SlideShare una empresa de Scribd logo
1 de 1
Descargar para leer sin conexión
BecA Hub/ILRI Bioinformatics Platform

        What is Bioinformatics?
        Bioinformatics is the application of statistics and computer science to molecular biology. It is a rapidly developing branch of
        Information Technology that seeks to exploit the wealth of DNA and other sequence data that has been generated in the last
        decade. In short, bioinformatics is the key to understanding the molecule of life, DNA.

        Bioinformatics offers tremendous opportunities and has great potential to underpin biotechnological solutions to agricultural
        development constraints.


       DNA - Information flow in the molecule of life
                                                          ATGATTATGGACACTTCTTTGAA
                                                          AAATAATGATGGAGCTTTAGAAG
                                                          CTGATAACAAAAATTATCAAGAT
                                                          TATAAAGCTGAGCCTGATAAAAC
                                                  Gene    AAGCGATGTATTAGATGTTACTA
                                                          AATATAATTCAGTGGTAGATTGT
                                                          TGCCATAAAAATTATTCAACATT
                                                          TACATCTGAATGGTATATTAATG
                                                          AAAGAAAATATAATGATGTTCCA
                                                          GAAGGACCAAAAAATGATTATGG
                                                          ACACTTCTTTGAAAAATAATGAT
                                                          GGAGCTTTAGAAGCTGATAACAA
                                                          AAATTATCAAGATT

       Cell          Chromosome           DNA             DNA sequence              RNA         Protein          Livestock, crops, micro-organisms


         Some of the many projects using the                                               BecA Hub/ILRI Bioinformatics Platform
        BecA Hub/ILRI Bioinformatics Platform
                                                                                     The bioinformatics platform provides advanced
                                                                                     computational capabilities i bi i f
                                                                                            t ti    l     biliti in bioinformatics t all
                                                                                                                              ti to ll
Crop improvement
                                                                                     scientists at the BecA Hub and provides training in all
 Biotechnology applications to combat Cassava Brown Streak
                                                                                     aspects of bioinformatics.
Disease (CBSD)
 Genetic fingerprints for groundnut and pigeon pea                                  The platform provides:
 Fine mapping of Striga resistance in sorghum                                        Access to major sequence databases (USA, EU, etc.)
 Marker-assisted breeding for drought resistance in sorghum                          Access to specialized hardware and sophisticated
                                                                                     commercial and academic software
                                                                                      Sophisticated data analysis capabilities
                                                                                      Access to high performance co put g se ces a d
                                                                                        ccess      g pe o a ce computing services and
                                                                                     grids (CGIAR, EU, USA, etc .)


Vaccines and diagnostics                                                                                              Research Institutes
                                                                                                                         Universities
 Integrated response system for emerging infectious diseases
in East Africa
 East Coast fever (ECF) recombinant vaccine development
 Contagious bovine pleuropneumonia (CBPP) diagnostic and                            European Molecular Biology Network                      Web interface
vaccine development                                                                  EMBRACE Network of Excellence                           Direct access
 Development of new diagnostic assays and epidemiological                           e-Infrastructure (EELA, GEANT, EGEE)
                                                                                     Advanced Research Institutes (EU, USA)                    Broadband
surveillance of viral pathogens of livestock in Africa
                                                                                                                                                 Internet
                                                                                                    Broadband
                                                                                                      Internet




Bioinformatics capacity building
 Training workshops                                                                                                   Direct access
 MSc and PhD student projects                                                                                         Web services
 Online training courses and training materials
                                                                                                                         Broadband
                                                                                                                           Internet
                                                                                     CGIAR – HPC Grid
                                                                                     BecA-ILRI – Kenya (64 CPUs)                           BecA Hub/ILRI
                                                                                     IRRI – Philippines (16 CPUs)                          Bioinformatics
                                                                                     ICRISAT – India (8 CPUs)                                 Platform
                                                                                     CIP – Peru (8 CPUs)

