SlideShare una empresa de Scribd logo
1 de 87
Unearthing the Roots of Venice:From Relics to DNA(allascopertadelleoriginidiVenezia) Debora Afezolli Benjamin M. Allen Jaclyn Hepworth Andrew J. Kazanovicz
Ancient Documents Archaeology Genetic Genealogy
  Archaeologist 2 To be filled for every object/layer ~100 per intervento   Archaeological  potential map  Cross-reference     Searchable Scheda statua  Scheda sito  Scheda tomba Scheda inorganico   Index forms Scheda organico  Scheda unita stratigrafica (US)  Create manualmente Schede  Soprintendenza Archeologica Foto  Consegna a mano    Archaeologist 1 Disegni 
ArchEasy: UnaSoluzione Sistemadigestione geo-spaziale per l’archiviazionedigitale e la correlazioneautomaticadeidatiarcheologicidiVenezia Form management Database search Automatic indexing Interpretative maps Initial prototype system design
   Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica   Archaeological  potential map  Correlazioni Electronically submitted    Searchable Interpretazionedati  Index forms ArchEasy database Schede  Caricate digitalmente Foto  Disegni 
   Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica   Archaeological  potential map  Cross-reference Electronically submitted    Searchable Data Interpretation  Index forms ArchEasy database Schede   Electronically uploaded Foto  Disegni 
Modulistica Paper US form ArchEasy electronic US form
   Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica   Archaeological  potential map  Cross-reference Electronically submitted    Searchable Data Interpretation   Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
Old paper index US form ArchEasy electronic index US form Indexing
   Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica   Archaeological  potential map  Cross-reference Electronically submitted     Searchable Data Interpretation  Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
Ricercatradizionale Manually searched Old searching methods to find desired data ,[object Object]
Ineffective
Difficult to cross-reference,[object Object]
Geo-referenziazioneDati View the Map
   Archaeologist 2 Automatic Automatic Archaeologist 1  Soprintendenza Archeologica   Archaeological  potential map  Cross-reference Electronically submitted    Searchable Data Interpretation  Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
Potenzialearcheologico Basso potenziale Maggiorpotenziale Broad representation of archaeological potential
Public works official PotenzialeArcheologico View all objects on map Consults map Relics near Via Barovier are found every 15m High likelihood of more of these objects, so budget accordingly Application to public works
   Archaeologist 2 Automatic Automatic Archaeologist 1  Soprintendenza Archeologica   Archaeological  potential map  Cross-reference Electronically submitted    Searchable Data Interpretation  Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
Correlazionetrareperti ArchEasy Correlates data Similar elevation, also 13th Century Brick floor Found: 1.5m beneath Origins: 13th Century  Brick floor Found: 1.5m beneath Origins: ??  Correlational ability of ArchEasy
In Futuro: Approccio ad AgentiAutonomi I have a similar floor pattern, therefore I could also be a 15th century church My brick size is 14x12x7 cm I’m a 15th century church with herringbone floors My brick size is 22x15x9 cm, and I am 100 years old I could also be 100 years old I have the same type of floor, oriented in the same direction My brick size is 22x15x9 cm Self-correlating autonomous agent approach
Risultati ad oggi ,[object Object],Introducing ArchEasy… ,[object Object]
Easy completion of administrative form requirements
Archaeological potential maps
Complete customization and control of workspace
Effective search function to enable cross-referencing,[object Object]
ArchiviodiStato Unbroken documentary history 90km of shelves Painstaking to access and utilize the documents
L’attualesistemadiconsultazionedell’ArchiviodiStato Publications Archive Scholar 1 Pages Transcriptions Santa Maria della Salute Manuscripts Retrieves Searches Deliver to  90km of Shelves Request Information Choose
Publications Archive Scholar 2 Duplicate Transcriptions Pages L’attualesistemadiconsultazionedell’ArchiviodiStato SAME Manuscripts Santa Maria della Salute Retrieves Searches Deliver to 90km of Shelves Request SAME Information Choose
Publications Archive Scholar 3 TriplicateTranscriptions Pages L’attualesistemadiconsultazionedell’ArchiviodiStato SAME Manuscripts Santa Maria della Salute Retrieves Searches Deliver to 90km of Shelves Request SAME Information Choose
Le trascrizioni non sonocondivise! Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Transcriptions     SHARING
uScript: UnaSoluzione Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Transcriptions SHARING
Contribution Accountant ComponentidiuScript 3 Components Archive Assistant Transcription Assistant Archive Assistant Transcription Assistant
uScript Scholar 1 Scholar 3 Scholar 2 uScript: concettigenerali Archive Assistant Santa Maria della Salute Search
uScript Scholar 1 Scholar 3 Scholar 2 Manuscripts Archive Assistant
I In In n no nom nomi nomin nomine nomine d do dom domi domin domini domini Marie Transcription Assistant
