Genome technology has revolutionized biological science through techniques of Gene Editing in order to edit any organism's genome.MegNs and zinc-finger nucleases are commonly understood to be used, as is the effector's transcriptional activator-like nucleases. In CRISPR/Cas9, genetic alterations, and gene functionality have become a well-known tool for understanding gene targeting.

2. Contents
Genome Editing
DNA repair system
MegNs: MegaNucleases
ZFNS: Zinc Finger Technology
TALENS: Transcription Activator-Like Effector Nucleases
CRISPR /CRISPR-Associated Protein 9 (Cas9)
Classifications of CRISPR/CAS system
Gene Delivery system
CRISPR- Cas9 system as Base Editing
Limitations/ Challenges
Applications or Future Prospective
Future Perspectives of Gene editing tool
2

3. Genome Editing (GE)
Genome editing (GE) has modernized the biological world by providing a means
to edit genomes of living organisms including humans, plants, animals, and
microbes.
Introduces mutations in the form of insertions or deletions (INDELs) or base
substitutions in targeted sequences, so causing DNA modifications by using
artificially engineered nucleases or molecular scissors.
Genome editing can be used:
 For research: used to change the DNA in cells or organisms to understand
their biology and how they work.
 To treat disease: used to modify human blood cells, also potentially be used to
treat other infections and simple genetic conditions
 For biotechnology: used in agriculture to genetically modify crops to improve
their yields and resistance to disease and drought
3

4. How does genome editing work?
Genome editing uses a type of enzyme called an ‘engineered nuclease’ which cuts
the genome in a specific place in genome.
Engineered nucleases are made up of two parts:
– A nuclease part that cuts the DNA.
– A DNA-targeting part that is designed to guide the nuclease to a specific sequence of DNA.
Programmable nucleases enable precise genome editing by introducing
DNA double- strand breaks (DSBs) at specific genomic loci.
We can manipulate this repair process to make changes (or ‘edits’) to the DNA in
that location in the genome.
4

5. Major Classes of Nucleases
As of 2015 four families of engineered nucleases used: These nuclease systems can be
broadly classified into two categories based on their mode of DNA recognition:
ZFNs, TALENs and meganucleases achieve specific DNA binding via protein- DNA
interactions
Cas9 is targeted to specific DNA sequences by a short RNA guide molecule that
base-pairs directly with the target DNA and by protein-DNA interactions
DNA Repair System
5
DSBs are repaired through two ways:
• Non-homologous end joining (NHEJ)
• Homologous Directed Recombination (HDR)

6. Fig.1: Major classes of nucleases
6

7. DNA repair system
A. Nonhomologous End-Joining (NHEJ):
A pathway that repairs DSBs and creates indels
leading to gene knockout
Used to generate point mutations via gene
replacement
B. Homology-Directed Repair (HDR):
Introduce precise sequence or insertion, or gene
replacement, by adding a donor DNA template
with sequence homology at a predicted DSB site.
HDR induces the specific replacement of genes or
allows foreign DNA knock-ins.
7

8. 8
Efficiency of genome editing
NHEJ is not limited to a specific cell cycle phase, whereas HDR occurs in the S or
G2 phase and uses the DNA template for homologous repair and is therefore largely
restricted to cells that are actively dividing, limiting treatments that require precise
genome modifications.
NHEJ is a very efficient repair mechanism that is most active in the cell.
Efficiency of NHEJ- and HDR-mediated DSB repair varies substantially by cell
type and cell state; in most cases, however, NHEJ is more active than HDR.
NHEJ is thought to be active throughout the cell cycle and has been observed in a
variety of cell types.