                                                                                    For further information contact:
                                                                                    Dr. Etienne de Villiers (Bioinformatics Group Leader) e.villiers@cgiar.org



                                                                                                                                       ILRI
                                                                                                                           INTERNATIONAL LIVESTOCK RESEARCH INSTITUTE

Más contenido relacionado

Destacado

Farmer-participatory research and development for improving feed supply and use
Farmer-participatory research and development for improving feed supply and useFarmer-participatory research and development for improving feed supply and use
Farmer-participatory research and development for improving feed supply and useILRI
 
Dairy Policy inventory – Ethiopia
Dairy Policy inventory – EthiopiaDairy Policy inventory – Ethiopia
Dairy Policy inventory – EthiopiaILRI
 
Resilience: concepts & implications for CG-wide research collaboration
Resilience: concepts & implications for CG-wide research collaborationResilience: concepts & implications for CG-wide research collaboration
Resilience: concepts & implications for CG-wide research collaborationILRI
 
Using stakeholder platforms to enhance local innovations in the livestock sec...
Using stakeholder platforms to enhance local innovations in the livestock sec...Using stakeholder platforms to enhance local innovations in the livestock sec...
Using stakeholder platforms to enhance local innovations in the livestock sec...ILRI
 
Some Reflections on Agricultural Innovation Systems Methodological Framework
Some Reflections on Agricultural Innovation Systems Methodological FrameworkSome Reflections on Agricultural Innovation Systems Methodological Framework
Some Reflections on Agricultural Innovation Systems Methodological FrameworkILRI
 
Shaping a new CGIAR Mega Program on Livestock and Fish
Shaping a new CGIAR Mega Program on Livestock and FishShaping a new CGIAR Mega Program on Livestock and Fish
Shaping a new CGIAR Mega Program on Livestock and FishILRI
 
Designing community based breeding strategies for indigenous sheep breeds of ...
Designing community based breeding strategies for indigenous sheep breeds of ...Designing community based breeding strategies for indigenous sheep breeds of ...
Designing community based breeding strategies for indigenous sheep breeds of ...ILRI
 
IPMS experiences on research for dairy development: Approaches and lessons
IPMS experiences on research for dairy development: Approaches and lessons  IPMS experiences on research for dairy development: Approaches and lessons
IPMS experiences on research for dairy development: Approaches and lessons ILRI
 

Destacado (8)

Farmer-participatory research and development for improving feed supply and use
Farmer-participatory research and development for improving feed supply and useFarmer-participatory research and development for improving feed supply and use
Farmer-participatory research and development for improving feed supply and use
 
Dairy Policy inventory – Ethiopia
Dairy Policy inventory – EthiopiaDairy Policy inventory – Ethiopia
Dairy Policy inventory – Ethiopia
 
Resilience: concepts & implications for CG-wide research collaboration
Resilience: concepts & implications for CG-wide research collaborationResilience: concepts & implications for CG-wide research collaboration
Resilience: concepts & implications for CG-wide research collaboration
 
Using stakeholder platforms to enhance local innovations in the livestock sec...
Using stakeholder platforms to enhance local innovations in the livestock sec...Using stakeholder platforms to enhance local innovations in the livestock sec...
Using stakeholder platforms to enhance local innovations in the livestock sec...
 
Some Reflections on Agricultural Innovation Systems Methodological Framework
Some Reflections on Agricultural Innovation Systems Methodological FrameworkSome Reflections on Agricultural Innovation Systems Methodological Framework
Some Reflections on Agricultural Innovation Systems Methodological Framework
 
Shaping a new CGIAR Mega Program on Livestock and Fish
Shaping a new CGIAR Mega Program on Livestock and FishShaping a new CGIAR Mega Program on Livestock and Fish
Shaping a new CGIAR Mega Program on Livestock and Fish
 
Designing community based breeding strategies for indigenous sheep breeds of ...
Designing community based breeding strategies for indigenous sheep breeds of ...Designing community based breeding strategies for indigenous sheep breeds of ...
Designing community based breeding strategies for indigenous sheep breeds of ...
 