uScript Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Manuscripts Manuscripts Archive Assistant Contribution Accountant Search d do dom domi domin domini
I In In n no nom nomi nomin nomine nomine d do dom domi domin domini domini n no nos nost nostr nostri nostri Marie Transcription Assistant
M Ma Mar Mary Mary Transcription Assistant
uScript Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Manuscripts Manuscripts Archive Assistant Contribution Accountant Search d do dom domi domin domini
Marie Transcription Assistant
uScript Scholar 1 Scholar 3 Scholar 2 Transcriptions Manuscripts Archive Assistant Contribution Accountant
I Componenti Contribution Accountant Archive Assistant Transcription Assistant Archive Assistant Contribution Accountant Search Manuscripts and Transcriptions  Rate Contributors and Transcriptions Transcription Database Promotes Accuracy  Learn Handwriting  Automatic Transcriptions Automatic Boxing
Transcriptions Transcriptions Transcriptions Transcriptions Nientevienescartato! uScript
Risultati ad oggi Promotional Website: show and explain everything that is uScript
Contribution to Origins Theory OriginideiVeneti Scavialimentanoteorie DNAConfermateorie Documentirafforzanoteorie
TeoriesulleOriginideiVeneti Lusatia ? Brittany ? Paphlagonia ?
OriginidallaPaflagonia?
Paphlagonian Theory
Paphlagonian Theory Livy – Aburbe condita 1st Century B.C.E. “Antenor sailed into the furthest part of the Adriatic, accompanied by a number of Enetians…and the name was extended to the surrounding district; the whole nation were called Veneti”
Paphlagonian Theory Homer – The Illiad 8th Century B.C.E. “The Paphlagonianswere commanded by a stout-hearted Pylaemenes from Enetae…”
MenzionideiVeneti in Britannia
Brittany Theory
Brittany Theory Strabo – Ancient Greek Historian  1st Century A.C.E. Claim that ancestors of Veneto are not the Enetae of Paphlagoniabut the Veneti of Gaul
OriginidallaLusazia?
Lusatia Theory
Lusatia Theory Salvi – Veneti: First Builders of European Community 1984 A.C.E. Developed VeneticTheory claiming most current day European populations are descendants of the Veneti of Lusatia
? ? ?
? ? ?
VerificageneticadelleTeorie ? ? ?
Collaborazione al progettoGenographics
Genographic Project Collaboration
Genographic Project Collaboration
Genographic Project Collaboration 300
Requisiti del progetto Maschi Soprai18 anni DalTriveneto
Veneto Barcelona
163
Estrazione del DNA
Y-Chromosomal DNA Y-chromosome
Y-Chromosomal DNA Coding DNA (genes) Y-chromosome
Y-Chromosomal DNA Coding DNA (genes) Non-coding DNA Y-chromosome
Y-Chromosomal DNA Coding DNA (genes) Non-coding DNA Loci  - 12 locations of interest Y-chromosome
Y-Chromosomal DNA ATCTCATACATACATACATAGCTA Y-chromosome
Y-Chromosomal DNA 4 complementary nucleotides A,T,C, and G ATCTCATACATACATACATAGCTA Y-chromosome
Y-Chromosomal DNA Scientists examine  short tandem repeats (STRs) ATCTCATACATACATACATAGCTA Y-chromosome
Y-Chromosomal DNA Scientists examine  short tandem repeats (STRs) ATCTCATACATACATACATAGCTA Y-chromosome
Y-Chromosomal DNA Scientists examine  short tandem repeats (STRs) ATCTCATACATACATACATAGCTA Y-chromosome
Y-Chromosomal DNA Scientists examine  short tandem repeats (STRs) ATCTCATACATACATACATAGCTA 4 CATA repetitions = 4 STRs Y-chromosome
Esempio del metododiconfrontogenetico Venice               	ATCTCATACATACATACATAGCTA
Hypothetical DNA Comparison Venice               	ATCTCATACATACATACATAGCTA PaphlagoniaATCACATACATACATACATAGCA Lusatia               	GCTGACCATACTGAACGATATC Brittany    		GCTAACGAATGTCAAGCTAATA
Hypothetical DNA Comparison Venice               	ATCTCATACATACATACATAGCTA Paphlagonia 	ATCACATACATACATACATAGCA Lusatia               	GCTGACCATACTGAACGATATC Brittany    		GCTAACGAATGTCAAGCTAATA
Hypothetical DNA Comparison Venice               	ATCTCATACATACATACATAGCTA Paphlagonia 	ATCACATACATACATACATAGCA Lusatia               	GCTGACCATACTGAACGATATC Brittany    		GCTAACGAATGTCAAGCTAATA
Hypothetical DNA Comparison Venice               	ATCTCATACATACATACATAGCTA                                                (4 STRs) Paphlagonia 	ATCACATACATACATACATAGCA Lusatia               	GCTGACCATACTGAACGATATC Brittany    		GCTAACGAATGTCAAGCTAATA
Hypothetical DNA Comparison Venice               	ATCTCATACATACATACATAGCTA                                                (4 STRs) PaphlagoniaATCACATACATACATACATAGCA Lusatia               	GCTGACCATACTGAACGATATC Brittany    		GCTAACGAATGTCAAGCTAATA
Hypothetical DNA Comparison Venice               	ATCTCATACATACATACATAGCTA                                                (4 STRs) PaphlagoniaATCACATACATACATACATAGCA                                                (4 STRs) Lusatia               	GCTGACCATACTGAACGATATC                                                (1 STRs) Brittany    		GCTAACGAATGTCAAGCTAATA (0 STRs)
Hypothetical DNA Comparison Venice               	ATCTCATACATACATACATAGCTA                                                (4 STRs) PaphlagoniaATCACATACATACATACATAGCA                                                (4 STRs) Lusatia               	GCTGACCATACTGAACGATATC                                                (1 STRs) Brittany    		GCTAACGAATGTCAAGCTAATA (0 STRs)   

