SlideShare una empresa de Scribd logo
1 de 76
Phylogenetic Workflows: Tree Building and Post-tree Analyses Naim Matasci The iPlant Collaborative Plant Biology 2011 August 6-10, 2011
Why is the tree of life important? “ Knowledge of evolutionary relationships is fundamental to biology, yielding new insights across the plant sciences, from comparative genomics and molecular evolution, to plant development, to the study of adaptation, speciation, community assembly, and ecosystem functioning.”
Nothing in biology makes sense except in the light of evolution. T. G. Dobzahnsky
Scalability Ackerly, 2009; J. Felsenstein, ca. 1980; Ranger Cluster at TACC
iPlant Tree of Life Grand Challenge ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Ancestral state of Hawaiian lobelioids Lobelia niihauensis  (Image: David Eickhoff) Cyanea leptostegia  (Image: Karl Magnacca)
 
Continuous Ancestral Character Estimation  (Schulter  et al.  1997, Paradis 2004) ?
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
>gi|1835233|emb|Z83147.1| S.nepaulensis rbcL gene TTATTATACTCCTGAATAYGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTGCTCAGCCT GGAGTTCCACCCGAAGAAGCGGGGGCCGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGT GGACCGATGGACTTACTAACCTTGATCGTTACAAAGGGCGATGCTACAACATAGAGCCCGTTGCTGGAGA AGAAAATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATG TTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAA TCCCTACTGCGTATTGTAAAACTTTCCAAGGACCGCCTCATGGGATCCAAGTTGAAAGAGATAAATTGAA CAAGTATGGTCGTCCCTTGCTGGGATGTACTATTAAACCTAAATTGGGGTTATCGGCTAAAAACTACGGT AGAGCAGTTTATGAATGTCTACGCGGTGGGCTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAAC CATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTTTAAAGCACAGTCTGAAACAGG TGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCTATATTT >gi|1835227|emb|Z83136.1| S.foetidissimum rbcL gene AAGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAA GATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCG CGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACTAGCCTTGATCG TTACAAAGGGCGATGCTACCACATCGAGCCCGTNGCTGGAGAAGAAAATCAATATATTGCTTATGTAGCT TATCCTTTAGACCTYTTTGAAGAAGGTTCTGTTACTAATATGTKNACTTCCATTGTGGGGAATGTATTTG GGTTCAAAGCCCTGCGTGCTTTACGTCTGGAAGATCTGCGAATCCCTCCTGCGTATTCTAAAACTTTCCA AGGACCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTACGGTCGTCCCCTGTTGGGATGT ACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTG GACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTT ATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCT >gi|1834456|emb|Z83132.1| G.urceolata rbcL gene AACTAAAGCGGGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGACTAT GAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAG CGGGGGCCGCCGTAGCTGCCGAATCCTCCACTGGTACATGGACAACTGTGTGGACCGACGGACTTACTAG CCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTGGCTGGAGAAGAAAATCAATTTATTGCT TATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTA ATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTGTTGCGTATGCTAA AACTTTCCAAGGGCCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAATAAGTATGGTCGTCCCCTG
Get Sequences ,[object Object],[object Object]
Get sequences DEMO
 
 
 
 
 
 
 
 
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
muscleDEMO
 
 
 
 
 
 
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Improved Tree Building Tools ,[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
RAxML DEMO
 
 
 
 
 
 
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Tree Visualization ,[object Object],[object Object],[object Object],[object Object],[object Object]
iPlant Tree Viewer http://portnoy.iplantcollaborative.org/
Live tree view demo
 
 
 
 
 
 
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
Obstacles
Lopper DEMO
 
 
 
 
 
 
 
 
 
 
 