IPMS experiences on research for dairy development: Approaches and lessons
IPMS experiences on research for dairy development: Approaches and lessons  IPMS experiences on research for dairy development: Approaches and lessons
IPMS experiences on research for dairy development: Approaches and lessons
 

Similar a BecA Hub/ILRI Bioinformatics Platform

Bioinformatics platform: Harnessing bioinformatics for food security and sust...
Bioinformatics platform: Harnessing bioinformatics for food security and sust...Bioinformatics platform: Harnessing bioinformatics for food security and sust...
Bioinformatics platform: Harnessing bioinformatics for food security and sust...ILRI
 
e-BioGrid_NBIC Conference 2011 april 20
e-BioGrid_NBIC Conference 2011 april 20e-BioGrid_NBIC Conference 2011 april 20
e-BioGrid_NBIC Conference 2011 april 20INooren
 
BecA-ILRI Hub genomics and bioinformatics platforms
BecA-ILRI Hub genomics and bioinformatics platformsBecA-ILRI Hub genomics and bioinformatics platforms
BecA-ILRI Hub genomics and bioinformatics platformsILRI
 
Software Pipelines: The Good, The Bad and The Ugly
Software Pipelines: The Good, The Bad and The UglySoftware Pipelines: The Good, The Bad and The Ugly
Software Pipelines: The Good, The Bad and The UglyJoão André Carriço
 
Bioinformatics Core at AGERI Present and Future
Bioinformatics Core at AGERI Present and FutureBioinformatics Core at AGERI Present and Future
Bioinformatics Core at AGERI Present and FutureRABNENA Network
 
wolstencroft-ogf20-astro
wolstencroft-ogf20-astrowolstencroft-ogf20-astro
wolstencroft-ogf20-astrowebuploader
 
A Reliable Password-based User Authentication Scheme for Web-based Human Geno...
A Reliable Password-based User Authentication Scheme for Web-based Human Geno...A Reliable Password-based User Authentication Scheme for Web-based Human Geno...
A Reliable Password-based User Authentication Scheme for Web-based Human Geno...Thitichai Sripan
 
BITS: Basics of sequence databases
BITS: Basics of sequence databasesBITS: Basics of sequence databases
BITS: Basics of sequence databasesBITS
 
Dr. Nanyingi Technology Keynote
Dr. Nanyingi Technology KeynoteDr. Nanyingi Technology Keynote
Dr. Nanyingi Technology KeynoteNanyingi Mark
 
VistaMilk Communication Technologies Research
VistaMilk Communication Technologies ResearchVistaMilk Communication Technologies Research
VistaMilk Communication Technologies ResearchWalton Institute
 
Cebit Brochure01 31oct08
Cebit Brochure01 31oct08Cebit Brochure01 31oct08
Cebit Brochure01 31oct08martindudziak
 
Bio Chip Project Report
Bio Chip Project ReportBio Chip Project Report
Bio Chip Project Reportpiyu k
 
SEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSIS
SEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSISSEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSIS
SEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSISIRJET Journal
 
Animal Repellent System for Smart Farming Using AI and Deep Learning
Animal Repellent System for Smart Farming Using AI and Deep LearningAnimal Repellent System for Smart Farming Using AI and Deep Learning
Animal Repellent System for Smart Farming Using AI and Deep LearningIRJET Journal
 
EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...
EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...
EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...Dag Endresen
 
Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...
Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...
Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...Yole Developpement
 
Tim Malthus_Towards standards for the exchange of field spectral datasets
Tim Malthus_Towards standards for the exchange of field spectral datasetsTim Malthus_Towards standards for the exchange of field spectral datasets
Tim Malthus_Towards standards for the exchange of field spectral datasetsTERN Australia
 

Similar a BecA Hub/ILRI Bioinformatics Platform (20)

