2ND INTERNATIONAL RESEARCH MEETING 4 JUNE 2010- HÔTEL DE MARIGNY PARIS

1. Circulation, Endocrinology, Hepatology, Gastroenterology, Nephrology, Bone & Joints, Diabetes Metabolism/Nutrition June 2010 Fields INSTITUT THÉMATIQUE MULTI-ORGANISMES (ITMO) Circulation, Métabolisme, Nutrition (CMN) Strategy from genetic background & mechanisms of initiation/progression to biomarkers & Innovative therapies

2. projected global deaths (millions) Cardiovascular diseases: world leading cause of death Causes of death in Europe cancer stroke ischemic heart disease ♀ coronary heart diseases stroke other cardiovascular diseases cancer other lung injury stroke coronary heart diseases other cardiovascular diseases cancer other lung injury ♂

3.  29% of deaths in France 27% ischemic cardiopathies 25% strokes 23% cardiac failure Cardiovascular diseases in France  hypertension: (adults > 20) 12-13.10 6  obesity:12.4% of adults in 2006  diabetes: 6.2% (20-70) glucose intolerance: 5.6% 10% health care expenses in France USA  50% 1997  2007

4. DIABETES PREVALENCE 2010 International Diabetes Federation Atlas DIABETES PREVALENCE 2030 International Diabetes Federation Atlas Yoon KH et al, Lancet 2006 HYPERTENSION PREVALENCE 2000 Kearney PM et al. Lancet 2005 developing countries USA HYPERTENSION PREVALENCE 2025 Kearney PM et al. Lancet 2005 developing countries USA

6. up to 5x10 6 ? 10 x 10 6 ? up to 2 megabases ? Copy Number Variation [CNVs] Single Nucleotide Polymorphism [SNPs] GENETIC DIVERSITY CGTTACGGCATCGAGCTGCTGCA TCGTTACGGC G TCGAGCTGCTGCA Concannon P & Nepom GT N Engl J Med 2009 GENETIC DIVERSITY IN DIABETES Single Nucleotide Polymorphism [SNPs] low Odds Ratios highly multigenic « normal genes » [gene variants ] 2377 participants 255  T2D [Framingham Offspring Study] Sex Family history Age BMI Fasting plasma glucose Systolic blood pressure HDL-Cholesterol Fasting triglycerides Meiggs JB et al. N Engl J Med 2008 Sex-adjusted reclassification by genotype score 4.1% 11.9% < 50 0.47 > 50 sex-adjusted OR for T2D 1.12 vs. ENVIRONMENT Epigenetic variabili ty Baylin & Schuebel Nature 2007  Baranzini SE et al. Nature 2010 epigenome sequences of CD4 + lymphocytes from 3 pairs pairwise comparisons of CpG site methylation (ELAND-extended)

7. Metagenome paves the way to future understanding of interactions between genome and environment in obesity and inflammation

8. 600 millions years Hotamisligil GS Nature 2006 THE ENVIRONMENTAL CHALLENGE the need for an integrative approach metabolic diseases INFLAMMATION Immune-mediated diseases

9. Hyperlipidemia Hypertension Insulin resistance Increased adiposity gut microbiota  antibiotics pancreas liver Vijay-Kumar M et al. Science 2010 Altered gut microbiota in TLR5 -/- mice leads to metabolic syndrome

10. INSTITUT THÉMATIQUE MULTI-ORGANISMES (ITMO) Circulation, Métabolisme, Nutrition (CMN) research units: 201 (%) staff researchers university staff ~ 6/unit Heart & vessels 59 (30%) Metabolism Nutrition & Diabetes 72 (37%) Endocrine glands 9 (4%) Digestive tract 11 (5%) Liver 17 (8%) Kidney 19 (9%) Bone and joints 14 (7%) Heart & vessels 59 (30%) Metabolism Nutrition & Diabetes 72 (37%) Endocrine glands 9 (4%) Digestive tract 11 (5%) Liver 17 (8%) Kidney 19 (9%) Bone and joints 14 (7%) Heart & vessels 59 (30%) Metabolism Nutrition & Diabetes 72 (37%) Endocrine glands 9 (4% Digestive tract 11 (5%) Liver 17 (8%) Kidney 19 (9%) Bone and joints 14 (7%)

11. Domains Circulation, Diabetes Endocrinology Gastro-enterology, Hepatology Metabolism/Nutrition Uro-Nephrology Osteo-articular System INSTITUT THÉMATIQUE MULTI-ORGANISMES (ITMO) Circulation, Metabolism, Nutrition (CMN)

12. PLATFORMS CHU Cohorts CRNH genomic epigenetic metagenomic metabolomic lipidomic biostatistics

13. Genetics, Genomics and Epigenetics at Inserm 163 research teams 99 19 7 5 4 2 1 Not at scale

14. A observatory of M-F in France French Network of Metabolomics PF PF 4 main centers 80% labs (56) Health lipidome metabolome health health health plants plants œnology plants pharmacology, plants product quality microbiology, human health food security plants, fruits, œnology microbiology human health agriculture products health pharmacology nutrition environment ~10000 ? ~15000 ? ~1500 ? Metabolome small molecules – metabolites - [< 1000] occurring in a biological system. metabolome analysis towards systems biology [cells, tissues, whole organisms]

15. CHUs University Hospitals > 80% funding

16. CICs Centers for Clinical Investigation cardiovascular CIC network

17. CICs Centers for Clinical Investigation thrombosis CIC network

18. CICs Centers for Clinical Investigation diabetes CIC network

19. CRNHs Human Nutrition Research Centers COHORTS Cohort SU.VI.MAX Cohort SU.FOL.OM3 NUTRINET Internet FOOD CONSUMPTION AND BEHAVIOR Health consequences food consumption & nutritional determinants of behavior Prevention, recommendations Education Energy and protein metabolism & aging Micronutrients and prevention Intestine, intestinal microflora & preventive nutrition OBESITY AND RELATED DISEASES Nutrigenomics Mechanisms of insulin resistance and type 2 diabetes Cardio-vascular risk & oxidative stress Food bioavailability Nutrition and cancer PREVENTIVE NUTRITION & AGING Cancer Sarcopemia Osteoporosis Cardio-vascular NUTRITION AND INTESTINE Prevention & treatments : fibers prebiotics fatty acids proteins… Nutrition and cancer (colon, breast) Intestinal inflammatory disease Intestine of the newborn Intestinal lipoproteins Obesity

20. 2ND INTERNATIONAL RESEARCH MEETING 1. FROM HUMAN GENOMICS TO SYSTEM PATHWAYS What could academia and industry achieve together in drug discovery? SPEAKERS : Xavier Jeunemaitre , HEGP, Paris Philippe Froguel , Lille Dusko Ehrlich , Jouy-en-Josas Questions and answers Alain Tedgui , HEGP, Paris Bart Staels , Lille Richard Moreau , Bichat, Paris Xavier Jouven , HEGP, Paris Questions and answers Chair : Christian Boitard- Director of ITMO CMN and Barbara Demeneix MNHN, Paris