 
Lobelia kauaensis Lobelia villosa Galeatella gloria-montis Trematolobelia kauaiensis Trematolobelia macrostachys Lobelia hypoleuca Neowimmeria yuccoides Lobelia niihauensis Brighamia insignis Brighamia rockii Delissea rhytidosperma Delissea subcordata Cyanea acuminata Cyanea hirtella Cyanea coriacea Delissea leptostegia Clermontia kakeana Clermontia parviflora Clermontia arborescens Clermontia fauriei
The TNRS: A Taxonomic Name Resolution Service for Plants Tonight from 5:30 - 7:30 in Exhibit Hall A. Poster number  P21011 .
[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object],[object Object]
CACE DEMO
 
 
 
 
 
 
 
 
 

Más contenido relacionado

La actualidad más candente

Phylogenetic Tree evolution
Phylogenetic Tree evolutionPhylogenetic Tree evolution
Phylogenetic Tree evolutionMd Omama Jawaid
 
Bioinformatics.Assignment
Bioinformatics.AssignmentBioinformatics.Assignment
Bioinformatics.AssignmentNaima Tahsin
 
Molecular Phylogenetics
Molecular PhylogeneticsMolecular Phylogenetics
Molecular PhylogeneticsMeghaj Mallick
 
Survey of softwares for phylogenetic analysis
Survey of softwares for phylogenetic analysisSurvey of softwares for phylogenetic analysis
Survey of softwares for phylogenetic analysisArindam Ghosh
 
MEGA (Molecular Evolutionary Genetics Analysis)
MEGA (Molecular Evolutionary Genetics Analysis)MEGA (Molecular Evolutionary Genetics Analysis)
MEGA (Molecular Evolutionary Genetics Analysis)Athar Mutahari
 
Construction of phylogenetic tree from multiple gene trees using principal co...
Construction of phylogenetic tree from multiple gene trees using principal co...Construction of phylogenetic tree from multiple gene trees using principal co...
Construction of phylogenetic tree from multiple gene trees using principal co...IAEME Publication
 
PMC Poster - phylogenetic algorithm for morphological data
PMC Poster - phylogenetic algorithm for morphological dataPMC Poster - phylogenetic algorithm for morphological data
PMC Poster - phylogenetic algorithm for morphological dataYiteng Dang
 
Phylogenetic analysis in nutshell
Phylogenetic analysis in nutshellPhylogenetic analysis in nutshell
Phylogenetic analysis in nutshellAvinash Kumar
 

La actualidad más candente (12)

Phylogenetic Tree evolution
Phylogenetic Tree evolutionPhylogenetic Tree evolution
Phylogenetic Tree evolution
 
Bioinformatics.Assignment
Bioinformatics.AssignmentBioinformatics.Assignment
Bioinformatics.Assignment
 
Molecular Phylogenetics
Molecular PhylogeneticsMolecular Phylogenetics
Molecular Phylogenetics
 
Survey of softwares for phylogenetic analysis
Survey of softwares for phylogenetic analysisSurvey of softwares for phylogenetic analysis
Survey of softwares for phylogenetic analysis
 
Phylogenetic studies
Phylogenetic studiesPhylogenetic studies
Phylogenetic studies
 
MEGA (Molecular Evolutionary Genetics Analysis)
MEGA (Molecular Evolutionary Genetics Analysis)MEGA (Molecular Evolutionary Genetics Analysis)
MEGA (Molecular Evolutionary Genetics Analysis)
 
Construction of phylogenetic tree from multiple gene trees using principal co...
Construction of phylogenetic tree from multiple gene trees using principal co...Construction of phylogenetic tree from multiple gene trees using principal co...
Construction of phylogenetic tree from multiple gene trees using principal co...
 
