Se ha denunciado esta presentación.
Utilizamos tu perfil de LinkedIn y tus datos de actividad para personalizar los anuncios y mostrarte publicidad más relevante. Puedes cambiar tus preferencias de publicidad en cualquier momento.

Crop plants: DNA-free genome editing with CRISPR enzymes

865 visualizaciones

Publicado el

-

Publicado en: Medio ambiente
  • Sé el primero en comentar

Crop plants: DNA-free genome editing with CRISPR enzymes

  1. 1. 1 DNA-free genome editing with CRISPR enzymes Sunghwa Choe Seoul National University Thursday, 27 June, 2018 14:20 - 14:40 OECD CONFERENCE ON GENOME EDITING: APPLICATIONS IN AGRICULTURE – IMPLICATIONS FOR HEALTH, ENVIRONMENT AND REGULATION
  2. 2. 2 Gene discovery by T-DNA random mutagenesis
  3. 3. 3 Functional genomics with random mutagenesis T-DNA tagging methods
  4. 4. 4 Evolution of site-specific genome editing ZFN, TALEN, Cas9 ZFN (Zinc Finger Nuclease) TALEN (Transcription Activator-Like Effector Nuclease CRISPR/Cas9 nuclease (Clustered Regularly Interspaced Short Palindromic Repeats/Cas9 nuclease) Fok I Fok I Fok I Fok I Yu et al., 2016. DOI: 10.5772/6433
  5. 5. 5 Conventional way of CRISPR/Cas9 genome editing
  6. 6. 6 Why DNA-free genome editing? From deregulation to non-regulation
  7. 7. 7 CRISPR/Cas9 ribonucleoprotein rather than DNA in vitro assembly of functional CRISPR/Cas9 Cas9 effector protein single guide RNA
  8. 8. 8 Procedures to prepare CRISPR enzymes Purification of the CRISPR/Cas9 and Cas9 Plus [HiTrap Ni-chelating profile] CRISPR/Cas9 CRISPR/Cas9 PLUS
  9. 9. 9 Procedures to prepare CRISPR enzymes sgRNA preparation and holoenzyme
  10. 10. 10 Scheme of DNA-free genome editing
  11. 11. 11 What genes to edit? Arabidopsis brassinosteroid mutants
  12. 12. 12 556 187 244 165 Does RNP of Cas9-sgRNA enter and edit protoplasts? (-) 20 60 (-) 20 60 Day 1 Day 3 (ug/200ul) T7E1 (+) T7E1 (-)556 312 One day treatment of 200K cells in 200 ml volume with 20 mg RNP with PEG induced indels (-) 12 30 12 30 no PEG (mg) Leaf age : 2 weeks 4 weeks Heteroduplex-specific cutting by T7E1 BRI1 (brassinosteroid insensitive 1)
  13. 13. 13 Did the double target method work to delete the intervening DNA? TGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCGCGGTGGCTAT........... 190 bp ..........GCTGGGGTGAAACTAAACTGGTCCACACGGCGGAAGATTGCGATAGGATCAGCTAG (wt) TGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCGCGGTGGCTAT........... 190 bp ..........GCTGGGGTGAAACTAAA-------ACACGGCGGAAGATTGCGATAGGATCAGCTAG (-7) TGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCG---------------------------------------------------------------ACACGGCGGAAGATTGCGATAGGATCAGCTAG (-224) TGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCG--------------------------------------------------------------CACACGGCGGAAGATTGCGATAGGATCAGCTAG (-223) TGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCACACGGCGGAAGATTGCGATAGGATCAGCTAG (-223+62) 1. DNA spanning the 2 target sites was PCR amplified 2. Cloned into a TA-cloning vector 3. Clones were randomly selected and Sanger sequenced: 23/40 = 57.5 (%)
