Se ha denunciado esta presentación.
Utilizamos tu perfil de LinkedIn y tus datos de actividad para personalizar los anuncios y mostrarte publicidad más relevante. Puedes cambiar tus preferencias de publicidad en cualquier momento.
Ciencias Del Mundo Contemporáneo
El cortejo en
las palomas

en el ciervo
Desde muy antiguo se sabe que también pueden reproducirse dos
especies diferentes: caballo y asno.
La mula es un híbrido q...
Teorías creacionistas
El origen de cada una de las especies se debía a un acto CREADOR específico. Surge
así la teoría FIJ...
Teorías evolutivas
1.- Lamarckismo
La premisa central de su
hipótesis giraba en torno a
dos ideas fundamentales:

Lamar ck...
1.- Lamarckismo
Según Lamarck, las modificaciones en el entorno de una especie
genera nuevas necesidades, en respuesta a l...
1.- Lamarckismo
Según Lamarck, las modificaciones en el entorno de una especie
genera nuevas necesidades, en respuesta a l...
1.- Lamarckismo
Según Lamarck, las modificaciones en el entorno de una especie
genera nuevas necesidades, en respuesta a l...
Teorías evolutivas
2.- Darwinismo
Las ideas de Darwin se
resumen en 3 conceptos:

1.- La lucha por la existencia
2.- La va...
2.- Darwinismo

¿Cómo van evolucionando los ser es vivos?

Son muchos los que nacen…
Nacen más individuos de los que son c...
2.- Darwinismo

Son muchos los que nacen…

Algunos no
encuentran suficiente
alimento o sufren
enfermedades y
2.- Darwinismo

Son muchos los que nacen…


Hay una lucha por la
existencia y por la

Algunos no encuen...
2.- Darwinismo

Son muchos los que nacen…


Sólo sobr eviven unos pocos:
los que han nacido
con características
que ...
2.- Darwinismo
La Selección Natural ha
eliminado a los que nacieron
con características menos
apropiadas para la
2.- Darwinismo

A diferencia de Lamarck, Darwin pensaba
que nacían jirafas con cuellos más largos o
más cortos. Sobrevivir...
2.- Darwinismo

Compara las dos teorías y reflexiona
2.- Darwinismo

Darwin estaba muy interesado en saber cómo los
agricultores, ganaderos y criadores de animales
conseguían ...
2.- Darwinismo

Darwin estaba muy interesado en saber cómo los
agricultores, ganaderos y criadores de animales
conseguían ...
2.- Darwinismo

El viaje del Beagle.
Tras graduarse en Cambridge en 1831, el joven
Darwin se enroló a los 22 años en el ba...
2.- Darwinismo

La expedición duró cinco años y recogió datos
hidrográficos, geológicos y meteorológicos en Sudamérica
y o...
2.- Darwinismo

Del “mono” no. Su teoría sobre la evolución del hombre fue
groseramente malinterpretada y encontró mucha o...
2.- Darwinismo




Ser humano

Darwin pensaba que
el ser humano no
procede de ningún
primate ...
2.- Darwinismo




Ser humano

Darwin fue atacado
porque en su época no se
conocían los “esla...
Teorías evolutivas
2.- Críticas al darwinismo
1. Las nuevas características ventajosas
propuestas por Darwin se diluirían ...
3.- Neodarwinismo o Teoría Sintética de la Evolución
niega hoy día
el hecho

La Biología moder...
3.- Neodarwinismo o Teoría Sintética de la Evolución
Principales afirmaciones:
a) Rechazo total a la herencia de los carac...
3.- Neodarwinismo o Teoría Sintética de la Evolución

La recombinación genética que
ocurre en la meiosis y la
3.- Neodarwinismo o Teoría Sintética de la Evolución
Como ya sabes, a veces se producen errores en la duplicación del ADN,...
3.- Neodarwinismo o Teoría Sintética de la Evolución