9. Several nucleases have been successfully used including:
• Meganucleases (MegNs),
• Zinc finger nucleases (ZFNs),
• Transcription activator-like effector nucleases (TALENs)
• Clustered regularly interspaced short palindromic
repeats(CRISPR/Cas9)
9

10. Discovered in 1980s, are enzyme in the endonuclease
family which are characterized by their capacity to
recognize and cut large DNA sequence from 14-40 bp
Molecular DNA scissors having large base pair
structures found within different types of microbial life
Homing endonucleases
MegNs divides its DNA substrate as homodimer
(composed of two copies of the same protein domain)
MegNs can be isolated into 5 families dependent on
arrangement and structure motify:
LAGLIDADG, GIYYIG, HNH, His-Cys box and PD-
(D/E)XK
10
Fig: Meganucleses
1. MegNs: Meganucleases

11. The most widespread and best known meganucleases are the protein in the
LAGLIDADG family, which own their name to a conserved amino acid sequence.
I-CreI is a homodimer individual from MegNs family which perceives and
separates a 22Bp pseudo-palindromic target
(5'_ CAAAACGTCGTGAGACAGTTTGG_3')
Natural meganucleases have certain variation in recognition site
By modifying their recognition sequence through the protein engineering the
targeted sequence can be changed.
Highly specific and easy to deliver to cells but difficult to redesign for new targets
Costly and time consuming
11
MegaNs Conti..

12. 2. ZFNS: Zinc Finger nucleases technology
Artificial restriction enzymes generated by fusing a zinc
finger DNA-binding domain to a DNA-cleavage domain.
First discovered primarily in 1985 in xenopus oocytes.
1) DNA binding
2) Cleavage domain
Restriction enzyme bound to the DNA binding domain
of Eukaryotic restriction factor known as Zinc Finger
Protein containing cys2-his2 fingers.
Fokl endonuclease from Flavobacteriam Okeanokotes
needs to be dimerized (fused) to generate DSB formation
12
Fig: Zinc finger nucleases
Each ZFN consist of two functional domain

13. ZFNs conti..
ZEN are formed of Zinc Finger protein bound to half subunit of FOK1, named so because
of their shape which is determined by binding of a centrally placed Zinc ion.
ZFs recognize codons and usually a group of 3 are linked together with a half subunit of
FOK1 endonuclease.
Cys2-his2 Zinc finger domain is most abundant DNA binding motif in eukaryotesZinc
finger themselves constructed in a way to contain three or more finger recognize 3-4 bases
by each finger .
The functional analysis of ZFNS domain revealed the presence of 30 cysteine and histidine.
These are derived by highly conserved interaction of their zinc finger domains with
homologous DNA sequence
Zinc finger consist of 30 amino acids bound to Zinc ion which consist of two anti parallel
β-sheets opposing an α-helix to provide stability to their ββα-structure.
Target site recognition and specificity are determined by three functions.
1) Amino sequence in each finger.
2) Number of fingers and
3) Nuclease domain interaction
13

14. By designing ZFNS pairs, one ZFN binds with forward strand, other ZFN bind
with Reverse strand and, contains heterodimer Fok-I domains, fused to form DSBs
that are repaired by NHEJ and HDR.
Improve the targeting accuracy of ZFNS via Selection based method
By introduced the new linker option for domains binding to produce a 64 fold total
increase in number of ZFN configuration available for targeting cleavage at any
desired base of DNA
ZFNs have been used for creating site-specific modifications in a number of model
organisms such as fruit, mouse-ear cress (Arabidopsis thaliana), zebrafish, mice and
also used for several therapeutic purposes
14
ZFNs conti..

15. ZFNs conti..
Benefits
Easy to prepare
smaller in size
Generate precisely targeted genomic editing resulting in cell lines with targeted
gene deletions, integration and modifications.
Drawbacks:
Context dependence - how well they cleave the targeted site
Designed difficult issues, and
Inefficient in multiple gene targeting
Their specificity does not depend on the target sequence itself but also on the
same sequence in the genome
15

16. Artificial restriction enzymes generated by fusing:
- DNA binding domain - TALE effector
- DNA cleavage domain - Restriction enzyme FOKI
TALENs can be engineered to bind any desired DNA sequence
to cut at specific locations in DNA
TALEN constructs are used in a similar way to designed zinc
finger nucleases
Protein originally discovered in pathogenic bacteria
Xanthomonas
Bacteria secrete effector proteins (TALES) in cytoplasm of
infected plant cell
Effector protein capable of DNA binding, activate the expression
of target genes via the eukaryotic transcription factors
DNA-binding domain consists of highly conserved repeats
derived from transcription activator-like effectors (TALE).
16
3. TALENS: Transcription Activator-like Effector Nucleases
Fig: TALENS

