identificatio...
Novel network pharmacology methods for drug mechanism of action identificatio...
 
Yuva CRO services
Yuva CRO servicesYuva CRO services
Yuva CRO services
 

OSWG Off-target position

  • 1. Assessing unintended hybridization induced biological effects of oligonucleotides Based on a position paper by Oligonucleotide Safety Working Group Subcommittee on Off-target assessment Draft position paper has been distributed with meeting materials NIH RNA Oligonucleotides Meeting, December 2011 Presented by Morten Lindow, mol@santaris.com
  • 2. The ‘off-target subcommittee’ • Arthur A. Levin, Santaris Pharma A/S • Donald Riley, DNA Consulting, LLC • Douglas J. Kornbrust, Preclinsight • Hans-Peter Vornlocher, Roche Kulmbach GmbH • Husam Younis, Isis Pharmaceuticals • James D. Thompson, Quark • Joanne Kamens, RXi Pharmaceuticals • Joel Parry, GlaxoSmithKline R&D Ltd. • Morten Lindow, Santaris Pharma A/S • Nicolay Ferrari, Topigen Pharmaceuticals Inc. • Sara Nochur, Alnylam • Scott P. Henry, Isis Pharmaceuticals • Steven Bartz, Merck Inc
  • 3. Mechanisms of toxicity for oligonucleotides Scope of this session: off-target toxicity = toxicity caused by the Watson-Crick basepairing between an oligonucleotide and an unintended target Bennett et al. Annu. Rev. Pharmacol. Toxicol. 2010.50:259-293
  • 4. Predictability of putative off- targets is a strength Protein <– small molecule RNA <- oligonucleotide CGCUGUGAGGUG GUA …GGGCGACACUCCACCAUGAAU…… ||||||||||||||| ? ? …GGGCGACACUCCACCAUAUCCGCUAUCUAGAAU…… ? …GGGCGACACUCCACCAUAUCCGCUAUCUAGAAU…… …GGGCGACACUCCACCAUAUCCGCUAUCUAGAAU…… In silico drug design and In silico drug design and specificity assesment is HARD specificity assesment is ‘EASY’
  • 5. Recommendation #1: “Candidate drug sequences (ASO and siRNAs) should be selected to minimize potential binding to and inhibitory activity on unintended RNAs“ • Perhaps not so “EASY” • Specificity is a quantitative trait. The objective is to: • Maximize effect on intended target knock down, while minimizing effect on off-target knockdown • Molecular factors governing activity of an oligonucleotide on an RNA (off)-target • Affinity to (off)-target site • Tolerance of RISC and RNAseH • Position of mismatches and bulges, possible context requirements • Target site accessibility (RNA folding, protein binding)
  • 6. In silico screening of candidates • In silico algorithms will never be perfect • Algorithms will depend on • mechanism (RNAseH, RISC, steric block) • chemistry of the oligonucleotide • Algorithms are under continuous development to align with increasing experimental data •  Merck talk •  Santaris talk
  • 7. Recommendation #2: Interpretation of in silico predicted off-targets • In vivo expression pattern of the off-target RNA • Overlap with tissues of drug accumulation • Function of off-target RNA • knock-out / knock-down phenotype • OMIM etc • Is the off-target site also present in species used in toxicity studies?
  • 8. Experimental follow-up on critical off-target hits • Validation. Relative potency between on- and off-target • E.g. qPCR in human cell lines.
  • 9. Recommendation #3: in vivo preclinical tox studies • Oligonucleotides are not essentially different from other drug classes • Penultimate test of relevance of off-target findings are in vivo studies in animal models • Understanding that the only way to truly test for human responses is in carefully controlled and monitored clinical trials
  • 10. Candidate oligonucleotide drug Summary Technology and In silico off-target mechanism Database of screen transcripts based • Off-target screening algorithms is only one among Case by case evaluation of putative off-targets may include: many other factors Comparison of tissue expression of off- Function of putative off-target if known, target with tissue used to select accumulation of drug candidate e.g. phenotype of genetic knock-out compounds In vitro validation of critical putative off- off-target present in targets. tox species? Relative IC50 in human cell line Penultimate test: Preclinical toxicity studies in vivo Proceed to human testing

Notas del editor

  1. These hybe dependent effects are unique to