The tree of life
The tree of lifeThe tree of life
The tree of life
 
Fasta
FastaFasta
Fasta
 
PMC Poster - phylogenetic algorithm for morphological data
PMC Poster - phylogenetic algorithm for morphological dataPMC Poster - phylogenetic algorithm for morphological data
PMC Poster - phylogenetic algorithm for morphological data
 
Protease Phylogeny
 Protease Phylogeny  Protease Phylogeny
Protease Phylogeny
 
Phylogenetic analysis in nutshell
Phylogenetic analysis in nutshellPhylogenetic analysis in nutshell
Phylogenetic analysis in nutshell
 

Similar a Phylogenetic Workflows

Post-tree Analyses Workflow
Post-tree Analyses WorkflowPost-tree Analyses Workflow
Post-tree Analyses WorkflowNaim Matasci
 
iPlant Tree of Life
iPlant Tree of LifeiPlant Tree of Life
iPlant Tree of LifeNaim Matasci
 
Functionally annotate genomic variants
Functionally annotate genomic variantsFunctionally annotate genomic variants
Functionally annotate genomic variantsDenis C. Bauer
 
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...Spark Summit
 
Thesis def
Thesis defThesis def
Thesis defJay Vyas
 
The iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitThe iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitNaim Matasci
 
Carleton Biology talk : March 2014
Carleton Biology talk : March 2014Carleton Biology talk : March 2014
Carleton Biology talk : March 2014Karen Cranston
 
2 md2016 annotation
2 md2016 annotation2 md2016 annotation
2 md2016 annotationScott Dawson
 
Una estrategia para la integración de ontologías, servicios web y PLN en el a...
Una estrategia para la integración de ontologías, servicios web y PLN en el a...Una estrategia para la integración de ontologías, servicios web y PLN en el a...
Una estrategia para la integración de ontologías, servicios web y PLN en el a...Anubis Hosein
 
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...Natalio Krasnogor
 
Visual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient StratificationVisual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient StratificationNils Gehlenborg
 
Inference and informatics in a 'sequenced' world
Inference and informatics in a 'sequenced' worldInference and informatics in a 'sequenced' world
Inference and informatics in a 'sequenced' worldJoe Parker
 
Transcript detection in RNAseq
Transcript detection in RNAseqTranscript detection in RNAseq
Transcript detection in RNAseqDenis C. Bauer
 
Variant (SNPs/Indels) calling in DNA sequences, Part 1
Variant (SNPs/Indels) calling in DNA sequences, Part 1 Variant (SNPs/Indels) calling in DNA sequences, Part 1
Variant (SNPs/Indels) calling in DNA sequences, Part 1 Denis C. Bauer
 
Utility of transcriptome sequencing for phylogenetic
Utility of transcriptome sequencing for phylogeneticUtility of transcriptome sequencing for phylogenetic
Utility of transcriptome sequencing for phylogeneticEdizonJambormias2
 
Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012gregcaporaso
 
Introduction to 16S rRNA gene multivariate analysis
Introduction to 16S rRNA gene multivariate analysisIntroduction to 16S rRNA gene multivariate analysis
Introduction to 16S rRNA gene multivariate analysisJosh Neufeld
 
Network Biology: A paradigm for modeling biological complex systems
Network Biology: A paradigm for modeling biological complex systemsNetwork Biology: A paradigm for modeling biological complex systems
Network Biology: A paradigm for modeling biological complex systemsGanesh Bagler
 

Similar a Phylogenetic Workflows (20)

Post-tree Analyses Workflow
Post-tree Analyses WorkflowPost-tree Analyses Workflow
Post-tree Analyses Workflow
 
iPlant Tree of Life
iPlant Tree of LifeiPlant Tree of Life
iPlant Tree of Life
 
Functionally annotate genomic variants
Functionally annotate genomic variantsFunctionally annotate genomic variants
Functionally annotate genomic variants
 
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
Finding Needles in Genomic Haystacks with “Wide” Random Forest: Spark Summit ...
 
Omics Integration
Omics IntegrationOmics Integration
Omics Integration
 
Thesis def
Thesis defThesis def
Thesis def
 
The iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitThe iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and Toolkit
 
Carleton Biology talk : March 2014
Carleton Biology talk : March 2014Carleton Biology talk : March 2014
Carleton Biology talk : March 2014
 
2 md2016 annotation
2 md2016 annotation2 md2016 annotation
2 md2016 annotation
 
Una estrategia para la integración de ontologías, servicios web y PLN en el a...
Una estrategia para la integración de ontologías, servicios web y PLN en el a...Una estrategia para la integración de ontologías, servicios web y PLN en el a...
Una estrategia para la integración de ontologías, servicios web y PLN en el a...
 