Más contenido relacionado

Destacado

Ilets 2nd hourly
Ilets   2nd hourlyIlets   2nd hourly
Ilets 2nd hourlyPAF-KIET
 
Final Presentation Italian B09 Ships
Final Presentation Italian B09 ShipsFinal Presentation Italian B09 Ships
Final Presentation Italian B09 Shipsvenice2point0
 
Presentation final b10_venipedia
Presentation final b10_venipediaPresentation final b10_venipedia
Presentation final b10_venipediavenice2point0
 
PreserVenice: Preserving Venetian Material Culture
PreserVenice:  Preserving Venetian Material CulturePreserVenice:  Preserving Venetian Material Culture
PreserVenice: Preserving Venetian Material Culturevenice2point0
 
An Update on Canal Hydrodynamics
An Update on Canal HydrodynamicsAn Update on Canal Hydrodynamics
An Update on Canal Hydrodynamicsvenice2point0
 
Mobility_B11_Presentation_EN
Mobility_B11_Presentation_ENMobility_B11_Presentation_EN
Mobility_B11_Presentation_ENvenice2point0
 
Final Presentation_B10_Origins
Final Presentation_B10_OriginsFinal Presentation_B10_Origins
Final Presentation_B10_Originsvenice2point0
 
Final Presentation B09 - Venice 4.0: Visualizing Venice
Final Presentation B09 - Venice 4.0: Visualizing VeniceFinal Presentation B09 - Venice 4.0: Visualizing Venice
Final Presentation B09 - Venice 4.0: Visualizing Venicevenice2point0
 
Ve11 Mobility Presentation_part1
Ve11 Mobility Presentation_part1Ve11 Mobility Presentation_part1
Ve11 Mobility Presentation_part1venice2point0
 
Mobility in the Floating City: A Study of Pedestrian Transportation
Mobility in the Floating City: A Study of Pedestrian Transportation Mobility in the Floating City: A Study of Pedestrian Transportation
Mobility in the Floating City: A Study of Pedestrian Transportation venice2point0
 
Cruise Control: Cruise Ships Influencing the City of Venice
Cruise Control: Cruise Ships Influencing the City of VeniceCruise Control: Cruise Ships Influencing the City of Venice
Cruise Control: Cruise Ships Influencing the City of Venicevenice2point0
 

Destacado (12)

Ilets 2nd hourly
Ilets   2nd hourlyIlets   2nd hourly
Ilets 2nd hourly
 
Final Presentation Italian B09 Ships
Final Presentation Italian B09 ShipsFinal Presentation Italian B09 Ships
Final Presentation Italian B09 Ships
 
