SlideShare una empresa de Scribd logo
1 de 17
An Ontological Characterization for the
Integration of Genetic Variation Data
WHAT’S IN A GENOTYPE?
Matthew H. Brush,
Chris Mungall, Nicole Washington, and Melissa Haendel
Oregon Health and Science University, Lawrence Berkeley Labs
International Conference in Biomedical Ontology
July 8, 2013
Genotype-to-Phenotype Research
B6.Cg-Alms1foz/fox/J
increased weight,
adipose tissue volume,
glucose homeostasis altered
ALSM1(NM_015120.4)
[c.10775delC] + [-]
GENOTYPE
PHENOTYPE
obesity,
diabetes mellitus,
insulin resistance
increased food
intake, hyperglycemia,
insulin resistance
kcnj11c14/c14; insrt143/+(AB)
G2P research seeks a mechanistic understanding of how genetic
variation is linked to organismal biology and disease
Integrating G2P Data
Integrating G2P Data
The Monarch Initiative
The Monarch Initiative aims to bring G2P and related data
together under a common semantic framework to support
integrated exploration and analysis.
Integration Challenges
I. Reconciling G2P data annotated to different
‘levels’ of a genotype
II. Integrating ‘non-genomic’ forms of variation
III. Creating semantic links to biological data
Technical Challenges
 Terminological, syntactic, organizational
variation in data is common
Knowledge-Based Challenges
 Reflect inherent complexity in the way G2P data is
generated and what it represents
GCGAAGTGCCAACTTCTACACACACAAAG
GCGAAGTGCCAACTTCTACACACACAAAG
Decomposition of a Genotype
genotype
genomic variation
complementgenomic background
= +
CGTAGC
CGTACC
apchu745/+; fgf8ati282/ti282(AB)
genomic variation
complement
variant single locus
complement
variant locus
(allele)
sequence alteration
has_part has_part
apchu745/+
apchu745
hu745
has_part has_part
has_part has_part
X
AACGTACCGACGCTCGCTACGGGCGTATC
(AB) apchu745/+; fgf8ati282/ti282
apchu745/+; fgf8ati282/ti282
GCGAAGTGCCAACTTCTACACACACAAAG
GCGAAGTGCCAACTTCTACACACACAAAG
AACGTAGCGACGCTCGCTACGGGCGTATC
AACGTACCGACGCTCGCTACGGGCGTATC X
ACAC
X
X
X
X
Genotype – an information entity that specifies an entire genome sequence
in terms of its variation from some reference genome
AACGTAGCGACGCTCGCTACGGGCGTATC
X ACAC
X
X
X
X
X
I. Reconciling Levels of G2P Association
apchu745/+; fgf8ati282/ti282(AB)
increased cell proliferation
disrupted digestive tract development
gut deformation
APC (NM_000038.5)
c.937_938delGA
X
Phenotype AllelePhenotype Genome
CGTACCG
GCGAAGTGCCAACTTCTACACACACAAAG
GCGAAGTGCCAACTTCTACACACACAAAG
X
AACGTACCGACGCTCGCTACGGGCGTATC
AACGTAGCGACGCTCGCTACGGGCGTATC
X
X
intestinal polyps
abnormal retinal pigmentation
sebaceous cysts
allele: apchu745
gene: apc fgf8a
allele: c.937_938delGA
gene: apc
(PHENOTYPE
PROPAGATION)
I. Reconciling Levels of G2P Association
inferred
apchu745/+; fgf8ati282/ti282(AB)
increased cell proliferation
disrupted digestive tract development
gut deformation
APC (NM_000038.5)
c.937_938delGA
X
Phenotype Genome
CGTACCG
GCGAAGTGCCAACTTCTACACACACAAAG
GCGAAGTGCCAACTTCTACACACACAAAG
X
AACGTACCGACGCTCGCTACGGGCGTATC
AACGTAGCGACGCTCGCTACGGGCGTATC
X
X
intestinal polyps
abnormal retinal pigmentation
sebaceous cysts
Phenotype Allele
Property chains exploit the transitive genotype
partonomy to infer phenotype associations
[variant] is_variant_part_of genotype
genotype has_phenotype phenotype