17. TALENS conti..
TALE protein made of three domains:
1) An amino-terminal domain having a transport signal,
2) A DNA-binding domain which is made of repeating sequences of 34 amino
acids, and
3) A carboxyl-terminal domain a transcription activation domain.
A variable region of two amino acid residues located at positions 12 and 13 called
repeat variable di-residues (RVD).
This region has the ability to confer specificity to one of the any four nucleotide bps
DNA-binding specificity is determined by RVDs, with ND specifical binding to C
nucleotides, HN to A or G nucleotides, NH to G nucleotides, and NP to all nucleotides
2 TALE repeats consists of a non-specific DNA cleavage domain of FokI nuclease
fused to a customizable target site of the DNA-binding domain to generate DSBs
17

18. To cleave the two strands of the targeted DNA, the FokI cleavage domain must be
dimerized
TALEN module is designed in pairs to bind opposing DNA target loci, with proper
spacing (12–30bp) between the two binding sites
TALENs-based site-specific changes have been obtained in yeast, fruit flies, mice,
nematodes, plants, zebrafish and human, clawed frog embryos, somatic and
pluripotent cells
Advantages
One module recognizes simply one nucleotide in its DNA-binding domain that
permits greater flexibility to design TALENS
TALEN systems which recognize more target sequences.
TALENs are more suitable for therapeutic use because of the 1:1 TALE-DNA
binding affinity
18
TALENS conti..

19. Lower charges of cytoxicity in human cellular lines due to off-target breaks that
result in unwanted changes and toxicity in genome
TALEN system is more efficient for producing DSBs in both somatic cells and
pluripotent stem cells
DNA binding PACE (Phage assisted continous evolution) is a standard strategy for
the laboratory evolution of DNA-binding activity and specificity that might be used
to generate TALEN with notably advance improved DNA cutting specificity
Simple design, and the low number of off-target break
Limitations
Difficulty of the cloning and off targeting effect
Golden Gate molecular cloning, excessive - throughput solid phase assembly and
connection independent cloning techniques to overcome limitations
19
TALENS conti..

20. 20

21. Acronym for “Clustered Regularly Interspaced Short Palindromic Repeats/CRISPR Associated Protein
9”
Revolutionary technique that can modify any region of the genome of any species with the high
precision and accuracy without harming other genes
CRISPR-Cas proteins can target and cleave invading DNA in a sequence specific manner. These are the
part of the Bacterial immune system which detects and recognize the foreign DNA and cleaves it.
CRISPR array is composed of a series of repeats interspaced by spacer sequences acquired from
invading genomes.
CRISPR a specialized region of DNA with two distinct characteristics:
1) Presence of nucleotide repeats
2) Spacers
An RNA guided endonuclease that targets specific DNA sequence
High efficiency, accuracy, and ease of use for GE
Used to modify various gene editing simultaneously (multiplexing) by inducing multiple guide RNAs,
target a 20bp of DNA sequence, that is relatively short compared targets of the ZFNs & TALENs.
21

22. CRISPR-associated nuclease 9 (Cas9): The endonuclease derived from diverse bacterial species. Cas9
protein is used in genetic engineering to cut the DNA and ultimately alter the cell’s genome.
CRISPR RNA (crRNA): The crRNA is transcribed from interval spacer sequences that contains the guide
RNA plays a vital role in matching and recognizing the target DNA that binds to tracrRNA forming an active
complex.
Guide RNA (gRNA): Chimeric molecule that consists of tracrRNA and crRNA, 18–20-nt spacer sequence
complementary to target DNA before PAM.
His-Asn-His (HNH) domain: One of the two endonuclease domains of Cas9 that functions to cleave the
complementary strand of CRISPR RNA (crRNA).
Protospacer adjacent motif (PAM): A 3-nt sequence located immediately downstream of the single guide
RNA (sgRNA) target site, which plays role in binding and for Cas9-mediated DNA cleavage.
RuvC-like domain: one of the two endonuclease domains of Cas9 that functions to cleave the
complementary strand of dsDNA.
Trans-activating crRNA (tracrRNA): A small trans-encoded RNA that stabilizes the structure and then
activates the Cas9 for cleavage of the target DNA.
22