Hydra
HydraHydra
Hydra
 
Presentation final b10_venipedia
Presentation final b10_venipediaPresentation final b10_venipedia
Presentation final b10_venipedia
 
PreserVenice: Preserving Venetian Material Culture
PreserVenice:  Preserving Venetian Material CulturePreserVenice:  Preserving Venetian Material Culture
PreserVenice: Preserving Venetian Material Culture
 
An Update on Canal Hydrodynamics
An Update on Canal HydrodynamicsAn Update on Canal Hydrodynamics
An Update on Canal Hydrodynamics
 
Mobility_B11_Presentation_EN
Mobility_B11_Presentation_ENMobility_B11_Presentation_EN
Mobility_B11_Presentation_EN
 
Final Presentation_B10_Origins
Final Presentation_B10_OriginsFinal Presentation_B10_Origins
Final Presentation_B10_Origins
 
Final Presentation B09 - Venice 4.0: Visualizing Venice
Final Presentation B09 - Venice 4.0: Visualizing VeniceFinal Presentation B09 - Venice 4.0: Visualizing Venice
Final Presentation B09 - Venice 4.0: Visualizing Venice
 
Ve11 Mobility Presentation_part1
Ve11 Mobility Presentation_part1Ve11 Mobility Presentation_part1
Ve11 Mobility Presentation_part1
 
Mobility in the Floating City: A Study of Pedestrian Transportation
Mobility in the Floating City: A Study of Pedestrian Transportation Mobility in the Floating City: A Study of Pedestrian Transportation
Mobility in the Floating City: A Study of Pedestrian Transportation
 
Cruise Control: Cruise Ships Influencing the City of Venice
Cruise Control: Cruise Ships Influencing the City of VeniceCruise Control: Cruise Ships Influencing the City of Venice
Cruise Control: Cruise Ships Influencing the City of Venice
 

Más de venice2point0

Ve11 super final presentation
Ve11 super final presentationVe11 super final presentation
Ve11 super final presentationvenice2point0
 
Ve11 mobility presentation_part2
Ve11 mobility presentation_part2Ve11 mobility presentation_part2
Ve11 mobility presentation_part2venice2point0
 
Final Presentation - Material Culture B11
Final Presentation - Material Culture B11Final Presentation - Material Culture B11
Final Presentation - Material Culture B11venice2point0
 
Bien B '11 Final Presentation EN
Bien B '11  Final Presentation ENBien B '11  Final Presentation EN
Bien B '11 Final Presentation ENvenice2point0
 
Final presentation b10_shops
Final presentation b10_shopsFinal presentation b10_shops
Final presentation b10_shopsvenice2point0
 
PreserVenice: Preserving Venetian Material Culture
PreserVenice: Preserving Venetian Material CulturePreserVenice: Preserving Venetian Material Culture
PreserVenice: Preserving Venetian Material Culturevenice2point0
 
Return to the City of Water: Quantifying Change in the Venetian Canals
Return to the City of Water: Quantifying Change in the Venetian CanalsReturn to the City of Water: Quantifying Change in the Venetian Canals
Return to the City of Water: Quantifying Change in the Venetian Canalsvenice2point0
 
Mobility B09 (Italian)
Mobility B09 (Italian)Mobility B09 (Italian)
Mobility B09 (Italian)venice2point0
 
B09 Origins Archaeological Process
B09 Origins Archaeological ProcessB09 Origins Archaeological Process
B09 Origins Archaeological Processvenice2point0
 
PublicEarthPresentationB09
PublicEarthPresentationB09PublicEarthPresentationB09
PublicEarthPresentationB09venice2point0
 
Final Presentation English B09 Veninomics
Final Presentation English B09 VeninomicsFinal Presentation English B09 Veninomics
Final Presentation English B09 Veninomicsvenice2point0
 
Final Presentation English B09 Ships
Final Presentation English B09 ShipsFinal Presentation English B09 Ships
Final Presentation English B09 Shipsvenice2point0
 
Mobility B09 (English)
Mobility B09 (English)Mobility B09 (English)
Mobility B09 (English)venice2point0
 

Más de venice2point0 (13)

Ve11 super final presentation
Ve11 super final presentationVe11 super final presentation
Ve11 super final presentation
 
Ve11 mobility presentation_part2
Ve11 mobility presentation_part2Ve11 mobility presentation_part2
Ve11 mobility presentation_part2
 
Final Presentation - Material Culture B11
Final Presentation - Material Culture B11Final Presentation - Material Culture B11
Final Presentation - Material Culture B11
 
