Se ha denunciado esta presentación.
Utilizamos tu perfil de LinkedIn y tus datos de actividad para personalizar los anuncios y mostrarte publicidad más relevante. Puedes cambiar tus preferencias de publicidad en cualquier momento.

Ocorrência e análise molecular de vírus quarentenário em áreas de cultivo de lírios no brasil

109 visualizaciones

Publicado el

Seminário "Ciência e Tecnologia para a Defesa Agropecuária"

O evento aconteceu nos dias 7 e 8 de dezembro de 2016 e abordou a situação atual, desafios e avanços científicos relacionados às principais pragas e doenças que ameaçam a estabilidade da produção à luz dos novos rumos da defesa agropecuária brasileira.
O programa teve foco nas revisões e artigos científicos publicados no número temático “Pesquisa, Desenvolvimento e Inovações Frente a Ameaças Sanitárias para a Agropecuária” da revista Pesquisa Agropecuária Brasileira (PAB) de maio de 2016.

Publicado en: Ciencias
  • Sé el primero en comentar

  • Sé el primero en recomendar esto

Ocorrência e análise molecular de vírus quarentenário em áreas de cultivo de lírios no brasil

  1. 1. Ocorrência e análise molecular deOcorrência e análise molecular de vírus quarentenário em áreas devírus quarentenário em áreas de cultivo de lírios no Brasilcultivo de lírios no Brasil Eliana Borges Rivas, E. C. A. Bôdi, R. Harakava, F. Gregori, M. C. Gonçalves Laboratório de Diagnóstico Fitopatológico Instituto Biológico
  2. 2. QQualificação do problema fitossanitárioualificação do problema fitossanitário Importação de bulbos de lírios – cultivo como planta envasada e flor de corte: vírus presentes podem se estabelecer no país e induzir sintomas e/ou perdas, ainda não relatadas nos países exportadores devido às diferenças edafo- climáticas; Detecção de Lily symptomless virus (LSV), praga quarentenária até 2013 (IN 59 de 18/12/13), por sorologia, em amostras de lírios coletadas por Fiscais Agropecuários Federais, em cultivos comerciais dos Estados de São Paulo e Minas Gerais; Verificar a existência de outro vírus estabelecido na cultura de lírios, como por exemplo, Tulip breaking virus (A1).
  3. 3. OObjetivosbjetivos Descrever as ocorrências das pragas Tulip breaking virus (A1) e Lily symptomless virus; Detectar molecularmente TBV e LSV; Demonstrar que Tulip breaking virus, que consta da lista de pragas A1 (IN 41 de 01/07/2008), é sinonímia de Lily mottle virus – isolado lírio, e que por ocorrer em cultivos comerciais de lírios deve ser retirado da lista de pragas A1.
  4. 4. MMétodosétodos DAS-ELISA Inoculação mecânica Desenho de primers RT-PCR Análise filogenética e pairwise Análise de recombinação
  5. 5. Primers específicos para LSV e LMoV para RT-PCR multiplex RResultados e Discussãoesultados e Discussão LMoV-F: 5’ AATGAGACACTCAATACTGGAGCTT 3’ LMoV-R: 5’ TTTATTGACATCATCTGCTGTATGC 3’ LSV-F: 5’ GATGAGCCCACCAATTACAATAATA 3’ LSV-R: 5’ GTTAGTCACGTAGTCGAAGGTGTC 3’ - LMoV - LSV
  6. 6. Detecção dos vírus de lírios RResultados e Discussãoesultados e Discussão LMoV + CMV LMoV + LSV LMoV + LSV + CMV LMoV LSV LSV + CMV
  7. 7. Distribuição dos vírus em cultivos de lírios RResultados e Discussãoesultados e Discussão Estados Municípios LMoV LSV CMV Minas Gerais Andradas     Araxá     Formiga     Munhoz            São Paulo Cotia    Holambra     Santo Antonio de Posse   
  8. 8. LMoV LSV Filogenia e recombinação para LSV e LMoV RResultados e Discussãoesultados e Discussão
  9. 9. DDiscussãoiscussão Lily symptomless virus (LSV) saiu da lista de praga quarentenárias A1 (IN 59 de  18/12/13); Retirar da lista de pragas quarentenárias A1 Tulip breaking virus (LMoV); Atualização da lista de pragas quarentenárias A1.
  10. 10. CConclusõesonclusões Atualização da lista de pragas quarentenárias A1; Atuação integrada para medidas fitossanitárias: MAPA x produtores x área técnica
  11. 11. Obrigada!Obrigada! Instituto Biológico Laboratório de Diagnóstico Fitopatológico rivas@biologico.sp.gov.br (11) 5087-1715

×