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
Darwin’s Magic: Evolutionary Computation in Nanoscience, Bioinformatics and S...
 
Visual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient StratificationVisual Exploration of Clinical and Genomic Data for Patient Stratification
Visual Exploration of Clinical and Genomic Data for Patient Stratification
 
phy prAC.pptx
phy prAC.pptxphy prAC.pptx
phy prAC.pptx
 
Inference and informatics in a 'sequenced' world
Inference and informatics in a 'sequenced' worldInference and informatics in a 'sequenced' world
Inference and informatics in a 'sequenced' world
 
Transcript detection in RNAseq
Transcript detection in RNAseqTranscript detection in RNAseq
Transcript detection in RNAseq
 
Variant (SNPs/Indels) calling in DNA sequences, Part 1
Variant (SNPs/Indels) calling in DNA sequences, Part 1 Variant (SNPs/Indels) calling in DNA sequences, Part 1
Variant (SNPs/Indels) calling in DNA sequences, Part 1
 
Utility of transcriptome sequencing for phylogenetic
Utility of transcriptome sequencing for phylogeneticUtility of transcriptome sequencing for phylogenetic
Utility of transcriptome sequencing for phylogenetic
 
Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012Caporaso sloan qiime_workshop_slides_18_oct2012
Caporaso sloan qiime_workshop_slides_18_oct2012
 
Introduction to 16S rRNA gene multivariate analysis
Introduction to 16S rRNA gene multivariate analysisIntroduction to 16S rRNA gene multivariate analysis
Introduction to 16S rRNA gene multivariate analysis
 
Network Biology: A paradigm for modeling biological complex systems
Network Biology: A paradigm for modeling biological complex systemsNetwork Biology: A paradigm for modeling biological complex systems
Network Biology: A paradigm for modeling biological complex systems
 

Más de Naim Matasci

iPlant Taxonomic Name Resolution Service v. 3
iPlant Taxonomic Name Resolution Service v. 3iPlant Taxonomic Name Resolution Service v. 3
iPlant Taxonomic Name Resolution Service v. 3Naim Matasci
 
iPlant TNRS for digital collections - iDigBio Workshop
iPlant TNRS for digital collections - iDigBio WorkshopiPlant TNRS for digital collections - iDigBio Workshop
iPlant TNRS for digital collections - iDigBio WorkshopNaim Matasci
 
The iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
The iPlant Collaborative: A Cyberinfrastructure for the Life SciencesThe iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
The iPlant Collaborative: A Cyberinfrastructure for the Life SciencesNaim Matasci
 
Phylotastic reconciliation
Phylotastic reconciliationPhylotastic reconciliation
Phylotastic reconciliationNaim Matasci
 
Phylogenetic Workflows
Phylogenetic WorkflowsPhylogenetic Workflows
Phylogenetic WorkflowsNaim Matasci
 
The iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitThe iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitNaim Matasci
 
The TNRS: a Taxonomic Name Resolution Service for Plants
The TNRS: a Taxonomic Name Resolution Service for PlantsThe TNRS: a Taxonomic Name Resolution Service for Plants
The TNRS: a Taxonomic Name Resolution Service for PlantsNaim Matasci
 

Más de Naim Matasci (8)

iPlant Taxonomic Name Resolution Service v. 3
iPlant Taxonomic Name Resolution Service v. 3iPlant Taxonomic Name Resolution Service v. 3
iPlant Taxonomic Name Resolution Service v. 3
 
iPlant TNRS for digital collections - iDigBio Workshop
iPlant TNRS for digital collections - iDigBio WorkshopiPlant TNRS for digital collections - iDigBio Workshop
iPlant TNRS for digital collections - iDigBio Workshop
 
The iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
The iPlant Collaborative: A Cyberinfrastructure for the Life SciencesThe iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
The iPlant Collaborative: A Cyberinfrastructure for the Life Sciences
 
iPlant TNRS
iPlant TNRSiPlant TNRS
iPlant TNRS
 
Phylotastic reconciliation
Phylotastic reconciliationPhylotastic reconciliation
Phylotastic reconciliation
 
Phylogenetic Workflows
Phylogenetic WorkflowsPhylogenetic Workflows
Phylogenetic Workflows
 
The iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and ToolkitThe iPlant Tree of Life Project and Toolkit
The iPlant Tree of Life Project and Toolkit
 
The TNRS: a Taxonomic Name Resolution Service for Plants
The TNRS: a Taxonomic Name Resolution Service for PlantsThe TNRS: a Taxonomic Name Resolution Service for Plants
The TNRS: a Taxonomic Name Resolution Service for Plants
 

Último

Human Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR SystemsHuman Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR SystemsMark Billinghurst
 
Unraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdfUnraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdfAlex Barbosa Coqueiro
 
Unleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding ClubUnleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding ClubKalema Edgar
 
Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!Manik S Magar
 
The Future of Software Development - Devin AI Innovative Approach.pdf
The Future of Software Development - Devin AI Innovative Approach.pdfThe Future of Software Development - Devin AI Innovative Approach.pdf
The Future of Software Development - Devin AI Innovative Approach.pdfSeasiaInfotech2
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 3652toLead Limited
 
Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!Commit University
 
Connect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck PresentationConnect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck PresentationSlibray Presentation
 
Install Stable Diffusion in windows machine
Install Stable Diffusion in windows machineInstall Stable Diffusion in windows machine
Install Stable Diffusion in windows machinePadma Pradeep
 
Developer Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQLDeveloper Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQLScyllaDB
 
Training state-of-the-art general text embedding
Training state-of-the-art general text embeddingTraining state-of-the-art general text embedding
Training state-of-the-art general text embeddingZilliz
 
Leverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage Cost
Leverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage CostLeverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage Cost
Leverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage CostZilliz
 
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024BookNet Canada
 
Artificial intelligence in cctv survelliance.pptx
Artificial intelligence in cctv survelliance.pptxArtificial intelligence in cctv survelliance.pptx
Artificial intelligence in cctv survelliance.pptxhariprasad279825
 
Vertex AI Gemini Prompt Engineering Tips
Vertex AI Gemini Prompt Engineering TipsVertex AI Gemini Prompt Engineering Tips
Vertex AI Gemini Prompt Engineering TipsMiki Katsuragi
 
CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):comworks
 
Vector Databases 101 - An introduction to the world of Vector Databases
Vector Databases 101 - An introduction to the world of Vector DatabasesVector Databases 101 - An introduction to the world of Vector Databases
Vector Databases 101 - An introduction to the world of Vector DatabasesZilliz
 
Scanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsScanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsRizwan Syed
 

Último (20)

Human Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR SystemsHuman Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR Systems
 
Unraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdfUnraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdf
 
Unleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding ClubUnleash Your Potential - Namagunga Girls Coding Club
Unleash Your Potential - Namagunga Girls Coding Club
 
E-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptx
E-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptxE-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptx
E-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptx
 
Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!
 
The Future of Software Development - Devin AI Innovative Approach.pdf
The Future of Software Development - Devin AI Innovative Approach.pdfThe Future of Software Development - Devin AI Innovative Approach.pdf
The Future of Software Development - Devin AI Innovative Approach.pdf
 
Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365Ensuring Technical Readiness For Copilot in Microsoft 365
Ensuring Technical Readiness For Copilot in Microsoft 365
 
Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!Nell’iperspazio con Rocket: il Framework Web di Rust!
Nell’iperspazio con Rocket: il Framework Web di Rust!
 