Bien B '11 Final Presentation EN
Bien B '11  Final Presentation ENBien B '11  Final Presentation EN
Bien B '11 Final Presentation EN
 
Final presentation b10_shops
Final presentation b10_shopsFinal presentation b10_shops
Final presentation b10_shops
 
PreserVenice: Preserving Venetian Material Culture
PreserVenice: Preserving Venetian Material CulturePreserVenice: Preserving Venetian Material Culture
PreserVenice: Preserving Venetian Material Culture
 
Return to the City of Water: Quantifying Change in the Venetian Canals
Return to the City of Water: Quantifying Change in the Venetian CanalsReturn to the City of Water: Quantifying Change in the Venetian Canals
Return to the City of Water: Quantifying Change in the Venetian Canals
 
Mobility B09 (Italian)
Mobility B09 (Italian)Mobility B09 (Italian)
Mobility B09 (Italian)
 
B09 Origins Archaeological Process
B09 Origins Archaeological ProcessB09 Origins Archaeological Process
B09 Origins Archaeological Process
 
PublicEarthPresentationB09
PublicEarthPresentationB09PublicEarthPresentationB09
PublicEarthPresentationB09
 
Final Presentation English B09 Veninomics
Final Presentation English B09 VeninomicsFinal Presentation English B09 Veninomics
Final Presentation English B09 Veninomics
 
Final Presentation English B09 Ships
Final Presentation English B09 ShipsFinal Presentation English B09 Ships
Final Presentation English B09 Ships
 
Mobility B09 (English)
Mobility B09 (English)Mobility B09 (English)
Mobility B09 (English)
 

Último

fourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingfourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingTeacherCyreneCayanan
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingTechSoup
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdfQucHHunhnh
 
Measures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SDMeasures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SDThiyagu K
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...christianmathematics
 
Class 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdfClass 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdfAyushMahapatra5
 
Sanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdfSanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdfsanyamsingh5019
 
BASLIQ CURRENT LOOKBOOK LOOKBOOK(1) (1).pdf
BASLIQ CURRENT LOOKBOOK  LOOKBOOK(1) (1).pdfBASLIQ CURRENT LOOKBOOK  LOOKBOOK(1) (1).pdf
BASLIQ CURRENT LOOKBOOK LOOKBOOK(1) (1).pdfSoniaTolstoy
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...EduSkills OECD
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfagholdier
 
Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111Sapana Sha
 
9548086042 for call girls in Indira Nagar with room service
9548086042  for call girls in Indira Nagar  with room service9548086042  for call girls in Indira Nagar  with room service
9548086042 for call girls in Indira Nagar with room servicediscovermytutordmt
 
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...PsychoTech Services
 
Arihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdfArihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdfchloefrazer622
 
Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)eniolaolutunde
 
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...fonyou31
 

Último (20)

fourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writingfourth grading exam for kindergarten in writing
fourth grading exam for kindergarten in writing
 
Grant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy ConsultingGrant Readiness 101 TechSoup and Remy Consulting
Grant Readiness 101 TechSoup and Remy Consulting
 
Código Creativo y Arte de Software | Unidad 1
Código Creativo y Arte de Software | Unidad 1Código Creativo y Arte de Software | Unidad 1
Código Creativo y Arte de Software | Unidad 1
 
Advance Mobile Application Development class 07
Advance Mobile Application Development class 07Advance Mobile Application Development class 07
Advance Mobile Application Development class 07
 
1029-Danh muc Sach Giao Khoa khoi 6.pdf
1029-Danh muc Sach Giao Khoa khoi  6.pdf1029-Danh muc Sach Giao Khoa khoi  6.pdf
1029-Danh muc Sach Giao Khoa khoi 6.pdf
 
Measures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SDMeasures of Dispersion and Variability: Range, QD, AD and SD
Measures of Dispersion and Variability: Range, QD, AD and SD
 
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
Explore beautiful and ugly buildings. Mathematics helps us create beautiful d...
 
Class 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdfClass 11th Physics NEET formula sheet pdf
Class 11th Physics NEET formula sheet pdf
 
Sanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdfSanyam Choudhary Chemistry practical.pdf
Sanyam Choudhary Chemistry practical.pdf
 
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
Mattingly "AI & Prompt Design: Structured Data, Assistants, & RAG"
 
BASLIQ CURRENT LOOKBOOK LOOKBOOK(1) (1).pdf
BASLIQ CURRENT LOOKBOOK  LOOKBOOK(1) (1).pdfBASLIQ CURRENT LOOKBOOK  LOOKBOOK(1) (1).pdf
BASLIQ CURRENT LOOKBOOK LOOKBOOK(1) (1).pdf
 
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
Presentation by Andreas Schleicher Tackling the School Absenteeism Crisis 30 ...
 