Bioinformatics platform: Harnessing bioinformatics for food security and sust...
Bioinformatics platform: Harnessing bioinformatics for food security and sust...Bioinformatics platform: Harnessing bioinformatics for food security and sust...
Bioinformatics platform: Harnessing bioinformatics for food security and sust...
 
e-BioGrid_NBIC Conference 2011 april 20
e-BioGrid_NBIC Conference 2011 april 20e-BioGrid_NBIC Conference 2011 april 20
e-BioGrid_NBIC Conference 2011 april 20
 
BecA-ILRI Hub genomics and bioinformatics platforms
BecA-ILRI Hub genomics and bioinformatics platformsBecA-ILRI Hub genomics and bioinformatics platforms
BecA-ILRI Hub genomics and bioinformatics platforms
 
Software Pipelines: The Good, The Bad and The Ugly
Software Pipelines: The Good, The Bad and The UglySoftware Pipelines: The Good, The Bad and The Ugly
Software Pipelines: The Good, The Bad and The Ugly
 
Bioinformatics Core at AGERI Present and Future
Bioinformatics Core at AGERI Present and FutureBioinformatics Core at AGERI Present and Future
Bioinformatics Core at AGERI Present and Future
 
wolstencroft-ogf20-astro
wolstencroft-ogf20-astrowolstencroft-ogf20-astro
wolstencroft-ogf20-astro
 
A Reliable Password-based User Authentication Scheme for Web-based Human Geno...
A Reliable Password-based User Authentication Scheme for Web-based Human Geno...A Reliable Password-based User Authentication Scheme for Web-based Human Geno...
A Reliable Password-based User Authentication Scheme for Web-based Human Geno...
 
NRNB EAC Report 2011
NRNB EAC Report 2011NRNB EAC Report 2011
NRNB EAC Report 2011
 
BITS: Basics of sequence databases
BITS: Basics of sequence databasesBITS: Basics of sequence databases
BITS: Basics of sequence databases
 
Bioinformatics
BioinformaticsBioinformatics
Bioinformatics
 
Dr. Nanyingi Technology Keynote
Dr. Nanyingi Technology KeynoteDr. Nanyingi Technology Keynote
Dr. Nanyingi Technology Keynote
 
VistaMilk Communication Technologies Research
VistaMilk Communication Technologies ResearchVistaMilk Communication Technologies Research
VistaMilk Communication Technologies Research
 
Sinnott Paper
Sinnott PaperSinnott Paper
Sinnott Paper
 
Cebit Brochure01 31oct08
Cebit Brochure01 31oct08Cebit Brochure01 31oct08
Cebit Brochure01 31oct08
 
Bio Chip Project Report
Bio Chip Project ReportBio Chip Project Report
Bio Chip Project Report
 
SEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSIS
SEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSISSEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSIS
SEMI SUPERVISED BASED SPATIAL EM FRAMEWORK FOR MICROARRAY ANALYSIS
 
Animal Repellent System for Smart Farming Using AI and Deep Learning
Animal Repellent System for Smart Farming Using AI and Deep LearningAnimal Repellent System for Smart Farming Using AI and Deep Learning
Animal Repellent System for Smart Farming Using AI and Deep Learning
 
EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...
EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...
EURISCO demo installations of IPT, at GBIF EU Nodes meeting in Alicante (11 M...
 
Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...
Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...
Next Generation Sequencing & DNA Synthesis: Technology, Consumables Manufactu...
 