Las mutaciones, la recombinación
genética en la meiosis, y la combin...
3.- Neodarwinismo o Teoría Sintética de la Evolución
En este medio, los ratones
de fenotipo oscuro
sobreviven con más
3. 1. Teoría del Equilibrio Puntuado (Eldredge y Gould)
El Neodarwinismo afirma que la transformación evolutiva es un proc...
Pruebas de la evolución
Pruebas morfológicas
Pruebas biogeográficas
Pruebas paleontológicas
Pruebas embriológicas
Pruebas ...
Pruebas de la evolución
Pruebas morfológicas
Se basan en el estudio comparado de la morfología de los
órganos de seres viv...
Pruebas morfológicas
Observa detenidamente estos dibujos de extremidades anteriores de vertebrados:

Todas son diferentes ...
Pruebas morfológicas
Observa detenidamente estos dibujos de extremidades anteriores de vertebrados:

Estos dibujos muestra...
Pruebas morfológicas
Los órganos HOMÓLOGOS son aquellos que tienen un mismo origen evolutivo
y embrionario, con una estruc...
Pruebas morfológicas
Los órganos HOMÓLOGOS son aquellos que tienen un mismo origen evolutivo
y embrionario, con una estruc...
Pruebas morfológicas
¿Te parecería apropiado pensar en un parentesco próximo entre un murciélago y
un insecto sólo porque ...
Pruebas morfológicas
Los órganos
aquellos que tienen
distinto origen
evolutivo y
embrionario, pero
presentan ...
Pruebas morfológicas
Los órganos ANÁLOGOS representan un fenómeno llamado
CONVERGENCIA ADAPTATIVA, por el cual los seres v...
Pruebas morfológicas
Los órganos HOMÓLOGOS representan la DIVERGENCIA
ADAPTATIVA, por la cual los seres vivos modelan sus ...
Pruebas morfológicas
Los ÓRGANOS VESTIGIALES son también pruebas anatómicas de la
Evolución. Son órganos rudimentarios, at...
Pruebas morfológicas
Los ÓRGANOS VESTIGIALES son también pruebas anatómicas de la
Evolución. Son órganos rudimentarios, at...
Pruebas de la evolución
Pruebas biogeográficas
Las encontramos repartidas por todo el
planeta, y consisten en la existenci...
Pruebas biogeográficas
Camello bactriano

de Asia África


Camélidos de S...
Pruebas biogeográficas

Diablo de


Lobo marsupial (extinguido)

La extraña fauna de Austral...
Pruebas de la evolución
Pruebas paleontológicas
El nacimiento de la Paleontología
vino a apoyar las ideas
evolucionistas d...
Pruebas paleontológicas

Se han logrado
completas como la
que condujo hasta
el caballo. L...
Pruebas paleontológicas

Ancestro de los équidos
Équido actual

Se han logrado reconstruir historias
evolutivas completas ...
Pruebas paleontológicas

vestigiales y
sin garras

Garras en los dedos
Pico con dientes

Cola larga

Cola cor...
Pruebas paleontológicas

Fósil de Archaeopteryx
Reconstrucciones del Archaeopteryx
Pruebas paleontológicas
Vivió hace 150
millones de años

Se considera un animal
emblemático en el
estudio de...
Pruebas paleontológicas

El libro de la historia de la
Tierra está escrita en las
rocas. Los fósiles son las
palabras de e...
Pruebas paleontológicas

“Fósiles vivientes”

Concha de

Nautilus actual

Nautilus fosilizados

Pruebas de la evolución
Pruebas embriológicas
Observa detenidamente el desarrollo embrionario de estas especies:
Pruebas embriológicas
Al principio todos estos embriones
son muy parecidos entre sí
Pruebas embriológicas
Estas semejanzas son una
prueba de que existe un
parentesco entre las
especies. Cuanto más alto
sea ...
Pruebas de la evolución
Pruebas bioquímicas
Por último, las pruebas más
recientes y las que mayores
posibilidades presenta...
Teoria de la evolucion
Próxima SlideShare
Cargando en…5