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptxINDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
INDIA QUIZ 2024 RLAC DELHI UNIVERSITY.pptx
 
Holdier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdfHoldier Curriculum Vitae (April 2024).pdf
Holdier Curriculum Vitae (April 2024).pdf
 
Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111Call Girls in Dwarka Mor Delhi Contact Us 9654467111
Call Girls in Dwarka Mor Delhi Contact Us 9654467111
 
9548086042 for call girls in Indira Nagar with room service
9548086042  for call girls in Indira Nagar  with room service9548086042  for call girls in Indira Nagar  with room service
9548086042 for call girls in Indira Nagar with room service
 
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
IGNOU MSCCFT and PGDCFT Exam Question Pattern: MCFT003 Counselling and Family...
 
Arihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdfArihant handbook biology for class 11 .pdf
Arihant handbook biology for class 11 .pdf
 
Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)Software Engineering Methodologies (overview)
Software Engineering Methodologies (overview)
 
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
Ecosystem Interactions Class Discussion Presentation in Blue Green Lined Styl...
 

Origins Final Presentation Italian

  • 1. Unearthing the Roots of Venice:From Relics to DNA(allascopertadelleoriginidiVenezia) Debora Afezolli Benjamin M. Allen Jaclyn Hepworth Andrew J. Kazanovicz
  • 2. Ancient Documents Archaeology Genetic Genealogy
  • 3.
  • 4.   Archaeologist 2 To be filled for every object/layer ~100 per intervento  Archaeological potential map  Cross-reference   Searchable Scheda statua  Scheda sito  Scheda tomba Scheda inorganico   Index forms Scheda organico  Scheda unita stratigrafica (US)  Create manualmente Schede  Soprintendenza Archeologica Foto  Consegna a mano Archaeologist 1 Disegni 
  • 5. ArchEasy: UnaSoluzione Sistemadigestione geo-spaziale per l’archiviazionedigitale e la correlazioneautomaticadeidatiarcheologicidiVenezia Form management Database search Automatic indexing Interpretative maps Initial prototype system design
  • 6. Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica  Archaeological potential map  Correlazioni Electronically submitted  Searchable Interpretazionedati  Index forms ArchEasy database Schede  Caricate digitalmente Foto  Disegni 
  • 7. Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica  Archaeological potential map  Cross-reference Electronically submitted  Searchable Data Interpretation  Index forms ArchEasy database Schede   Electronically uploaded Foto  Disegni 
  • 8. Modulistica Paper US form ArchEasy electronic US form
  • 9. Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica  Archaeological potential map  Cross-reference Electronically submitted  Searchable Data Interpretation   Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
  • 10. Old paper index US form ArchEasy electronic index US form Indexing
  • 11. Archaeologist 2 Automatic Automatic Archaeologist 1 Soprintendenza Archeologica  Archaeological potential map  Cross-reference Electronically submitted   Searchable Data Interpretation  Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
  • 12.
  • 14.
  • 16. Archaeologist 2 Automatic Automatic Archaeologist 1  Soprintendenza Archeologica  Archaeological potential map  Cross-reference Electronically submitted  Searchable Data Interpretation  Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
  • 17. Potenzialearcheologico Basso potenziale Maggiorpotenziale Broad representation of archaeological potential
  • 18. Public works official PotenzialeArcheologico View all objects on map Consults map Relics near Via Barovier are found every 15m High likelihood of more of these objects, so budget accordingly Application to public works
  • 19. Archaeologist 2 Automatic Automatic Archaeologist 1  Soprintendenza Archeologica  Archaeological potential map  Cross-reference Electronically submitted  Searchable Data Interpretation  Index forms ArchEasy database Schede  Electronically uploaded Foto  Disegni 