Atomic Relations
Composed Relation
is_variant_part_of o has_phenotype -->
is_variant_with_phenotype
Implementation of Phenotype Propagation
Example of Phenotype Propagation
has_phenotype
apchu745/+;fgf8ati282/ti282(AB)
cell proliferation,
digestive tract development
gut deformation
1. Monarch ingests
phenotypes annotated
to a genotype
genotype
Example of Phenotype Propagation
apchu745,
fgf8ati282
hu745
ti282
has_variant_part
has_variant_part
has_variant_part
has_variant_part
apchu745/+;fgf8ati282/ti282(AB)
apchu745/+;fgf8ati282/ti282
apchu745/+ ,
fgf8ati282/ti282
cell proliferation,
digestive tract development
gut deformation
apc fgf8a
1. Monarch ingests
phenotypes annotated
to a genotype
2. Genotype is parsed to
create instances down
partonomy Alleles
GVC
VSLCs
Seq.
Alts
Genes
has_phenotype
Example of Phenotype Propagation
1. Monarch ingests
phenotypes annotated
to a genotype
2. Genotype is parsed to
create instances down
partonomy
3. Phenotype propagation
infers associations
between phenotypes
and each level in the
partonomy
apchu745,
fgf8ati282
hu745
ti282
apc fgf8a
has_variant_part
has_variant_part
has_variant_part
has_variant_part
apchu745/+;fgf8ati282/ti282(AB)
apchu745/+;fgf8ati282/ti282
apchu745/+ ,
fgf8ati282/ti282
cell proliferation,
digestive tract development
gut deformation
Alleles
GVC
VSLCs
Seq.
Alts
Genes
has_phenotype
is_variant_
with_
phenotype
II. Integrating Non-Genomic Variation
‘Extrinsic genotypes’ describe
sequences subject to transient
variations in expression at the
time of an experiment
Representing extrinsic
variation data in terms of the
targeted genes facilitates
integration with ‘intrinsic’
G2P data
Morpholino-mediated
gene knockdown
;
III. Semantic Links to Related Data
GENO In the OBO Foundry
• GENO modeled according to OBO Foundry principles, under
conceptual frameworks of the BFO, IAO, and SO
• Collaborators in SO refactoring to enhance genetic variation
representation, and ensure integration of Monarch data with
SO-annotated genomes
Summary and Future Directions
GENO in the Monarch Data Integration Pipeline
1. Raw data ingested into Monarch RDB
2. Views generated that contain “GENO-enhanced” data
(standardized syntax, unpacked genotypes, links to external data)
3. D2RQ maps relational data to GENO and generates RDF
4. GENO-supported reasoning adds inferred G2P associations
(e.g. phenotype propagation)
Future Directions
1. Modeling of transgenes, human variation, and related data types
2. Develop property chains and algorithms to improve specificity and
weighting of inferred G2P associations
3. Separate application features to provide a community model for
public release and integration with SO
Acknowledgements
OHSU
Melissa Haendel
Carlo Torniai
Shahim Essaid
Nicole Vasilevsky
Scott Hoffman
LBNL
Chris Mungall
Suzi Lewis
Nicole Washington
UCSD/NIF
Maryann Martone
Anita Bandrowski
Jeff Grethe
Amarnath Gupta
Trish Whetzel
University of Pittsburgh
Harry Hochheiser
Chuck Borromeo
Monarch Initiative / NIF
Sequence Ontology
University of Utah
Karen Eilbeck
University of Colorado
Mike Bada
Funding
NIH # 1R24OD011883-01
We are under construction
OHSU Ontology
Development Group
www.ohsu.edu/library/ontology
GENO ontology
purl.obolibrary.org/obo/geno.owl