Teoria de la evolucion

8.597 visualizaciones

Publicado el

Publicado en: Salud y medicina

Teoria de la evolucion

  1. 1. TEORÍA DE LA EVOLUCIÓN Ciencias Del Mundo Contemporáneo 1º BACHILLERATO
  2. 2. El cortejo en las palomas Apareamiento en el ciervo volante
  3. 3. Desde muy antiguo se sabe que también pueden reproducirse dos especies diferentes: caballo y asno. La mula es un híbrido que resulta del cruce entre burro y yegua o entre caballo y burra. Las mulas no se pueden reproducir porque son ESTÉRILES Équidos Animales del género Equus Mula (es un híbrido burra-caballo) Cuando se originan las especies dejan de reproducirse unas con otras. Adoptan colores, formas y comportamientos que les impiden cruzarse con especies diferentes
  4. 4. Teorías creacionistas El origen de cada una de las especies se debía a un acto CREADOR específico. Surge así la teoría FIJISTA que sostiene que las especies se mantienen invariables a lo largo del tiempo. Linneo (1707-1778) Naturalista sueco a quien se debe la nomenclatura binomial para designar las especies. Afirmó que “hay tantas especies diferentes como formas diversas fueron creadas en un principio por el ser infinito” Cuvier (1769-1832) Zoólogo francés iniciador de la anatomía comparada y de la paleontología. Para explicar la desaparición de las especies afirmó que durante el transcurso de la historia de la tierra, habían sucedido varias catástrofes o cataclismos que provocaron la extinción total de ciertas especies. Es la llamada teoría del CATASTROFISMO
  5. 5. Teorías evolutivas 1.- Lamarckismo La premisa central de su hipótesis giraba en torno a dos ideas fundamentales: Lamar ck (1744 – 1829) Jean Baptiste de Monet, caballero de Lamarck, naturalista francés. En 1809 publicó Philosophie zoologique, donde expuso las primeras ideas razonadas sobre la evolución. Sus ideas no fueron aceptadas. 1. La influencia del medio en el que se desarrollan las especies determinan los cambios de estas. 2. Dichos cambios son hereditarios, es decir, serán transmitidos a la descendencia. Cráneo y vértebras cervicales de jirafa
  6. 6. 1.- Lamarckismo Según Lamarck, las modificaciones en el entorno de una especie genera nuevas necesidades, en respuesta a las cuales los seres vivos se ven obligados a utilizar un determinado órgano determinado: “La función hace el órgano”, en palabras del propio Lamarck. El uso continuado del mismo lo fortalece y desarrolla, mientras que el no usarlo determina su atrofia y desaparición (“ley del uso y desuso”). Esforzándose y usándolo, este animal lograría desarrollar su cuello. Y después lograría transmitir eso a sus hijos.
  7. 7. 1.- Lamarckismo Según Lamarck, las modificaciones en el entorno de una especie genera nuevas necesidades, en respuesta a las cuales los seres vivos se ven obligados a utilizar un determinado órgano determinado: “La función hace el órgano”, en palabras del propio Lamarck. El uso continuado del mismo lo fortalece y desarrolla, mientras que el no usarlo determina su atrofia y desaparición (“ley del uso y desuso”). El uso de los cuernos provocaría su desarrollo. El gran desarrollo de las patas posteriores de algunos animales se debería a su gran uso. El kiwi habría atrofiado sus alas por no usarlas.
  8. 8. 1.- Lamarckismo Según Lamarck, las modificaciones en el entorno de una especie genera nuevas necesidades, en respuesta a las cuales los seres vivos se ven obligados a utilizar un determinado órgano determinado: “La función hace el órgano”, en palabras del propio Lamarck. El uso continuado del mismo lo fortalece y desarrolla, mientras que el no usarlo determina su atrofia y desaparición (“ley del uso y desuso”). Esta hipótesis es totalmente inadmisible hoy día por la Genética, pues se sabe que los caracteres adquiridos (como, por ejemplo, el aumento de la masa muscular por el ejercicio o ponerse moreno cuando se toma el sol) no se transmiten a la descendencia, pues no afectan al material genético.