  • 20. Correlazionetrareperti ArchEasy Correlates data Similar elevation, also 13th Century Brick floor Found: 1.5m beneath Origins: 13th Century Brick floor Found: 1.5m beneath Origins: ?? Correlational ability of ArchEasy
  • 21. In Futuro: Approccio ad AgentiAutonomi I have a similar floor pattern, therefore I could also be a 15th century church My brick size is 14x12x7 cm I’m a 15th century church with herringbone floors My brick size is 22x15x9 cm, and I am 100 years old I could also be 100 years old I have the same type of floor, oriented in the same direction My brick size is 22x15x9 cm Self-correlating autonomous agent approach
  • 22.
  • 23. Easy completion of administrative form requirements
  • 25. Complete customization and control of workspace
  • 26.
  • 27. ArchiviodiStato Unbroken documentary history 90km of shelves Painstaking to access and utilize the documents
  • 28. L’attualesistemadiconsultazionedell’ArchiviodiStato Publications Archive Scholar 1 Pages Transcriptions Santa Maria della Salute Manuscripts Retrieves Searches Deliver to 90km of Shelves Request Information Choose
  • 29. Publications Archive Scholar 2 Duplicate Transcriptions Pages L’attualesistemadiconsultazionedell’ArchiviodiStato SAME Manuscripts Santa Maria della Salute Retrieves Searches Deliver to 90km of Shelves Request SAME Information Choose
  • 30. Publications Archive Scholar 3 TriplicateTranscriptions Pages L’attualesistemadiconsultazionedell’ArchiviodiStato SAME Manuscripts Santa Maria della Salute Retrieves Searches Deliver to 90km of Shelves Request SAME Information Choose
  • 31. Le trascrizioni non sonocondivise! Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Transcriptions     SHARING
  • 32. uScript: UnaSoluzione Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Transcriptions SHARING
  • 33. Contribution Accountant ComponentidiuScript 3 Components Archive Assistant Transcription Assistant Archive Assistant Transcription Assistant
  • 34. uScript Scholar 1 Scholar 3 Scholar 2 uScript: concettigenerali Archive Assistant Santa Maria della Salute Search
  • 35. uScript Scholar 1 Scholar 3 Scholar 2 Manuscripts Archive Assistant
  • 36. I In In n no nom nomi nomin nomine nomine d do dom domi domin domini domini Marie Transcription Assistant
  • 37. uScript Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Manuscripts Manuscripts Archive Assistant Contribution Accountant Search d do dom domi domin domini
  • 38. I In In n no nom nomi nomin nomine nomine d do dom domi domin domini domini n no nos nost nostr nostri nostri Marie Transcription Assistant
  • 39. M Ma Mar Mary Mary Transcription Assistant
  • 40. uScript Scholar 1 Scholar 3 Scholar 2 Transcriptions Transcriptions Manuscripts Manuscripts Archive Assistant Contribution Accountant Search d do dom domi domin domini
  • 42. uScript Scholar 1 Scholar 3 Scholar 2 Transcriptions Manuscripts Archive Assistant Contribution Accountant
  • 43. I Componenti Contribution Accountant Archive Assistant Transcription Assistant Archive Assistant Contribution Accountant Search Manuscripts and Transcriptions  Rate Contributors and Transcriptions Transcription Database Promotes Accuracy  Learn Handwriting  Automatic Transcriptions Automatic Boxing
  • 44. Transcriptions Transcriptions Transcriptions Transcriptions Nientevienescartato! uScript
  • 45. Risultati ad oggi Promotional Website: show and explain everything that is uScript
  • 46.
  • 47. Contribution to Origins Theory OriginideiVeneti Scavialimentanoteorie DNAConfermateorie Documentirafforzanoteorie
  • 48. TeoriesulleOriginideiVeneti Lusatia ? Brittany ? Paphlagonia ?
  • 51. Paphlagonian Theory Livy – Aburbe condita 1st Century B.C.E. “Antenor sailed into the furthest part of the Adriatic, accompanied by a number of Enetians…and the name was extended to the surrounding district; the whole nation were called Veneti”
  • 52. Paphlagonian Theory Homer – The Illiad 8th Century B.C.E. “The Paphlagonianswere commanded by a stout-hearted Pylaemenes from Enetae…”