Tim Malthus_Towards standards for the exchange of field spectral datasets
Tim Malthus_Towards standards for the exchange of field spectral datasetsTim Malthus_Towards standards for the exchange of field spectral datasets
Tim Malthus_Towards standards for the exchange of field spectral datasets
 

Más de ILRI

How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...ILRI
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...ILRI
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...ILRI
 
A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...ILRI
 
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...ILRI
 
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseasesPreventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseasesILRI
 
Preventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne diseasePreventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne diseaseILRI
 
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistancePreventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistanceILRI
 
Food safety research in low- and middle-income countries
Food safety research in low- and middle-income countriesFood safety research in low- and middle-income countries
Food safety research in low- and middle-income countriesILRI
 
Food safety research LMIC
Food safety research LMICFood safety research LMIC
Food safety research LMICILRI
 
The application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern AfricaThe application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern AfricaILRI
 
One Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the fieldOne Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the fieldILRI
 
Reservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in UgandaReservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in UgandaILRI
 
Minyoo ya mbwa
Minyoo ya mbwaMinyoo ya mbwa
Minyoo ya mbwaILRI
 
Parasites in dogs
Parasites in dogsParasites in dogs
Parasites in dogsILRI
 
Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...ILRI
 
Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...ILRI
 
Livestock in the agrifood systems transformation
Livestock in the agrifood systems transformationLivestock in the agrifood systems transformation
Livestock in the agrifood systems transformationILRI
 
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...ILRI
 
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farmsPractices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farmsILRI
 

Más de ILRI (20)

How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...How the small-scale low biosecurity sector could be transformed into a more b...
How the small-scale low biosecurity sector could be transformed into a more b...
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
 
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
Small ruminant keepers’ knowledge, attitudes and practices towards peste des ...
 
A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...A training, certification and marketing scheme for informal dairy vendors in ...
A training, certification and marketing scheme for informal dairy vendors in ...
 
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...Milk safety and child nutrition impacts of the MoreMilk training, certificati...
Milk safety and child nutrition impacts of the MoreMilk training, certificati...
 
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseasesPreventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
Preventing the next pandemic: a 12-slide primer on emerging zoonotic diseases
 
Preventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne diseasePreventing preventable diseases: a 12-slide primer on foodborne disease
Preventing preventable diseases: a 12-slide primer on foodborne disease
 
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistancePreventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
Preventing a post-antibiotic era: a 12-slide primer on antimicrobial resistance
 
Food safety research in low- and middle-income countries
Food safety research in low- and middle-income countriesFood safety research in low- and middle-income countries
Food safety research in low- and middle-income countries
 
Food safety research LMIC
Food safety research LMICFood safety research LMIC
Food safety research LMIC
 
The application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern AfricaThe application of One Health: Observations from eastern and southern Africa
The application of One Health: Observations from eastern and southern Africa
 
One Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the fieldOne Health in action: Perspectives from 10 years in the field
One Health in action: Perspectives from 10 years in the field
 
Reservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in UgandaReservoirs of pathogenic Leptospira species in Uganda
Reservoirs of pathogenic Leptospira species in Uganda
 
Minyoo ya mbwa
Minyoo ya mbwaMinyoo ya mbwa
Minyoo ya mbwa
 
Parasites in dogs
Parasites in dogsParasites in dogs
Parasites in dogs
 
Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...Assessing meat microbiological safety and associated handling practices in bu...
Assessing meat microbiological safety and associated handling practices in bu...
 
Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...Ecological factors associated with abundance and distribution of mosquito vec...
Ecological factors associated with abundance and distribution of mosquito vec...
 
Livestock in the agrifood systems transformation
Livestock in the agrifood systems transformationLivestock in the agrifood systems transformation
Livestock in the agrifood systems transformation
 
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
Development of a fluorescent RBL reporter system for diagnosis of porcine cys...
 