Connect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck PresentationConnect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck Presentation
 
Install Stable Diffusion in windows machine
Install Stable Diffusion in windows machineInstall Stable Diffusion in windows machine
Install Stable Diffusion in windows machine
 
Developer Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQLDeveloper Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQL
 
Training state-of-the-art general text embedding
Training state-of-the-art general text embeddingTraining state-of-the-art general text embedding
Training state-of-the-art general text embedding
 
DMCC Future of Trade Web3 - Special Edition
DMCC Future of Trade Web3 - Special EditionDMCC Future of Trade Web3 - Special Edition
DMCC Future of Trade Web3 - Special Edition
 
Leverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage Cost
Leverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage CostLeverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage Cost
Leverage Zilliz Serverless - Up to 50X Saving for Your Vector Storage Cost
 
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
New from BookNet Canada for 2024: BNC CataList - Tech Forum 2024
 
Artificial intelligence in cctv survelliance.pptx
Artificial intelligence in cctv survelliance.pptxArtificial intelligence in cctv survelliance.pptx
Artificial intelligence in cctv survelliance.pptx
 
Vertex AI Gemini Prompt Engineering Tips
Vertex AI Gemini Prompt Engineering TipsVertex AI Gemini Prompt Engineering Tips
Vertex AI Gemini Prompt Engineering Tips
 
CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):CloudStudio User manual (basic edition):
CloudStudio User manual (basic edition):
 
Vector Databases 101 - An introduction to the world of Vector Databases
Vector Databases 101 - An introduction to the world of Vector DatabasesVector Databases 101 - An introduction to the world of Vector Databases
Vector Databases 101 - An introduction to the world of Vector Databases
 
Scanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsScanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL Certs
 