Más contenido relacionado

La actualidad más candente

Human genome project(ibri)
Human genome project(ibri)Human genome project(ibri)
Human genome project(ibri)ajay vishwakrma
 
The human genome project
The human genome projectThe human genome project
The human genome projectKundol Laa
 
The Chills and Thrills of Whole Genome Sequencing
The Chills and Thrills of Whole Genome SequencingThe Chills and Thrills of Whole Genome Sequencing
The Chills and Thrills of Whole Genome SequencingEmiliano De Cristofaro
 
Human genome project (2) converted
Human genome project (2) convertedHuman genome project (2) converted
Human genome project (2) convertedGAnchal
 
Bioinformatics as a tool for understanding carcinogenesis
Bioinformatics as a tool for understanding carcinogenesisBioinformatics as a tool for understanding carcinogenesis
Bioinformatics as a tool for understanding carcinogenesisDespoina Kalfakakou
 
YSP Week 3 HGP
YSP Week 3 HGPYSP Week 3 HGP
YSP Week 3 HGPLisa Feng
 
Next generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomicsNext generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomicsDr. Gerry Higgins
 
Human genome project
Human genome projectHuman genome project
Human genome projectmah neem mah
 
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...Nathan Olson
 
Microbial Metagenomics Drives a New Cyberinfrastructure
Microbial Metagenomics Drives a New CyberinfrastructureMicrobial Metagenomics Drives a New Cyberinfrastructure
Microbial Metagenomics Drives a New CyberinfrastructureLarry Smarr
 
Bioinformatics final
Bioinformatics finalBioinformatics final
Bioinformatics finalRainu Rajeev
 
Human genome project
Human genome projectHuman genome project
Human genome projectDilip jaipal
 

La actualidad más candente (20)

Human genome project(ibri)
Human genome project(ibri)Human genome project(ibri)
Human genome project(ibri)
 
The human genome project
The human genome projectThe human genome project
The human genome project
 
The Chills and Thrills of Whole Genome Sequencing
The Chills and Thrills of Whole Genome SequencingThe Chills and Thrills of Whole Genome Sequencing
The Chills and Thrills of Whole Genome Sequencing
 
Human genome project (2) converted
Human genome project (2) convertedHuman genome project (2) converted
Human genome project (2) converted
 
Bioinformatics as a tool for understanding carcinogenesis
Bioinformatics as a tool for understanding carcinogenesisBioinformatics as a tool for understanding carcinogenesis
Bioinformatics as a tool for understanding carcinogenesis
 
YSP Week 3 HGP
YSP Week 3 HGPYSP Week 3 HGP
YSP Week 3 HGP
 
Next generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomicsNext generation sequencing in pharmacogenomics
Next generation sequencing in pharmacogenomics
 
Human genome project
Human genome projectHuman genome project
Human genome project
 
sequencing-methods-review
sequencing-methods-reviewsequencing-methods-review
sequencing-methods-review
 
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
Next Generation Sequencing for Identification and Subtyping of Foodborne Pat...
 
Human genome project
Human genome projectHuman genome project
Human genome project
 
EU PathoNGenTraceConsortium:cgMLST Evolvement and Challenges for Harmonization
EU PathoNGenTraceConsortium:cgMLST Evolvement and Challenges for HarmonizationEU PathoNGenTraceConsortium:cgMLST Evolvement and Challenges for Harmonization
EU PathoNGenTraceConsortium:cgMLST Evolvement and Challenges for Harmonization
 
Microbial Metagenomics Drives a New Cyberinfrastructure
Microbial Metagenomics Drives a New CyberinfrastructureMicrobial Metagenomics Drives a New Cyberinfrastructure
Microbial Metagenomics Drives a New Cyberinfrastructure
 
Bioinformatics final
Bioinformatics finalBioinformatics final
Bioinformatics final
 
Human genome project and elsi
Human genome project and elsiHuman genome project and elsi
Human genome project and elsi
 
Human genome project ()
Human genome project ()Human genome project ()
Human genome project ()
 
HGP, the human genome project
HGP, the human genome projectHGP, the human genome project
HGP, the human genome project
 
Human genome project
Human genome projectHuman genome project
Human genome project
 
Human genome project
Human genome projectHuman genome project
Human genome project
 
Impact of the human genome project on medical advancement in India.
Impact of the human genome project on medical advancement in India.Impact of the human genome project on medical advancement in India.
Impact of the human genome project on medical advancement in India.
 