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farmsPractices and drivers of antibiotic use in Kenyan smallholder dairy farms
Practices and drivers of antibiotic use in Kenyan smallholder dairy farms
 

Último

QCon London: Mastering long-running processes in modern architectures
QCon London: Mastering long-running processes in modern architecturesQCon London: Mastering long-running processes in modern architectures
QCon London: Mastering long-running processes in modern architecturesBernd Ruecker
 
Glenn Lazarus- Why Your Observability Strategy Needs Security Observability
Glenn Lazarus- Why Your Observability Strategy Needs Security ObservabilityGlenn Lazarus- Why Your Observability Strategy Needs Security Observability
Glenn Lazarus- Why Your Observability Strategy Needs Security Observabilityitnewsafrica
 
Time Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directionsTime Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directionsNathaniel Shimoni
 
Digital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptxDigital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptxLoriGlavin3
 
The Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptx
The Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptxThe Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptx
The Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptxLoriGlavin3
 
MuleSoft Online Meetup Group - B2B Crash Course: Release SparkNotes
MuleSoft Online Meetup Group - B2B Crash Course: Release SparkNotesMuleSoft Online Meetup Group - B2B Crash Course: Release SparkNotes
MuleSoft Online Meetup Group - B2B Crash Course: Release SparkNotesManik S Magar
 
Unleashing Real-time Insights with ClickHouse_ Navigating the Landscape in 20...
Unleashing Real-time Insights with ClickHouse_ Navigating the Landscape in 20...Unleashing Real-time Insights with ClickHouse_ Navigating the Landscape in 20...
Unleashing Real-time Insights with ClickHouse_ Navigating the Landscape in 20...Alkin Tezuysal
 
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyesHow to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyesThousandEyes
 
React Native vs Ionic - The Best Mobile App Framework
React Native vs Ionic - The Best Mobile App FrameworkReact Native vs Ionic - The Best Mobile App Framework
React Native vs Ionic - The Best Mobile App FrameworkPixlogix Infotech
 
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptxPasskey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptxLoriGlavin3
 
Long journey of Ruby standard library at RubyConf AU 2024
Long journey of Ruby standard library at RubyConf AU 2024Long journey of Ruby standard library at RubyConf AU 2024
Long journey of Ruby standard library at RubyConf AU 2024Hiroshi SHIBATA
 
Top 10 Hubspot Development Companies in 2024
Top 10 Hubspot Development Companies in 2024Top 10 Hubspot Development Companies in 2024
Top 10 Hubspot Development Companies in 2024TopCSSGallery
 
Bridging Between CAD & GIS: 6 Ways to Automate Your Data Integration
Bridging Between CAD & GIS:  6 Ways to Automate Your Data IntegrationBridging Between CAD & GIS:  6 Ways to Automate Your Data Integration
Bridging Between CAD & GIS: 6 Ways to Automate Your Data Integrationmarketing932765
 
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024BookNet Canada
 
Decarbonising Buildings: Making a net-zero built environment a reality
Decarbonising Buildings: Making a net-zero built environment a realityDecarbonising Buildings: Making a net-zero built environment a reality
Decarbonising Buildings: Making a net-zero built environment a realityIES VE
 
Generative Artificial Intelligence: How generative AI works.pdf
Generative Artificial Intelligence: How generative AI works.pdfGenerative Artificial Intelligence: How generative AI works.pdf
Generative Artificial Intelligence: How generative AI works.pdfIngrid Airi González
 
Moving Beyond Passwords: FIDO Paris Seminar.pdf
Moving Beyond Passwords: FIDO Paris Seminar.pdfMoving Beyond Passwords: FIDO Paris Seminar.pdf
Moving Beyond Passwords: FIDO Paris Seminar.pdfLoriGlavin3
 
Zeshan Sattar- Assessing the skill requirements and industry expectations for...
Zeshan Sattar- Assessing the skill requirements and industry expectations for...Zeshan Sattar- Assessing the skill requirements and industry expectations for...
Zeshan Sattar- Assessing the skill requirements and industry expectations for...itnewsafrica
 
A Deep Dive on Passkeys: FIDO Paris Seminar.pptx
A Deep Dive on Passkeys: FIDO Paris Seminar.pptxA Deep Dive on Passkeys: FIDO Paris Seminar.pptx
A Deep Dive on Passkeys: FIDO Paris Seminar.pptxLoriGlavin3
 
Use of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptx
Use of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptxUse of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptx
Use of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptxLoriGlavin3
 