23. History:
CRISPR sequences initially discovered in the E. coli genome in 1987 by a Japanese
scientist, Yoshizumi Ishino, and his team, while analyzing a gene responsible for the
conversion of alkaline phosphatase.
95% of archaeal and 48% of bacterial genomes, with varying PAM sequences and
number/types of Cas proteins.
In 2007, as defense mechanism in microorganism as well as in archaea against to
viral infection
In 2012, researcher Jennifer Doudna with Emmaneulle Charpentier discovered the
system work by explaining the function of Cas9 protein to breaks the DNA structure
with the aid of short repeats of gRNA in vitro
In 2013 in mammalian cells, was found out as third generation genome editing
technique.
23

24. 24
Jinek et al and Cong et al used the CRISPR/Cas system as a genome editing tool
and are trying to use this for the gene editing in the eukaryotic cells to remedy the
genetic diseases.
Liang et al through the use of this system exactly mutated the hemoglobin subunit
β (HBB) gene by working on hemoglobin subunit δ (HBD) gene that's homologous
to the HBB gene.
CRISPR/Cas9 is turning into a powerful effective tool in research for the
information of gene function, gene targeting, alter various genes simultaneously
(Multiplexing), crop improvement and simplicity, versatility and specificity of this
technique may be very useful as well.
History:

25. CRISPR-Cas9 components
Crispr- Cas9 uses a combination of:
1) Cas9 – a Nuclease, an enzyme that
cuts DNA
2) Guide RNA – to specify the location
in the genome.
Generally, the guide RNA targets and
binds to a specific DNA sequence, and
the attached cas9 enzymes .Cas9
nuclease activates DSBs guided by guide
RNA towards the specific DNA
sequence to cut the DNA template and
can be repaired by NHEJ and HDR.
25
Fig : CRISPR-Cas9 system

26. CRISPR is widespread in bacteria as well as in archaea and protects them against viral
infections.
When the bacterium detects viral DNA, it integrates short fragments of viral DNA into
its own chromosome at a position known as the CRISPR locus.
Then, transcribes this sequence into short RNA, known as crRNA (CRISPR RNA),
which then forms a complex with another RNA known as tracrRNA (trans-activating
CRISPR RNA).
This complex is known as “guide RNA (gRNA)”, which then guides a protein called
Cas9 to recognize viral DNA.
DNA cleavage domain has two functional units RUVC and His- ASN-His (HNH) to
break the DSDNA site realize by 3 BP of PAM sequences Cas9 (5ʹ-NGG-3ʹ or 5ʹ-NAG-
3ʹ).
Commonly used Cas9 of Streptococcus pyogenes the sequence 5′-NGG-3′ has been the
widely accepted PAM.
26

27. Degeneracy in Cas9 PAM sequences such as 5′-NGA-3′and 5′-YTN-3′ has also
been reported. These variations affect the specificity of gRNA binding.
HNH domain cuts a complementary strand of CRRNA
RUVC-like domain cleaves an alternative strand of DSDNA.
Cas9 has Ribo-Nucleoprotein (RNP) complex with GRNA to cut DNA properly.
The crRNA performs a role in comparable and identifying the target DNA by
containing a sequence that guides the Cas9 RNP to a specific locus through base
pairing with the target DNA to form an R loop.
This R-loop formation initiates the cleavage to the specific and non-specific
strands of DNA
The DSBs are then usually repaired by:
- NHEJ method introduces small insertions or deletions (InDels) at the site
- HR method, the donor DNA acts as a template to carry out the repair
27

28.  Another knock-in strategy called Intracellular linearized single homology mediate in vivo
targeting the integration (SATI) has capacity, assists to prey a large mutation in various cell
types
 For gene knock-in, it was victoriously used to correct the point mutation which causes
premature aging in mice.
 Other techniques also have been developed for the gene editing inside or outside the cell
Within the bacterial genome, a CRISPR array contains many unique protospacer sequences
that have homology to foreign DNA.
 Protospacers are separated by short palindromic repeat sequences. The CRISPR array is
transcribed to make the pre-CRISPR RNA (pre-crRNA).
 CRISPR/Cas9 have high efficiency such as target site selection, accuracy and simplicity
depends on complex and DNA recognition site based on RNA-DNA interaction.
28