Destacado (9)

Ovary Function
Ovary  FunctionOvary  Function
Ovary Function
 
Genetics and Man
Genetics and ManGenetics and Man
Genetics and Man
 
Genotype and phenotype
Genotype and phenotypeGenotype and phenotype
Genotype and phenotype
 
Genetics: Genes in Populations
Genetics: Genes in PopulationsGenetics: Genes in Populations
Genetics: Genes in Populations
 
Prenatal Genetics
Prenatal GeneticsPrenatal Genetics
Prenatal Genetics
 
Genotypes and phenotypes
Genotypes and phenotypesGenotypes and phenotypes
Genotypes and phenotypes
 
Chapter 3 heredity and variation
Chapter 3   heredity and variationChapter 3   heredity and variation
Chapter 3 heredity and variation
 
Introduction to Genetics
Introduction to GeneticsIntroduction to Genetics
Introduction to Genetics
 
Mean, Median, Mode: Measures of Central Tendency
Mean, Median, Mode: Measures of Central Tendency Mean, Median, Mode: Measures of Central Tendency
Mean, Median, Mode: Measures of Central Tendency
 

Similar a What's In a Genotype?: An Ontological Characterization for the Integration of Genetic Variation Data

Genes related to aging, obesity and myocardial infarction
Genes related to aging, obesity and myocardial infarctionGenes related to aging, obesity and myocardial infarction
Genes related to aging, obesity and myocardial infarctionThet Su Win
 
Apolipoprotein A-V Genetic Variants in Obese Children
Apolipoprotein A-V Genetic Variants in Obese ChildrenApolipoprotein A-V Genetic Variants in Obese Children
Apolipoprotein A-V Genetic Variants in Obese ChildrenCrimsonPublishersIOD
 
Bifidobacterium strain that helps reduce body fat
Bifidobacterium strain that helps reduce body fatBifidobacterium strain that helps reduce body fat
Bifidobacterium strain that helps reduce body fatBiopolis_SL
 
Focusing the diversity of Gardnerella vaginalis through the lens of ecotypes
Focusing the diversity of Gardnerella vaginalis through the lens of ecotypesFocusing the diversity of Gardnerella vaginalis through the lens of ecotypes
Focusing the diversity of Gardnerella vaginalis through the lens of ecotypesRoxana Hickey
 
GH and IGF Research 2012 OR09-5
GH and IGF Research 2012 OR09-5GH and IGF Research 2012 OR09-5
GH and IGF Research 2012 OR09-5Caroline Nelson
 
1-s2.0-S0014480015000970-main
1-s2.0-S0014480015000970-main1-s2.0-S0014480015000970-main
1-s2.0-S0014480015000970-mainHelene Schulz
 
Gene related to aging, obesity, and myocardial infarction, Fragile X Syndrome...
Gene related to aging, obesity, and myocardial infarction, Fragile X Syndrome...Gene related to aging, obesity, and myocardial infarction, Fragile X Syndrome...
Gene related to aging, obesity, and myocardial infarction, Fragile X Syndrome...maysoethu
 
Pells et al [2015] PLoS ONE 10[7] e0131102
Pells et al [2015] PLoS ONE 10[7] e0131102Pells et al [2015] PLoS ONE 10[7] e0131102
Pells et al [2015] PLoS ONE 10[7] e0131102Steve Pells
 
Short intro epigenetics & nutrigenomics& the early impact of nutrition
Short intro epigenetics & nutrigenomics& the early impact of nutrition Short intro epigenetics & nutrigenomics& the early impact of nutrition
Short intro epigenetics & nutrigenomics& the early impact of nutrition Norwich Research Park
 
Cofer, methylation microarry, PLOS (2016).PDF
Cofer, methylation microarry, PLOS (2016).PDFCofer, methylation microarry, PLOS (2016).PDF
Cofer, methylation microarry, PLOS (2016).PDFZenobia Cofer
 
NUT3008 Biochemistry Genetics And Molecular Nutrition.docx
NUT3008 Biochemistry Genetics And Molecular Nutrition.docxNUT3008 Biochemistry Genetics And Molecular Nutrition.docx
NUT3008 Biochemistry Genetics And Molecular Nutrition.docxstirlingvwriters
 
Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...
Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...
Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...Wani Ahad
 
Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...
Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...
Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...Wani Ahad
 
Proteomic Analysis of the Serum and Excretory-Secretary proteins of Trichinel...
Proteomic Analysis of the Serum and Excretory-Secretary proteins of Trichinel...Proteomic Analysis of the Serum and Excretory-Secretary proteins of Trichinel...
Proteomic Analysis of the Serum and Excretory-Secretary proteins of Trichinel...AmalDhivaharS
 

Similar a What's In a Genotype?: An Ontological Characterization for the Integration of Genetic Variation Data (20)

Eample_presentation
Eample_presentationEample_presentation
Eample_presentation
 
Gfba Gene Essay
Gfba Gene EssayGfba Gene Essay
Gfba Gene Essay
 
Genes related to aging, obesity and myocardial infarction
Genes related to aging, obesity and myocardial infarctionGenes related to aging, obesity and myocardial infarction
Genes related to aging, obesity and myocardial infarction
 
Apolipoprotein A-V Genetic Variants in Obese Children
Apolipoprotein A-V Genetic Variants in Obese ChildrenApolipoprotein A-V Genetic Variants in Obese Children
Apolipoprotein A-V Genetic Variants in Obese Children
 
Pone.0034901
Pone.0034901Pone.0034901
Pone.0034901
 
Bifidobacterium strain that helps reduce body fat
Bifidobacterium strain that helps reduce body fatBifidobacterium strain that helps reduce body fat
Bifidobacterium strain that helps reduce body fat
 
Focusing the diversity of Gardnerella vaginalis through the lens of ecotypes
Focusing the diversity of Gardnerella vaginalis through the lens of ecotypesFocusing the diversity of Gardnerella vaginalis through the lens of ecotypes
Focusing the diversity of Gardnerella vaginalis through the lens of ecotypes
 
GH and IGF Research 2012 OR09-5
GH and IGF Research 2012 OR09-5GH and IGF Research 2012 OR09-5
GH and IGF Research 2012 OR09-5
 
1-s2.0-S0014480015000970-main
1-s2.0-S0014480015000970-main1-s2.0-S0014480015000970-main
1-s2.0-S0014480015000970-main
 
Gene related to aging, obesity, and myocardial infarction, Fragile X Syndrome...
Gene related to aging, obesity, and myocardial infarction, Fragile X Syndrome...Gene related to aging, obesity, and myocardial infarction, Fragile X Syndrome...
Gene related to aging, obesity, and myocardial infarction, Fragile X Syndrome...
 
Pells et al [2015] PLoS ONE 10[7] e0131102
Pells et al [2015] PLoS ONE 10[7] e0131102Pells et al [2015] PLoS ONE 10[7] e0131102
Pells et al [2015] PLoS ONE 10[7] e0131102
 
Short intro epigenetics & nutrigenomics& the early impact of nutrition
Short intro epigenetics & nutrigenomics& the early impact of nutrition Short intro epigenetics & nutrigenomics& the early impact of nutrition
Short intro epigenetics & nutrigenomics& the early impact of nutrition
 
DNA methylation and Diet
DNA methylation and DietDNA methylation and Diet
DNA methylation and Diet
 
Cofer, methylation microarry, PLOS (2016).PDF
Cofer, methylation microarry, PLOS (2016).PDFCofer, methylation microarry, PLOS (2016).PDF
Cofer, methylation microarry, PLOS (2016).PDF
 
Science 2010
Science 2010Science 2010
Science 2010
 
NUT3008 Biochemistry Genetics And Molecular Nutrition.docx
NUT3008 Biochemistry Genetics And Molecular Nutrition.docxNUT3008 Biochemistry Genetics And Molecular Nutrition.docx
NUT3008 Biochemistry Genetics And Molecular Nutrition.docx
 
Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...
Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...
Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...
 
Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...
Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...
Sequence Characterization of Coding Regions of the Myostatin Gene (GDF8) from...
 