Último (20)

QCon London: Mastering long-running processes in modern architectures
QCon London: Mastering long-running processes in modern architecturesQCon London: Mastering long-running processes in modern architectures
QCon London: Mastering long-running processes in modern architectures
 
Glenn Lazarus- Why Your Observability Strategy Needs Security Observability
Glenn Lazarus- Why Your Observability Strategy Needs Security ObservabilityGlenn Lazarus- Why Your Observability Strategy Needs Security Observability
Glenn Lazarus- Why Your Observability Strategy Needs Security Observability
 
Time Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directionsTime Series Foundation Models - current state and future directions
Time Series Foundation Models - current state and future directions
 
Digital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptxDigital Identity is Under Attack: FIDO Paris Seminar.pptx
Digital Identity is Under Attack: FIDO Paris Seminar.pptx
 
The Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptx
The Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptxThe Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptx
The Role of FIDO in a Cyber Secure Netherlands: FIDO Paris Seminar.pptx
 
MuleSoft Online Meetup Group - B2B Crash Course: Release SparkNotes
MuleSoft Online Meetup Group - B2B Crash Course: Release SparkNotesMuleSoft Online Meetup Group - B2B Crash Course: Release SparkNotes
MuleSoft Online Meetup Group - B2B Crash Course: Release SparkNotes
 
Unleashing Real-time Insights with ClickHouse_ Navigating the Landscape in 20...
Unleashing Real-time Insights with ClickHouse_ Navigating the Landscape in 20...Unleashing Real-time Insights with ClickHouse_ Navigating the Landscape in 20...
Unleashing Real-time Insights with ClickHouse_ Navigating the Landscape in 20...
 
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyesHow to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
How to Effectively Monitor SD-WAN and SASE Environments with ThousandEyes
 
React Native vs Ionic - The Best Mobile App Framework
React Native vs Ionic - The Best Mobile App FrameworkReact Native vs Ionic - The Best Mobile App Framework
React Native vs Ionic - The Best Mobile App Framework
 
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptxPasskey Providers and Enabling Portability: FIDO Paris Seminar.pptx
Passkey Providers and Enabling Portability: FIDO Paris Seminar.pptx
 
Long journey of Ruby standard library at RubyConf AU 2024
Long journey of Ruby standard library at RubyConf AU 2024Long journey of Ruby standard library at RubyConf AU 2024
Long journey of Ruby standard library at RubyConf AU 2024
 
Top 10 Hubspot Development Companies in 2024
Top 10 Hubspot Development Companies in 2024Top 10 Hubspot Development Companies in 2024
Top 10 Hubspot Development Companies in 2024
 
Bridging Between CAD & GIS: 6 Ways to Automate Your Data Integration
Bridging Between CAD & GIS:  6 Ways to Automate Your Data IntegrationBridging Between CAD & GIS:  6 Ways to Automate Your Data Integration
Bridging Between CAD & GIS: 6 Ways to Automate Your Data Integration
 
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
Transcript: New from BookNet Canada for 2024: Loan Stars - Tech Forum 2024
 
Decarbonising Buildings: Making a net-zero built environment a reality
Decarbonising Buildings: Making a net-zero built environment a realityDecarbonising Buildings: Making a net-zero built environment a reality
Decarbonising Buildings: Making a net-zero built environment a reality
 
Generative Artificial Intelligence: How generative AI works.pdf
Generative Artificial Intelligence: How generative AI works.pdfGenerative Artificial Intelligence: How generative AI works.pdf
Generative Artificial Intelligence: How generative AI works.pdf
 
Moving Beyond Passwords: FIDO Paris Seminar.pdf
Moving Beyond Passwords: FIDO Paris Seminar.pdfMoving Beyond Passwords: FIDO Paris Seminar.pdf
Moving Beyond Passwords: FIDO Paris Seminar.pdf
 
Zeshan Sattar- Assessing the skill requirements and industry expectations for...
Zeshan Sattar- Assessing the skill requirements and industry expectations for...Zeshan Sattar- Assessing the skill requirements and industry expectations for...
Zeshan Sattar- Assessing the skill requirements and industry expectations for...
 