29. 29

30. CRISPR-Cas9 immunity in bacteria
Three basic steps :
1. Adaptation – DNA from an invading virus is
processed into short segments that are inserted
into the CRISPR sequence as new spacers.
2. Transcription – CRISPR repeats and spacers in
the bacterial DNA undergo transcription, the
process of copying DNA into RNA. This RNA
chain is cut into short pieces called CRISPR
RNAs.
3. Targeting – CRISPR RNAs guide bacterial
molecular machinery to destroy the viral material.
Because CRISPR RNA sequences are copied
from the viral DNA sequences acquired during
adaptation, they are exact matches to the viral
genome and thus serve as excellent guides.
30
Fig: CRISPR-Cas9 immunity in
Bacteria

31. Divided into the two classes each type consists of several subtypes (I-V) on basis of
CAS signature genes and their organization style (target location on foreign DNA)
Till now 6 types of CRISPR-CAS and 20 subtypes have been listed and is amplifying.
The commonly used subtype is the type II CRISPR/ Cas9 system from the
Streptococcus (SpCas9) targeting specific DNA sequences and cleaves the DSBs.
Initially, CRISPR system divided by taxonomic studies on mode of specific marker
proteins into 3 types: Type-1 Cas3, type-2 Cas9 and type-3.
CRISPR editing system introduced classes IV and V subsequently.
Generally, classification based on genes that are coded with functional proteins and
others (Cascade, complex or Cas9)
Type I and type III involve multiple proteins forming large cas complex
Type Il from Streptococcus pyrogenes, which relies on a single endonuclease , cas9
31
Classification of CRISPR

32. 32

33. 33
Type I CRISPR
Cascade complex which is followed by the nuclease, which acts as both helicase
and nuclease
7 subtypes – A to F and U
Cas6e cleaves the Pre-CRRNA results to achieved the crRNA, along with cascade
perform for targeting the proto-spacer in genome sequence.
Type-1 also identifies Cas 1-8 protein with known fusion of Cas genes.
PAM is the important factor for type I CRISPR-Cas protective mechanisms and
disturbance of its shows an inability of crRNA to recognize the spacers in target
DNA by Cascade proteins and suppress the R-loop formation
Classification of CRISPR conti..

34. Type II CRISPR
Simplest to all other types due to genes involved
Multidomain Cas9 is a signature protein, with two different classes of RNAs,
RNase III and trRNA and a PAM sequence, detect neighboring to the target genome.
The nuclease domain (HNH) cleaving one strand and another strand cleaved by
RuvC nuclease domain to produce DSBs.
Type II has 3 subtypes (II-A to C) and in Cas9 type-II loci have Cas1 and Cas2
along with Cas4 and Csn2 genes in few subtypes
34
Classification of CRISPR conti..

35. Type III CRISPR
 10 signature Cas genes along Cas5 and Case7
 2 subtypes (III-A, III-B) by having Cas1, Cas2 and Cas6 genes
 Cas6 forms CRRNA by integrate the pre-CRRNA with pathway. This type found
8-nucleotide repeat sequences (crRNA tag) as a result of crRNA.
 The crRNA tag, execute maturation and altered into six nucleotides.
 As size of CRRNA complex rises and generates Cas10-Csm (type III-A) and
Cas10-Cmr (type III-B) complex.
35
Classification of CRISPR conti..

36. As compare to type I and II, type III targets both DNA and RNA, by forming guided
CRRNA to develop DSBs of the target DNA.
The Cas10 domain cuts the DNA strands and Csm3 and Cmr4 bisect the RNA
transcripts.
Another difference of type III, PAM is not essential to initiate immune mechanisms.
Type IV CRISPR known to be present in many bacteria, but the function of which
has not yet been distinguished. This may have Cas5, Cas7 and Csf1 proteins and
recently.
Type V introduced the Cpf1 protein, which acts on crRNA. Thus, they cleaved the
DNA for further clarify the editing system. Cas9 can be delivered in the forms of
DNA, mRNA, or protein.
36
Classification of CRISPR conti..