Proteomic Analysis of the Serum and Excretory-Secretary proteins of Trichinel...
Proteomic Analysis of the Serum and Excretory-Secretary proteins of Trichinel...Proteomic Analysis of the Serum and Excretory-Secretary proteins of Trichinel...
Proteomic Analysis of the Serum and Excretory-Secretary proteins of Trichinel...
 
Nutrigenomics
NutrigenomicsNutrigenomics
Nutrigenomics
 

Último

Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxVishalSingh1417
 
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...Sapna Thakur
 
Arihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdfArihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdfchloefrazer622
 
microwave assisted reaction. General introduction
microwave assisted reaction. General introductionmicrowave assisted reaction. General introduction
microwave assisted reaction. General introductionMaksud Ahmed
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsTechSoup
 
BASLIQ CURRENT LOOKBOOK LOOKBOOK(1) (1).pdf
BASLIQ CURRENT LOOKBOOK  LOOKBOOK(1) (1).pdfBASLIQ CURRENT LOOKBOOK  LOOKBOOK(1) (1).pdf
BASLIQ CURRENT LOOKBOOK LOOKBOOK(1) (1).pdfSoniaTolstoy
 
Activity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfActivity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfciinovamais
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...EduSkills OECD
 
Beyond the EU: DORA and NIS 2 Directive's Global Impact
Beyond the EU: DORA and NIS 2 Directive's Global ImpactBeyond the EU: DORA and NIS 2 Directive's Global Impact
Beyond the EU: DORA and NIS 2 Directive's Global ImpactPECB
 
1029 - Danh muc Sach Giao Khoa 10 . pdf
1029 -  Danh muc Sach Giao Khoa 10 . pdf1029 -  Danh muc Sach Giao Khoa 10 . pdf
1029 - Danh muc Sach Giao Khoa 10 . pdfQucHHunhnh
 
The basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptxThe basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptxheathfieldcps1
 
A Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy ReformA Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy ReformChameera Dedduwage
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactdawncurless
 
9548086042 for call girls in Indira Nagar with room service
9548086042  for call girls in Indira Nagar  with room service9548086042  for call girls in Indira Nagar  with room service
9548086042 for call girls in Indira Nagar with room servicediscovermytutordmt
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfagholdier
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxiammrhaywood
 
Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Disha Kariya
 
Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Celine George
 

Último (20)

Unit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptxUnit-IV- Pharma. Marketing Channels.pptx
Unit-IV- Pharma. Marketing Channels.pptx
 
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
BAG TECHNIQUE Bag technique-a tool making use of public health bag through wh...
 
Arihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdfArihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdf
 
microwave assisted reaction. General introduction
microwave assisted reaction. General introductionmicrowave assisted reaction. General introduction
microwave assisted reaction. General introduction
 
Introduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The BasicsIntroduction to Nonprofit Accounting: The Basics
Introduction to Nonprofit Accounting: The Basics
 
BASLIQ CURRENT LOOKBOOK LOOKBOOK(1) (1).pdf
BASLIQ CURRENT LOOKBOOK  LOOKBOOK(1) (1).pdfBASLIQ CURRENT LOOKBOOK  LOOKBOOK(1) (1).pdf
BASLIQ CURRENT LOOKBOOK LOOKBOOK(1) (1).pdf
 
Activity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdfActivity 01 - Artificial Culture (1).pdf
Activity 01 - Artificial Culture (1).pdf
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
 
Beyond the EU: DORA and NIS 2 Directive's Global Impact
Beyond the EU: DORA and NIS 2 Directive's Global ImpactBeyond the EU: DORA and NIS 2 Directive's Global Impact
Beyond the EU: DORA and NIS 2 Directive's Global Impact
 
1029 - Danh muc Sach Giao Khoa 10 . pdf
1029 -  Danh muc Sach Giao Khoa 10 . pdf1029 -  Danh muc Sach Giao Khoa 10 . pdf
1029 - Danh muc Sach Giao Khoa 10 . pdf
 
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
 
Advance Mobile Application Development class 07
Advance Mobile Application Development class 07Advance Mobile Application Development class 07
Advance Mobile Application Development class 07
 
The basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptxThe basics of sentences session 2pptx copy.pptx
The basics of sentences session 2pptx copy.pptx
 
A Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy ReformA Critique of the Proposed National Education Policy Reform
A Critique of the Proposed National Education Policy Reform
 
Accessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impactAccessible design: Minimum effort, maximum impact
Accessible design: Minimum effort, maximum impact
 
9548086042 for call girls in Indira Nagar with room service
9548086042  for call girls in Indira Nagar  with room service9548086042  for call girls in Indira Nagar  with room service
9548086042 for call girls in Indira Nagar with room service
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdf
 
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptxSOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
SOCIAL AND HISTORICAL CONTEXT - LFTVD.pptx
 
Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..Sports & Fitness Value Added Course FY..
Sports & Fitness Value Added Course FY..
 
Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17Advanced Views - Calendar View in Odoo 17
Advanced Views - Calendar View in Odoo 17
 

What's In a Genotype?: An Ontological Characterization for the Integration of Genetic Variation Data

  • 1. An Ontological Characterization for the Integration of Genetic Variation Data WHAT’S IN A GENOTYPE? Matthew H. Brush, Chris Mungall, Nicole Washington, and Melissa Haendel Oregon Health and Science University, Lawrence Berkeley Labs International Conference in Biomedical Ontology July 8, 2013
  • 2. Genotype-to-Phenotype Research B6.Cg-Alms1foz/fox/J increased weight, adipose tissue volume, glucose homeostasis altered ALSM1(NM_015120.4) [c.10775delC] + [-] GENOTYPE PHENOTYPE obesity, diabetes mellitus, insulin resistance increased food intake, hyperglycemia, insulin resistance kcnj11c14/c14; insrt143/+(AB) G2P research seeks a mechanistic understanding of how genetic variation is linked to organismal biology and disease
  • 4. Integrating G2P Data The Monarch Initiative The Monarch Initiative aims to bring G2P and related data together under a common semantic framework to support integrated exploration and analysis.
  • 5. Integration Challenges I. Reconciling G2P data annotated to different ‘levels’ of a genotype II. Integrating ‘non-genomic’ forms of variation III. Creating semantic links to biological data Technical Challenges  Terminological, syntactic, organizational variation in data is common Knowledge-Based Challenges  Reflect inherent complexity in the way G2P data is generated and what it represents
  • 6. GCGAAGTGCCAACTTCTACACACACAAAG GCGAAGTGCCAACTTCTACACACACAAAG Decomposition of a Genotype genotype genomic variation complementgenomic background = + CGTAGC CGTACC apchu745/+; fgf8ati282/ti282(AB) genomic variation complement variant single locus complement variant locus (allele) sequence alteration has_part has_part apchu745/+ apchu745 hu745 has_part has_part has_part has_part X AACGTACCGACGCTCGCTACGGGCGTATC (AB) apchu745/+; fgf8ati282/ti282 apchu745/+; fgf8ati282/ti282 GCGAAGTGCCAACTTCTACACACACAAAG GCGAAGTGCCAACTTCTACACACACAAAG AACGTAGCGACGCTCGCTACGGGCGTATC AACGTACCGACGCTCGCTACGGGCGTATC X ACAC X X X X Genotype – an information entity that specifies an entire genome sequence in terms of its variation from some reference genome AACGTAGCGACGCTCGCTACGGGCGTATC X ACAC X X X X X
  • 7. I. Reconciling Levels of G2P Association apchu745/+; fgf8ati282/ti282(AB) increased cell proliferation disrupted digestive tract development gut deformation APC (NM_000038.5) c.937_938delGA X Phenotype AllelePhenotype Genome CGTACCG GCGAAGTGCCAACTTCTACACACACAAAG GCGAAGTGCCAACTTCTACACACACAAAG X AACGTACCGACGCTCGCTACGGGCGTATC AACGTAGCGACGCTCGCTACGGGCGTATC X X intestinal polyps abnormal retinal pigmentation sebaceous cysts