A Deep Dive on Passkeys: FIDO Paris Seminar.pptx
A Deep Dive on Passkeys: FIDO Paris Seminar.pptxA Deep Dive on Passkeys: FIDO Paris Seminar.pptx
A Deep Dive on Passkeys: FIDO Paris Seminar.pptx
 
Use of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptx
Use of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptxUse of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptx
Use of FIDO in the Payments and Identity Landscape: FIDO Paris Seminar.pptx
 

BecA Hub/ILRI Bioinformatics Platform

  • 1. BecA Hub/ILRI Bioinformatics Platform What is Bioinformatics? Bioinformatics is the application of statistics and computer science to molecular biology. It is a rapidly developing branch of Information Technology that seeks to exploit the wealth of DNA and other sequence data that has been generated in the last decade. In short, bioinformatics is the key to understanding the molecule of life, DNA. Bioinformatics offers tremendous opportunities and has great potential to underpin biotechnological solutions to agricultural development constraints. DNA - Information flow in the molecule of life ATGATTATGGACACTTCTTTGAA AAATAATGATGGAGCTTTAGAAG CTGATAACAAAAATTATCAAGAT TATAAAGCTGAGCCTGATAAAAC Gene AAGCGATGTATTAGATGTTACTA AATATAATTCAGTGGTAGATTGT TGCCATAAAAATTATTCAACATT TACATCTGAATGGTATATTAATG AAAGAAAATATAATGATGTTCCA GAAGGACCAAAAAATGATTATGG ACACTTCTTTGAAAAATAATGAT GGAGCTTTAGAAGCTGATAACAA AAATTATCAAGATT Cell Chromosome DNA DNA sequence RNA Protein Livestock, crops, micro-organisms Some of the many projects using the BecA Hub/ILRI Bioinformatics Platform BecA Hub/ILRI Bioinformatics Platform The bioinformatics platform provides advanced computational capabilities i bi i f t ti l biliti in bioinformatics t all ti to ll Crop improvement scientists at the BecA Hub and provides training in all  Biotechnology applications to combat Cassava Brown Streak aspects of bioinformatics. Disease (CBSD)  Genetic fingerprints for groundnut and pigeon pea The platform provides:  Fine mapping of Striga resistance in sorghum  Access to major sequence databases (USA, EU, etc.)  Marker-assisted breeding for drought resistance in sorghum  Access to specialized hardware and sophisticated commercial and academic software  Sophisticated data analysis capabilities  Access to high performance co put g se ces a d ccess g pe o a ce computing services and grids (CGIAR, EU, USA, etc .) Vaccines and diagnostics Research Institutes Universities  Integrated response system for emerging infectious diseases in East Africa  East Coast fever (ECF) recombinant vaccine development  Contagious bovine pleuropneumonia (CBPP) diagnostic and European Molecular Biology Network Web interface vaccine development EMBRACE Network of Excellence Direct access  Development of new diagnostic assays and epidemiological e-Infrastructure (EELA, GEANT, EGEE) Advanced Research Institutes (EU, USA) Broadband surveillance of viral pathogens of livestock in Africa Internet Broadband Internet Bioinformatics capacity building  Training workshops Direct access  MSc and PhD student projects Web services  Online training courses and training materials Broadband Internet CGIAR – HPC Grid BecA-ILRI – Kenya (64 CPUs) BecA Hub/ILRI IRRI – Philippines (16 CPUs) Bioinformatics ICRISAT – India (8 CPUs) Platform CIP – Peru (8 CPUs) For further information contact: Dr. Etienne de Villiers (Bioinformatics Group Leader) e.villiers@cgiar.org ILRI INTERNATIONAL LIVESTOCK RESEARCH INSTITUTE