37. 37
Gene delivery system
3 common delivery approaches for genome editing.
1. Plasmid‐based CRISPR/Cas9 strategy
A plasmid is used to encode Cas9 protein and sgRNA in vitro
This strategy is longer lasting in the expression of Cas9 and sgRNA, and
Prevents multiple transfections - Process of artificially introducing nucleic acids (DNA
or RNA) into cells
2. Direct intracellular delivery of Cas9 mRNA and sgRNA
Greatest drawback of which lies in the poor stability of mRNA, which results in
transient expression of mRNA and a short duration of gene modification
3. Directly delivery of Cas9 protein and sgRNA
Several advantages, including rapid action, great stability, and limited antigenicity

38. For gene editing in mammalian cells, recommend delivery of a ribonuclear
protein (RNP) complex consisting of Cas9 protein and a single guide RNA (sgRNA).
RNPs remain in the cell for a short time and the dose is minimal, leading to lower
toxicity and reduced editing at off-target sites compared to other methods.
RNPs can be delivered using either electroporation of recombinant Cas9
protein along with in vitro transcribed guide RNA or using cell-derived nanovesicles
called gesicles.
Also provides kits for delivery using lentivirus, AAV, and plasmid.
38
Gene delivery system conti..

39. Nano-based particles systems or a Gemini-virus genome have been
revolutionized to deliver various nucleases and repaired DSBs template.
Electroporation, lipofection, and microinjection are non-viral methods also be
used to transfer the gene carrying sequence to target site, as a result less off
targeting cleavage. Microinjection is considered the gold standard procedure since
its efficiency
Size of the Cas9 nuclease allowed the delivery of the system in vivo using
Adeno-associated viruses
Most Common way to minimize the off-target activity, Streptococcus Cas9
protein (SpyCas9) is recover with Cas9 nickase which breaks a single strand by
the deactivation of a nuclease domain (Ruvc or HNH).
39
Gene delivery system conti..

40. Base editing (BE)
A genome editing system that introduces precise and highly predictable
nucleotide changes at genomic targets without requiring donor DNA templates or
DSBs and are not dependent on HDR and NHEJ
 Highly predictable change introduces changes in nucleotide at genome target site.
 Base deaminase enzyme with the help of Cas9 D10A nickases
 Various BE system - BE3, BE4, Targeted AID, and dCpf1-Base Editing
 Protein BE (Cas9 nickase) exhibits a dual function:
1) target the de aminase domain to the target region
2) localize the enzyme to certain regions of double-stranded RNA
40

41. CRISPR/Cas9 as base editing conti..
 BE deaminase domains occur in two ways:
1) Adenosine deaminase
2) Cytosine deaminase
- creates single base substitution (C→T or G→A).
 Base editors are used in different organism e.g., human embryos.
 First base editing generation is cytosine base editor (CBE) it has ability to convert C to T. The
commonly used CBE contains of acytidine deaminase (APOBEC1) and a uracil glycosylase
inhibitor (UGI).
 CRISPR combine with the cytidine deaminase - CRISPR-SKIP utilizes cytidine deaminase
single-base editors. Due to its integrity and accuracy, CRISPR-SKIP will broadly useful in
gene editing.
 BE with mRNA or ribonucleoproteins by selecting the Tyr or Dmd through microinjection or
electrophoresis in rat embroy.
 It possesses efficacy of 55–57% as known as competent way to induce point mutation in target
41

42.  Adenine base editor (ABE) by replacing the cytidine deaminase with adenine deaminase
that convert the A→G. ABE containing hetero dimeric proteins and Cas9 nickase in a
single polypeptide chain.
 RNA base editors (RBE) are generated by fusing nucleobase deaminase with Cas13
protein to de aminate A to inosine or C to uracil in the targeted RNA that is used to repair
the strand with a cytosine, and the I:C base pair is resolved to G: C.
 Glycosylase editors which consist of the CAS9 Nickase, Cytidine deaminase and uracil
DNA glycosylase can convert the C to A and C to G in bacteria and mammals
respectively. Its gene editing efficiency vary between 5-53%.
 CRISPR base editors utilized to remove the genes from DNA by mutation of single
nucleotide to provoke stop codons.
 Stop codons can be developed in approximately 17,000 human genes. This approach is
higher efficient and small toxic.
42
CRISPR/Cas9 as base editing conti..