  • 55. Brittany Theory Strabo – Ancient Greek Historian 1st Century A.C.E. Claim that ancestors of Veneto are not the Enetae of Paphlagoniabut the Veneti of Gaul
  • 58. Lusatia Theory Salvi – Veneti: First Builders of European Community 1984 A.C.E. Developed VeneticTheory claiming most current day European populations are descendants of the Veneti of Lusatia
  • 59. ? ? ?
  • 60. ? ? ?
  • 66. Requisiti del progetto Maschi Soprai18 anni DalTriveneto
  • 68. 163
  • 71. Y-Chromosomal DNA Coding DNA (genes) Y-chromosome
  • 72. Y-Chromosomal DNA Coding DNA (genes) Non-coding DNA Y-chromosome
  • 73. Y-Chromosomal DNA Coding DNA (genes) Non-coding DNA Loci - 12 locations of interest Y-chromosome
  • 75. Y-Chromosomal DNA 4 complementary nucleotides A,T,C, and G ATCTCATACATACATACATAGCTA Y-chromosome
  • 76. Y-Chromosomal DNA Scientists examine short tandem repeats (STRs) ATCTCATACATACATACATAGCTA Y-chromosome
  • 77. Y-Chromosomal DNA Scientists examine short tandem repeats (STRs) ATCTCATACATACATACATAGCTA Y-chromosome
  • 78. Y-Chromosomal DNA Scientists examine short tandem repeats (STRs) ATCTCATACATACATACATAGCTA Y-chromosome
  • 79. Y-Chromosomal DNA Scientists examine short tandem repeats (STRs) ATCTCATACATACATACATAGCTA 4 CATA repetitions = 4 STRs Y-chromosome
  • 80. Esempio del metododiconfrontogenetico Venice ATCTCATACATACATACATAGCTA
  • 81. Hypothetical DNA Comparison Venice ATCTCATACATACATACATAGCTA PaphlagoniaATCACATACATACATACATAGCA Lusatia GCTGACCATACTGAACGATATC Brittany GCTAACGAATGTCAAGCTAATA
  • 82. Hypothetical DNA Comparison Venice ATCTCATACATACATACATAGCTA Paphlagonia ATCACATACATACATACATAGCA Lusatia GCTGACCATACTGAACGATATC Brittany GCTAACGAATGTCAAGCTAATA
  • 83. Hypothetical DNA Comparison Venice ATCTCATACATACATACATAGCTA Paphlagonia ATCACATACATACATACATAGCA Lusatia GCTGACCATACTGAACGATATC Brittany GCTAACGAATGTCAAGCTAATA
  • 84. Hypothetical DNA Comparison Venice ATCTCATACATACATACATAGCTA (4 STRs) Paphlagonia ATCACATACATACATACATAGCA Lusatia GCTGACCATACTGAACGATATC Brittany GCTAACGAATGTCAAGCTAATA
  • 85. Hypothetical DNA Comparison Venice ATCTCATACATACATACATAGCTA (4 STRs) PaphlagoniaATCACATACATACATACATAGCA Lusatia GCTGACCATACTGAACGATATC Brittany GCTAACGAATGTCAAGCTAATA
  • 86. Hypothetical DNA Comparison Venice ATCTCATACATACATACATAGCTA (4 STRs) PaphlagoniaATCACATACATACATACATAGCA (4 STRs) Lusatia GCTGACCATACTGAACGATATC (1 STRs) Brittany GCTAACGAATGTCAAGCTAATA (0 STRs)
  • 87. Hypothetical DNA Comparison Venice ATCTCATACATACATACATAGCTA (4 STRs) PaphlagoniaATCACATACATACATACATAGCA (4 STRs) Lusatia GCTGACCATACTGAACGATATC (1 STRs) Brittany GCTAACGAATGTCAAGCTAATA (0 STRs)   
  • 89. Ancient Documents Archaeology Genetic Genealogy
  • 90. Ringraziamenti Professor Fabio Carrera Professor Daniel Gibson Dr. Marco Bortoletto and Dr. Alberto Zandinella, Dr. Giovanni Caniato Dr. David Comas Alberto Gallo MatteoSecchi, PierluigiTamburrini, and Venessia.com The Settimari Caffé Brasilia John Brunelli And a special thanks to all of the Genographic participants!

Notas del editor

  1. Venice State Archive houses one of the largest collections of unbroken documentary historyDating back to the beginning of the Venetian Republic90km of shelves
  2. Show the first three words, one at a timeLink this with the three people thing, with more edits
  3. Show the first three words, one at a timeLink this with the three people thing, with more edits
  4. Show the first three words, one at a timeLink this with the three people thing, with more edits
  5. Dna extraction is generic example, random str, explain significanceFor example, go back to map and show comparison from everythingOne sample tracking throughLab gets bottle, extract Y chromosomeFrom Y chromosome, DNA helixFrom DNA Helix, zoom in on a non-coding DNAFrom ncDNA, zoom to nucleotides(explain STR’s, and all the stuff I read)Bunch of other samples come in, randomly? (fabio just said it)Show comparison from samples from the test regions and the control regions, make up how some are similar but some are different