  • 8. allele: apchu745 gene: apc fgf8a allele: c.937_938delGA gene: apc (PHENOTYPE PROPAGATION) I. Reconciling Levels of G2P Association inferred apchu745/+; fgf8ati282/ti282(AB) increased cell proliferation disrupted digestive tract development gut deformation APC (NM_000038.5) c.937_938delGA X Phenotype Genome CGTACCG GCGAAGTGCCAACTTCTACACACACAAAG GCGAAGTGCCAACTTCTACACACACAAAG X AACGTACCGACGCTCGCTACGGGCGTATC AACGTAGCGACGCTCGCTACGGGCGTATC X X intestinal polyps abnormal retinal pigmentation sebaceous cysts Phenotype Allele
  • 9. Property chains exploit the transitive genotype partonomy to infer phenotype associations [variant] is_variant_part_of genotype genotype has_phenotype phenotype Atomic Relations Composed Relation is_variant_part_of o has_phenotype --> is_variant_with_phenotype Implementation of Phenotype Propagation
  • 10. Example of Phenotype Propagation has_phenotype apchu745/+;fgf8ati282/ti282(AB) cell proliferation, digestive tract development gut deformation 1. Monarch ingests phenotypes annotated to a genotype genotype
  • 11. Example of Phenotype Propagation apchu745, fgf8ati282 hu745 ti282 has_variant_part has_variant_part has_variant_part has_variant_part apchu745/+;fgf8ati282/ti282(AB) apchu745/+;fgf8ati282/ti282 apchu745/+ , fgf8ati282/ti282 cell proliferation, digestive tract development gut deformation apc fgf8a 1. Monarch ingests phenotypes annotated to a genotype 2. Genotype is parsed to create instances down partonomy Alleles GVC VSLCs Seq. Alts Genes has_phenotype
  • 12. Example of Phenotype Propagation 1. Monarch ingests phenotypes annotated to a genotype 2. Genotype is parsed to create instances down partonomy 3. Phenotype propagation infers associations between phenotypes and each level in the partonomy apchu745, fgf8ati282 hu745 ti282 apc fgf8a has_variant_part has_variant_part has_variant_part has_variant_part apchu745/+;fgf8ati282/ti282(AB) apchu745/+;fgf8ati282/ti282 apchu745/+ , fgf8ati282/ti282 cell proliferation, digestive tract development gut deformation Alleles GVC VSLCs Seq. Alts Genes has_phenotype is_variant_ with_ phenotype
  • 13. II. Integrating Non-Genomic Variation ‘Extrinsic genotypes’ describe sequences subject to transient variations in expression at the time of an experiment Representing extrinsic variation data in terms of the targeted genes facilitates integration with ‘intrinsic’ G2P data Morpholino-mediated gene knockdown ;
  • 14. III. Semantic Links to Related Data
  • 15. GENO In the OBO Foundry • GENO modeled according to OBO Foundry principles, under conceptual frameworks of the BFO, IAO, and SO • Collaborators in SO refactoring to enhance genetic variation representation, and ensure integration of Monarch data with SO-annotated genomes
  • 16. Summary and Future Directions GENO in the Monarch Data Integration Pipeline 1. Raw data ingested into Monarch RDB 2. Views generated that contain “GENO-enhanced” data (standardized syntax, unpacked genotypes, links to external data) 3. D2RQ maps relational data to GENO and generates RDF 4. GENO-supported reasoning adds inferred G2P associations (e.g. phenotype propagation) Future Directions 1. Modeling of transgenes, human variation, and related data types 2. Develop property chains and algorithms to improve specificity and weighting of inferred G2P associations 3. Separate application features to provide a community model for public release and integration with SO
  • 17. Acknowledgements OHSU Melissa Haendel Carlo Torniai Shahim Essaid Nicole Vasilevsky Scott Hoffman LBNL Chris Mungall Suzi Lewis Nicole Washington UCSD/NIF Maryann Martone Anita Bandrowski Jeff Grethe Amarnath Gupta Trish Whetzel University of Pittsburgh Harry Hochheiser Chuck Borromeo Monarch Initiative / NIF Sequence Ontology University of Utah Karen Eilbeck University of Colorado Mike Bada Funding NIH # 1R24OD011883-01 We are under construction OHSU Ontology Development Group www.ohsu.edu/library/ontology GENO ontology purl.obolibrary.org/obo/geno.owl