43. 43

44. 44
Improved yield of plants
Healthy food
Gene knockout in polyploid plants
Deletions of large fragments from gene sequencing
Gene Editing in Human Embryos
Precise base editing

45. 45
1. Deletions of large fragments from gene sequencing
Large deletions are useful in research for crop improvement like in rice and Arabidopsis. These are
involved in the study of gene clusters and non-coding RNAs in plants.
Approximately 245 kb genes in rice and four groups of genes in Arabidopsis have been removed from
the genome sequence by this technique.
2. Precise base editing
Many traits in plants and crops can be obtained by variations in one or more bases like the editing of a
single base C to T which results in C-T or G-A switching in sequence of genes.
A guide RNA and a modified Cas9 that fused to cytidine deaminase for the conversion of cytidine
into uridine.
This technique has been used in many varieties of plants like rice.

46. 3. Usage of gene Editing tools for Human Embryo
The diseases caused by the genetic mutations can be treated in the initial stages of embryo
development.
These techniques involves modifications of patient cells for treatment which can done by isolating
the cells from body and transplanting back into the body after modifications.
The purpose of these gene editing tools in human embryos was to solve initial developmental
problems without implanting the edited cells.
4. Specificity and Off-Target Effects
Specific nucleases used for targeting desired region on the genome. The medicinal use of nuclease need
to have higher selectivity and it modify genes.
Base and primer editing approaches can be a good approach to find the disease-causing mutations
without any changes.
The development of new gene editing tools tools and sequencing methods will help in screening and
RNAs identification that have no off-target effect.
46

47. 5. Single and multiple genes knockout
 Gene editing techniques had been used for targeting of single and multiple genes in plants
like Arabidopsis, rice and tobacco.
 Desired gene in specie is knocked out by introduction of indel in gene sequence which cause
mutations and make gene non- functional.
 Three regulators of grain size found in rice involving GW2, GW5 and TGW6 have been
knocked out.
 This is allowing rapid production of multiple traits in plants and the new varieties of plants
obtained by knocking out gene from their gene sequence.
47

48. Future Perspectives of gene editing tools
Customizable nucleases made new achievements in the treatment or recovery of genetic
mutations. Results obtained from in vitro experiments and animal model shows application of
CRISPR technique in research and medical field.
Customizable nucleases regulate the expression of target gene without modification in
sequence of genome, so it can be an active method in clinics to treat diseases.
CRISPR-Cas9 system with new advancements may allow the activation of endogenous genes
in in-vivo and reverse disease phenotypes
There is need of research to determine the minimal levels of Cas9 protein that can activate the
immune system and it will able the CRISPR-Cas9 system to correct the mutations and to treat
the genetic disease.
Gene editing technique has also been combined with tumor immunotherapy for human disease
treatment like CAR T cell therapy was approved in 2017 for clinical treatment of leukemia
and lymphoma.
The great response of CART therapy in clinical trials of B cell malignancies give hope for the
intelligence treatment, cancer patient treatments, and start advertisement of CART cells by
pharmaceutical and biotechnology companies.
48

49. In the future CRISPR technique will made it possible to identify synthetic lethal interactions
in genome and will be able to discover many novel drug target. It provides new tools to deal
with noncoding regions of the cancer genome sequence.
In the future an efficient CRISPR- Cas system may modifiy specific regions of the genome to
prevent the development of diseases.
Gene editing technology has develops techniques of cell imaging, regulating gene
expression, therapeutic drug production, gene screening and diagnosis.
These techniques can provide therapies for diseases and promoting the life sciences
development.
Many clinical trials are under study that are using new gene editing techniques and in the
coming years, it will be applied clinically for the treatments of genetically produce diseases
and preventions for the viral infections treatment such as SARS-CoV-2.
49
Future Perspectives of gene editing tools

50. Future perspective or Recommendations of genome editing
techniques
• Gene knock in
• Base editing
• Better quality of food
• Treatment of genetic diseases
• Avoid off targets effects for better results
• Activation of gene of interest by CRISPER activation technique
• Gene knock out
• knock down efficiency of any gene could be increased by crisper gene
knock down
50