  9. 9. Teorías evolutivas 2.- Darwinismo Las ideas de Darwin se resumen en 3 conceptos: 1.- La lucha por la existencia 2.- La variabilidad intraespecífica 3.- La selección natural La selección natural tiende a promover la supervivencia de los más aptos. Esta teoría revolucionaria se publicó en 1859 en el famoso tratado El origen de las especies por medio de la selección natural. Veamos estos conceptos… Charles Darwin (1809 – 1882)
  10. 10. 2.- Darwinismo ¿Cómo van evolucionando los ser es vivos? Son muchos los que nacen… Nacen más individuos de los que son capaces de sobrevivir en un medio con recursos limitados. Dentro de cada especie hay variedad en las características. Los individuos no son idénticos entre sí. Nacen con diferencias entre ellos, es decir, hay una variabilidad intraespecífica (dentro de la especie)
  11. 11. 2.- Darwinismo Son muchos los que nacen… Pero… Algunos no encuentran suficiente alimento o sufren enfermedades y mueren Otros son la presa de algún depredador Hay una lucha por la existencia
  12. 12. 2.- Darwinismo Son muchos los que nacen… Pero… Hay una lucha por la existencia y por la reproducción Algunos no encuentran pareja o no consiguen reproducirse por algún motivo
  13. 13. 2.- Darwinismo Son muchos los que nacen… Pero… Sólo sobr eviven unos pocos: los que han nacido con características que les permiten adaptarse mejor a su medio.
  14. 14. 2.- Darwinismo La Selección Natural ha eliminado a los que nacieron con características menos apropiadas para la supervivencia. Sólo sobreviven unos pocos Los que sobreviven transmiten a sus hijos esas características que precisamente les ayudaron a sobrevivir mejor en su medio.
  15. 15. 2.- Darwinismo A diferencia de Lamarck, Darwin pensaba que nacían jirafas con cuellos más largos o más cortos. Sobrevivirían sólo aquellas que habían heredado un cuello suficientemente largo.
  16. 16. 2.- Darwinismo Compara las dos teorías y reflexiona
  17. 17. 2.- Darwinismo Darwin estaba muy interesado en saber cómo los agricultores, ganaderos y criadores de animales conseguían obtener y mejorar diferentes razas
  18. 18. 2.- Darwinismo Darwin estaba muy interesado en saber cómo los agricultores, ganaderos y criadores de animales conseguían obtener y mejorar diferentes razas Si se quiere una buena raza de vaca lechera no se cruzan animales que produzcan poca leche. Se seleccionan aquellas hembras que produzcan más leche. Se hace una Cría Selectiva o Selección Artificial
  19. 19. 2.- Darwinismo El viaje del Beagle. Tras graduarse en Cambridge en 1831, el joven Darwin se enroló a los 22 años en el barco de reconocimiento HMS Beagle como naturalista sin paga, para emprender una expedición científica alrededor del mundo.
  20. 20. 2.- Darwinismo La expedición duró cinco años y recogió datos hidrográficos, geológicos y meteorológicos en Sudamérica y otros muchos lugares. Las observaciones de zoología y botánica de Darwin le llevaron a desarrollar la teoría de la selección natural. La asombrosa fauna de las Islas Galápagos dio mucho que pensar a Darwin Iguana Varias especies de pinzones Cormorán con alas atrofiadas Tortugas gigantes