Phylogenetic Workflows

  • 1. Phylogenetic Workflows: Tree Building and Post-tree Analyses Naim Matasci The iPlant Collaborative Plant Biology 2011 August 6-10, 2011
  • 2. Why is the tree of life important? “ Knowledge of evolutionary relationships is fundamental to biology, yielding new insights across the plant sciences, from comparative genomics and molecular evolution, to plant development, to the study of adaptation, speciation, community assembly, and ecosystem functioning.”
  • 3. Nothing in biology makes sense except in the light of evolution. T. G. Dobzahnsky
  • 4. Scalability Ackerly, 2009; J. Felsenstein, ca. 1980; Ranger Cluster at TACC
  • 5.
  • 6. Ancestral state of Hawaiian lobelioids Lobelia niihauensis (Image: David Eickhoff) Cyanea leptostegia (Image: Karl Magnacca)
  • 7.  
  • 8. Continuous Ancestral Character Estimation (Schulter et al. 1997, Paradis 2004) ?
  • 9.
  • 10.
  • 11. >gi|1835233|emb|Z83147.1| S.nepaulensis rbcL gene TTATTATACTCCTGAATAYGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTGCTCAGCCT GGAGTTCCACCCGAAGAAGCGGGGGCCGCGGTAGCTGCGGAATCTTCTACTGGTACATGGACAACTGTGT GGACCGATGGACTTACTAACCTTGATCGTTACAAAGGGCGATGCTACAACATAGAGCCCGTTGCTGGAGA AGAAAATCAATTTATTGCTTATGTAGCTTATCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATG TTTACTTCCATTGTGGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAA TCCCTACTGCGTATTGTAAAACTTTCCAAGGACCGCCTCATGGGATCCAAGTTGAAAGAGATAAATTGAA CAAGTATGGTCGTCCCTTGCTGGGATGTACTATTAAACCTAAATTGGGGTTATCGGCTAAAAACTACGGT AGAGCAGTTTATGAATGTCTACGCGGTGGGCTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAAC CATTTATGCGTTGGAGAGACCGTTTCGTATTTTGTGCCGAAGCAATTTTTAAAGCACAGTCTGAAACAGG TGAAATCAAAGGGCATTACTTGAATGCTACTGCAGGTACATGTGAAGAAATGATGAAAAGGGCTATATTT >gi|1835227|emb|Z83136.1| S.foetidissimum rbcL gene AAGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTGACTTATTATACTCCTGACTATGAAACCAAA GATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAGCAGGGGCCG CGGTAGCTGCCGAATCTTCTACTGGTACATGGACAACTGTGTGGACCGATGGACTTACTAGCCTTGATCG TTACAAAGGGCGATGCTACCACATCGAGCCCGTNGCTGGAGAAGAAAATCAATATATTGCTTATGTAGCT TATCCTTTAGACCTYTTTGAAGAAGGTTCTGTTACTAATATGTKNACTTCCATTGTGGGGAATGTATTTG GGTTCAAAGCCCTGCGTGCTTTACGTCTGGAAGATCTGCGAATCCCTCCTGCGTATTCTAAAACTTTCCA AGGACCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAACAAGTACGGTCGTCCCCTGTTGGGATGT ACTATTAAACCTAAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCGGTTTATGAATGTCTCCGCGGTG GACTTGATTTTACCAAAGATGATGAGAACGTGAACTCCCAACCATTTATGCGTTGGAGAGATCGTTTCTT ATTTTGTGCCGAAGCACTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTGAATGCT >gi|1834456|emb|Z83132.1| G.urceolata rbcL gene AACTAAAGCGGGTGTTGGATTCAAAGCGGGTGTTAAAGATTACAAATTAACTTATTATACTCCTGACTAT GAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTTCCACCTGAAGAAG CGGGGGCCGCCGTAGCTGCCGAATCCTCCACTGGTACATGGACAACTGTGTGGACCGACGGACTTACTAG CCTTGATCGTTACAAAGGGCGATGCTACCACATCGAGCCCGTGGCTGGAGAAGAAAATCAATTTATTGCT TATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCTGTTACTAACATGTTTACTTCCATTGTGGGTA ATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTGTTGCGTATGCTAA AACTTTCCAAGGGCCGCCTCATGGCATCCAAGTTGAAAGAGATAAATTGAATAAGTATGGTCGTCCCCTG
  • 12.
  • 14.  
  • 15.  
  • 16.  
  • 17.  
  • 18.  
  • 19.  
  • 20.  
  • 21.  
  • 22.
  • 24.  
  • 25.  
  • 26.  
  • 27.  
  • 28.  
  • 29.  
  • 30.
  • 31.
  • 33.  
  • 34.  
  • 35.  
  • 36.  
  • 37.  
  • 38.  
  • 39.
  • 40.
  • 41. iPlant Tree Viewer http://portnoy.iplantcollaborative.org/
  • 43.  
  • 44.  
  • 45.  
  • 46.  
  • 47.  
  • 48.  
  • 49.
  • 52.  
  • 53.  
  • 54.  
  • 55.  
  • 56.  
  • 57.  
  • 58.  
  • 59.  
  • 60.  
  • 61.  
  • 62.  
  • 63.  
  • 64. Lobelia kauaensis Lobelia villosa Galeatella gloria-montis Trematolobelia kauaiensis Trematolobelia macrostachys Lobelia hypoleuca Neowimmeria yuccoides Lobelia niihauensis Brighamia insignis Brighamia rockii Delissea rhytidosperma Delissea subcordata Cyanea acuminata Cyanea hirtella Cyanea coriacea Delissea leptostegia Clermontia kakeana Clermontia parviflora Clermontia arborescens Clermontia fauriei
  • 65. The TNRS: A Taxonomic Name Resolution Service for Plants Tonight from 5:30 - 7:30 in Exhibit Hall A. Poster number P21011 .
  • 66.
  • 68.  
  • 69.  
  • 70.  
  • 71.  
  • 72.  
  • 73.  
  • 74.  
  • 75.  
  • 76.  

Notas del editor

  1. Our understanding of the phylogeny of the half million known species of green plants has expanded dramatically over the past two decades, The task of assembling a comprehensive "tree of life" for them presents a Grand Challenge. Also part of the grand challenge is developing the necessary infrastructre to view and use the tree of life, to put it into the hands of plant biologists
  2. Left tree: Maple tree phylogeny from D. Ackerly Left picture: Joe Felsenstein, ca. 1980 Right picture: Ranger cluster at TACC
  3. Distance matrix calculation compared to FASTREE