Amino acids link together through peptide bonds to form proteins. The specific sequence of amino acids is determined by the DNA sequence. mRNA carries this code from DNA to the ribosome where tRNA brings the correct amino acids. Weak hydrogen bonds allow proteins to fold into complex 3D shapes like coils, pleats, and sheets that enable their many functions. Lipids are insoluble in water and include triglycerides, phospholipids, and cholesterol. Triglycerides store energy and are made of a glycerol molecule bonded to three fatty acid chains. Phospholipids form the structure of cell membranes with a hydrophilic head and hydrophobic tails. Carbohydrates include monosaccharides, disaccharides, and
2. 20 essential amino acids
Linked together to make proteins
Made of amine group, carboxylic
acid, and R group (side chain)
3. Sequence of amino acids
Depends on the DNA sequence
› mRNA is formed by pairing with DNA
› mRNA is then read by the ribosome
› tRNA with the mRNA to bring correct amino acid
to the right place
› as more tRNA comes in the amino acids produced
are then connected with a peptide bond
ACAAUGGAACAUAGAUACAUA
17. Organic compound made of Carbon,
Hydrogen, & Oxygen in ratio of
› 1C : 2H : 1O
Used for energy storage
3 types:
› Monosaccharides
› Disaccharides
› Polysaccharides
19. Two monosaccharide sugars linked
together by dehydration synthesis
Soluble in water
Example: Sucrose
20. More than 2 sugars linked together
Formed by dehydration synthesis
Usually not soluble in water
Examples: Starch, cellulose, & Glycogen
Starch:
› Sugars the same way
› Primary source of calories
Cellulose:
› Sugars are opposite every other one
Glycogen:
› Sugars are branched
21. Monomers joined together to make
polymers
› Loss of water when they are joined
› Electrons are rearranged
› New bond is formed
23. Synthesis reactions: combining atoms
› Anabolic reactions
› Require more energy than produced
Decomposition reactions: breaking apart
› Catabolic reactions
› More energy released than needed