  21. 21. 2.- Darwinismo Del “mono” no. Su teoría sobre la evolución del hombre fue groseramente malinterpretada y encontró mucha oposición. Los ataques a las ideas de Darwin que encontraron mayor eco no provenían de sus contrincantes científicos, sino de sus oponentes religiosos. La idea de que los seres vivos habían evolucionado por procesos naturales negaba la creación divina del hombre y parecía colocarlo al mismo nivel que los animales. Ambas ideas representaban una grave amenaza para la teología ortodoxa. Muchos atacaron a Darwin sin haber leído su libro ni conocer a fondo sus argumentos e ideas. Darwin no pensaba que el hombre descendiese de ningún “mono” actual, sino que el hombre y otros primates descendían todos de antepasados comunes.
  22. 22. 2.- Darwinismo Orangután Gorila Chimpancé Ser humano ? Darwin pensaba que el ser humano no procede de ningún primate actual. Pero sí creía que tenemos antepasados comunes con ellos. ? En tiempos de Darwin no se conocían fósiles de antepasados humanos Antepasado común
  23. 23. 2.- Darwinismo Orangután Gorila Chimpancé Ser humano ? Darwin fue atacado porque en su época no se conocían los “eslabones perdidos” de la cadena de la evolución humana Pero la ciencia moderna conoce muchos eslabones de esta cadena ? (hace 5 millones de años) Australopithecus Procónsul (hace 20 millones de años)
  24. 24. Teorías evolutivas 2.- Críticas al darwinismo 1. Las nuevas características ventajosas propuestas por Darwin se diluirían y desaparecerían en la descendencia. 2. La teoría de Darwin no explicaba cómo se originaba la variabilidad de la descendencia; tampoco explicaba que si las modificaciones eran pequeñas, la selección natural ni las favorecería ni las perjudicarías. 3. Una nueva especie no podía formarse en el mismo lugar en el que viven sus progenitores. 4. Si las nuevas características ventajosas eran pequeñas, no había existido suficiente tiempo para que surgieran tantas especies diferentes. Mendel (1822-1884) Monje agustino y naturalista de origen checo. Descubridor de las llamadas leyes de Mendel que rigen la herencia genética.
  25. 25. 3.- Neodarwinismo o Teoría Sintética de la Evolución Ningún científico niega hoy día el hecho evolutivo La Biología moderna explica el hecho evolutivo sumando a las ideas de Darwin las Leyes de Mendel y los conocimientos de la moderna Genética. + Darwin Mendel + = Neodarwinismo o Teoría Sintética de la Evolución Genética Moderna Por fin quedaba resuelto el misterio del modo de transmitirse los caracteres hereditarios. El descubrimiento de las leyes de la herencia y del material genético permitía explicar aquello que los científicos contrarios a Darwin más le criticaron. El origen de las especies de Darwin se publicó en 1859, antes de los trabajos de Mendel.
  26. 26. 3.- Neodarwinismo o Teoría Sintética de la Evolución Principales afirmaciones: a) Rechazo total a la herencia de los caracteres adquiridos b) La unidad sobre la que actúa la evolución no es el individuo sino la Población. c) La información genética se transmite con el mínimo cambio posible pero se pueden producir cambios por recombinación y por mutaciones espontáneas, que por producirse en el materia l genético son heredables. d) La Selección Natural sigue admitiéndose como el principal “motor” de la Evolución. La Selección Natural “escoge” dentro de la variabilidad. e) La evolución es gradual y lenta.
  27. 27. 3.- Neodarwinismo o Teoría Sintética de la Evolución La recombinación genética que ocurre en la meiosis y la reproducción sexual producen la variabilidad intraespecífica de la que hablaba Darwin … mamá pata puso huevos en el nido… Papá pato conoce a mamá pata… …y tuvieron hermosos patitos. Pero no habrá una oportunidad para “el patito feo”: la Selección Natural acabará con él. El pato malvasía bucea para obtener alimento del fondo de lagunas
  28. 28. 3.- Neodarwinismo o Teoría Sintética de la Evolución Como ya sabes, a veces se producen errores en la duplicación del ADN, dando lugar a genes alterados, distintos al original. Son las MUTACIONES. ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Doble cadena de ADN sin mutar ATTCGCGGCATTAATCCGATACCTAGGACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCCTGGCGCCTAAATTTGTACCTAG Doble cadena de ADN con mutación Mutación Las mutaciones son la fuente original de la variabilidad. La meiosis y la reproducción sexual son fuentes añadidas de variabilidad. Variabilidad dentro de la especie Eriopis eschscholtzi Algunas mutaciones provocan la muerte, pero otras, en sí, no son “buenas” ni “malas”: todo dependerá del medio donde vive la especie.
  29. 29. 3.- Neodarwinismo o Teoría Sintética de la Evolución Las mutaciones, la recombinación genética en la meiosis, y la combinación de gametos en la reproducción sexual ocurren aleatoriamente (al azar) El número de combinaciones posibles de alelos de genes en una especie es elevadísimo (“casi infinito”).
  30. 30. 3.- Neodarwinismo o Teoría Sintética de la Evolución En este medio, los ratones de fenotipo oscuro sobreviven con más probabilidad La naturaleza arroja sus dados y nacen animales más claros, más oscuros… Dependiendo del medio, un color u otro será “mejor” o “peor” Búho “normal” En este medio, los ratones de fenotipo claro sobreviven con más probabilidad Con el tiempo, en esta población de ratones, aumenta la frecuencia de genes que determinan el fenotipo claro Búho nival
  31. 31. 3. 1. Teoría del Equilibrio Puntuado (Eldredge y Gould) El Neodarwinismo afirma que la transformación evolutiva es un proceso lento, GRADUAL, en toda la población (gradualismo filético), y se apoya en la observación de las series filogenéticas Estos afirman que hay secuencias que no son graduales, hay saltos en la evolución sin formas intermedias. Habrá largos periodos de calma (de equilibrio) y cortos periodos, puntuales, de rápida evolución. Este modelo supone: • El proceso de formación de especies está entre 5.000 y 50.000 años. • Los fósiles muestran que una especie no cambia sustancialmente a lo largo de su existencia (estasis) • El mecanismo evolutivo es rápido y por ramificación (cladogénesis)
  32. 32. Pruebas de la evolución Pruebas morfológicas Pruebas biogeográficas Pruebas paleontológicas Pruebas embriológicas Pruebas bioquímicas
  33. 33. Pruebas de la evolución Pruebas morfológicas Se basan en el estudio comparado de la morfología de los órganos de seres vivos actuales o de fósiles. Mediante la ANATOMIA COMPARADA se estudian las semejanzas y diferencias entre órganos de diversas especies.
  34. 34. Pruebas morfológicas Observa detenidamente estos dibujos de extremidades anteriores de vertebrados: Todas son diferentes pero tienen “un esquema común” de organización Ese “esquema común” de organización se debe a un antepasado común que “inventó” un “esquema básico”. La evolución por selección natural llevó a distintas adaptaciones de esta extremidad para correr, nadar, volar… Pero el “esquema básico” se mantuvo en todas estas especies.
  35. 35. Pruebas morfológicas Observa detenidamente estos dibujos de extremidades anteriores de vertebrados: Estos dibujos muestran ejemplos de ÓRGANOS HOMÓLOGOS
  36. 36. Pruebas morfológicas Los órganos HOMÓLOGOS son aquellos que tienen un mismo origen evolutivo y embrionario, con una estructura interna semejante, fruto de diversas modificaciones adaptativas a distintos hábitats. Ejemplos: Humano Gato Ballena Murciélago
  37. 37. Pruebas morfológicas Los órganos HOMÓLOGOS son aquellos que tienen un mismo origen evolutivo y embrionario, con una estructura interna semejante, fruto de diversas modificaciones adaptativas a distintos hábitats. Humano Caballo Murciélago Ballena
  38. 38. Pruebas morfológicas ¿Te parecería apropiado pensar en un parentesco próximo entre un murciélago y un insecto sólo porque vuelan? Ala de murciélago Ala de insecto Hay una membrana entre los dedos que permite volar a los murciélagos. Son ejemplos de órganos HOMÓLOGOS Brazo humano Brazo de murciélago Son ejemplos de órganos ANÁLOGOS Cráneo de murciélago Cráneo de oso Aunque los osos y los humanos no volemos, estamos bastante más emparentados con un murciélago que con un insecto.
  39. 39. Pruebas morfológicas Los órganos ANÁLOGOS son aquellos que tienen distinto origen evolutivo y embrionario, pero presentan una forma aparentemente semejante y realizan la misma función. Ala de murciélago Ala de insecto Son ejemplos de órganos ANÁLOGOS Son ejemplos de órganos ANÁLOGOS Estos machos de Lucanus cervus (ciervo volante), usan sus “cuernos” (mandíbulas muy desarrolladas) para combatir entre ellos. Los ciervos macho también combaten con sus cuernos
  40. 40. Pruebas morfológicas Los órganos ANÁLOGOS representan un fenómeno llamado CONVERGENCIA ADAPTATIVA, por el cual los seres vivos repiten fórmulas y diseños que han tenido éxito.
  41. 41. Pruebas morfológicas Los órganos HOMÓLOGOS representan la DIVERGENCIA ADAPTATIVA, por la cual los seres vivos modelan sus órganos según su modo de vida, el ambiente en que están, etc.
  42. 42. Pruebas morfológicas Los ÓRGANOS VESTIGIALES son también pruebas anatómicas de la Evolución. Son órganos rudimentarios, atrofiados, que revelan un pasado evolutivo. Cintura pélvica Fémur Por ejemplo, los cetáceos (ballenas, delfines…) conservan vestigios (“restos”) del fémur y de la cintura pelviana. La explicación es que tuvieron un antepasado mamífero terrestre. Su adaptación al medio acuático les llevó a perder las extremidades posteriores, pero quedan “restos”.
  43. 43. Pruebas morfológicas Los ÓRGANOS VESTIGIALES son también pruebas anatómicas de la Evolución. Son órganos rudimentarios, atrofiados, que revelan un pasado evolutivo. El kiwi y el cormorán de las Islas Galápagos tienen alas vestigiales. Con ellas ya no pueden volar. El cóccix son pequeñas vértebras fusionadas. Es el vestigio de un pasado evolutivo con cola. Este insecto tiene alas vestigiales. Con ellas ya no puede volar.
  44. 44. Pruebas de la evolución Pruebas biogeográficas Las encontramos repartidas por todo el planeta, y consisten en la existencia de grupos de especies más o menos parecidas, emparentadas, que habitan lugares relacionados entre sí por su proximidad, situación o características, por ejemplo, un conjunto de islas, donde cada especie del grupo se ha adaptado a unas condiciones concretas. La prueba evolutiva aparece porque todas esas especies próximas provienen de una única especie antepasada que originó a todas las demás a medida que pequeños grupos de individuos se adaptaban a las condiciones de un lugar concreto, que eran diferentes a las de otros lugares. Son ejemplos característicos de esto los pinzones de las islas Galápagos que fueron estudiados por Darwin Darwin
  45. 45. Pruebas biogeográficas Camello bactriano Llama Camélidos de Asia África Alpaca Guanaco Dromedario Vicuña Camélidos de Sudamérica La familia de los camélidos se diversificó de acuerdo a su distinta adaptación en diferentes hábitats. Ello constituye una prueba biogeográfica más de la evolución.
  46. 46. Pruebas biogeográficas Diablo de Tasmania Equidna Ornitorrinco Lobo marsupial (extinguido) La extraña fauna de Australia refleja su aislamiento evolutivo del resto de continentes. Las especies de mamíferos evolucionaron independientemente de otras partes del mundo. Esto es una prueba biogeográfica más de la evolución. Koala Wallaby Canguro rojo
  47. 47. Pruebas de la evolución Pruebas paleontológicas El nacimiento de la Paleontología vino a apoyar las ideas evolucionistas del siglo XIX. Esqueleto fosilizado de Megaceros ¿Podría ser este el antepasado del ciervo actual? Se establecen similitudes con especies actuales y se intenta determinar una historia evolutiva apoyada en pruebas tan firmes como son los fósiles. Así, por ejemplo, se han logrado reconstruir historias evolutivas completas como la que condujo hasta el caballo
  48. 48. Pruebas paleontológicas Se han logrado reconstruir historias evolutivas completas como la que condujo hasta el caballo. Los antepasados del caballo fueron cambiando y gradualmente fueron perdiendo dedos como adaptación a la carrera veloz. En los fósiles está escrita la historia evolutiva de los équidos
  49. 49. Pruebas paleontológicas Ancestro de los équidos Équido actual Se han logrado reconstruir historias evolutivas completas como la que condujo hasta el caballo. Los antepasados del caballo fueron cambiando y gradualmente fueron perdiendo dedos como adaptación a la carrera veloz. En los fósiles está escrita la historia evolutiva
  50. 50. Pruebas paleontológicas Dedos vestigiales y sin garras Garras en los dedos Pico con dientes Plumas Cola larga Cola corta Ave actual Pico sin dientes El Arqueopterix pudo ser el antepasado extinguido de las aves. Era “mitad reptil – mitad ave”
  51. 51. Pruebas paleontológicas Fósil de Archaeopteryx Reconstrucciones del Archaeopteryx
  52. 52. Pruebas paleontológicas Archaeopteryx Vivió hace 150 millones de años Se considera un animal emblemático en el estudio de la evolución por su carácter transicional entre reptiles y aves
  53. 53. Pruebas paleontológicas El libro de la historia de la Tierra está escrita en las rocas. Los fósiles son las palabras de ese libro.
  54. 54. Pruebas paleontológicas “Fósiles vivientes” Hoja actual Concha de Nautilus actual Nautilus fosilizados seccionado Este molusco es un “fósil viviente” que lleva sin evolucionar 150 millones de años. Se considera próximo en la evolución a los extinguidos ammonites Hojas fosilizadas Darwin llamó al Ginkgo biloba "fósil viviente", por considerarlo la especie vegetal más antigua del planeta. Aparecieron hace 250 millones de años, en el período Pérmico, al final de la era primaria. Este pez, el celacanto es otros “fósil viviente”. Curiosamente, se conocía muy bien a los fósiles mucho antes de descubrirse el primer ejemplar vivo.
  55. 55. Pruebas de la evolución Pruebas embriológicas Observa detenidamente el desarrollo embrionario de estas especies:
  56. 56. Pruebas embriológicas Al principio todos estos embriones son muy parecidos entre sí
  57. 57. Pruebas embriológicas Estas semejanzas son una prueba de que existe un parentesco entre las especies. Cuanto más alto sea el parecido entre embriones, mayor será el grado de parentesco entre dos especies. Durante el desarrollo embrionario es como si se reprodujese la historia evolutiva de los antepasados. Nuestro embrión, al principio, es muy parecido al de un pez. Nuestros antepasados remotos fueron peces.
  58. 58. Pruebas de la evolución Pruebas bioquímicas Por último, las pruebas más recientes y las que mayores posibilidades presentan, consisten en comparar ciertas moléculas que aparecen en todos los seres vivos de tal manera que esas moléculas son tanto más parecidas cuanto menores diferencias evolutivas hay entre sus poseedores, y al revés; esto se ha hecho sobre todo con proteínas (por ejemplo proteínas de la sangre) y con ADN.