  14. 14. 14 Are other loci of the Arabidopsis genome accessible? PhyB - + COI1 - + Protoplast 1*10^5 cell Cas9 protein 20 mg (final concentration : 50 ng/ml) sgRNA 15 mg (final concentration : 38 ng/ml) PEG incubation condition 20 %, 15 min Total volume 400 ml 5’-ACGGTGCAGCATTTCTTTACCACGGGAAGTATTACCCGTT-GGGTGTTGCTCCTAGTGAAGTTCAGATAAAAGATGTTGTG WT 5’-ACGGTGCAGCATTTCTTTACCACGGGAAGTATTACCCGTT--GGTGTTGCTCCTAGTGAAGTTCAGATAAAAGATGTTGTG -1 bp (3/10) 5’-ACGGTGCAGCATTTCTTTACCACGGGAAGTATTACCCGTTaGGGTGTTGCTCCTAGTGAAGTTCAGATAAAAGATGTTGTG +1 bp (1/10) 5’-ACGGTGCAGCATTTCTTTACCACGGGAAGTATTACCCGTTtGGGTGTTGCTCCTAGTGAAGTTCAGATAAAAGATGTTGTG +1 bp (4/10) 5’-ACGGTGCAGCATTTCTTTACCACGGGAAGTATTACCCGT--GGGTGTTGCTCCTAGTGAAGTTCAGATAAAAGATGTTGTG -1 bp (2/10) PhyB BRI1-TS1 5’-GTGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCG-CGGTGGCTATCAAGAAACTGATTCATGTTAGCGGT WT 5’-GTGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCGgCGGTGGCTATCAAGAAACTGATTCATGTTAGCGGT +1 bp (1/4) 5’-GTGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAG---CGGTGGCTATCAAGAAACTGATTCATGTTAGCGGT -2 bp (2/4) 5’-GTGGGTTTGGAGATGTTTACAAAGCGATTTTGAAAGATGGAAGCGtCGGTGGCTATCAAGAAACTGATTCATGTTAGCGGT +1 bp (1/4) BRI1 - + + RNP
  15. 15. 15 Off-target effects are negligible in Arabidopsis
  16. 16. 16 Do the assembled RNPs work for rice protoplasts? DWD1 3-1 3-2 3-3 CYP724 3-1 3-2 3-3 5’-TGGTTGATCCCGTCTGCATCGTCCAAGCGCACAGTGGCCCGGCCTACGACGTCAGGTTCT----ACCCGGATTCGCAGCAGC WT 5’-TGGTTGATCCCGTCTGCATCGTCCAAGCGCACAGTGGCCCGGCCTACGACGTCAGGTTCT-//-ACCCGGATTCGCAGCAGC +33 bp(4/5) 5’-TGGTTGATCCCGTCTGCATCGTCCAAGCGC-----------------------------T----ACCCGGATTCGCAGCAGC -29 bp(1/5) DWD1 CYP724 5’-CAGGAACCTTGCTCTAGCACTGGTCACCTCCACAAAGCTCAAGCCCAGCTACCTTGGCGACATTGAGAAGATTGCACTGCATATAGTTGGGTCATGGCATGGCAAGAGCAAGG WT 5’-CAGGAACCTTGCTCTAGCACTGGTCACCTCCACAAAGCTCAAGCCCAGCTACCTTGGCGACATTGAGAAGATTGCACTGCATATAGTTGGGTCAT-GCATGGCAAGAGCAAGG -1bp (2/2) Protoplast 3*10^4 cell Cas9 protein 20 mg (final concentration : 50 ng/ml) sgRNA 15 mg (final concentration : 38 ng/ml) PEG incubation condition 20 %, 15 min Total volume 400 ml
  17. 17. 17 Does the Cas9-sgRNA complex work in lettuce? Arabidopsis BIN2 (brassinosteroid insensitive2): gain-of-function mutants WT het homo T7E1 Ctrl 1 2 3 4 5 * (culture) sgRNA (ug) 0 5 10 20 40 80 CAS9 (ug) 0 2.5 5 10 20 40 Indel (%) 10 14 8 11 LsBIN2 5’-AATTTTTCGGGTTTTAAAGCATCACAGTGATGCTCGTCAAAGGATGCCTCTCAT |||||||||||||||||||||||||||||||||||||||||||||||||||||| 3’-TTAAAAAGCCCAAAATTTCGTAGTGTCACTACGAGCAGTTTCCTACGGAGAGTA LsBIN2-RG4
  18. 18. 18 Ribonucleoproteins (RNPs) – mediated genome editing followed by lettuce plant regeneration 1 2 3 4 5 6
  19. 19. 19 Regeneration of plantlets after GE in lettuce Growth and Division of lettuce Protoplasts (LsBIN2 (RG4) editing line) (Deep sequencing analysis : NGS)
  20. 20. 20 Regeneration of whole plants from edited protoplasts
  21. 21. 21 Can we tell edited clones from non-edited ones?  Yes by RNA guided endonuclease (RGEN) Kim JM, Kim D, Kim S, Kim JS (2014) Genotyping with CRISPR-Cas-derived RNA-guided endonucleases. Nature Commu 5: 3157 Arrows: cut Red: deletion Yellow: insertion PCR Digestion Run
  22. 22. 22 What are the nature of editing in the regenerating plantlets? WT 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 ATCACAGTGATGCTCGT-CAAAGG WT #08 ATCACAGTGATGCTCGTTCAAAGG +1 #09 ATCACAGTGATGCTCGTTCAAAGG +1 #10-A1 ATCACAGTGATGCT----CAAAGG -3 -A2 ATCACAGTGATGCTCGTTCAAAGG +1 #11-A1 ATCACAGT----------CAAAGG -9 -A2 ATCACAGTGATGCTCGTTCAAAGG +1 ATCACAGTGATGCTCGT-CAAAGG WT #12 ATCACAGTGATGCTCGTTCAAAGG +1 #14-A1 ATCACAGT----------CAAAGG -9 -A2 ATCACAGTGATGCTCGTTCAAAGG +1 #18-A1 ATCACAGTGATGCTCGTTCAAAGG +1 #20-A1 ATCACAGTGATGCTCGT---AAGG -2 -A2 ATCACAGTGATGCTCGTTCAAAGG +1 #21-A1 ATCACAGTGATGCTCGTTCAAAGG +1 ATCACAGTGATGCTCGT-CAAAGG WT #24-A1 ATCACAGTGATGCTCGTTCAAAGG +1 -A2 ATCACAGTGATGCTCG--CAAAGG -1 #25-A1 ATCACAGTGATGCTCGTTCAAAGG +1 -A2 ATCACAGTGATGCTCGT-CAAAGG WT #29-A1 ATCACAGTG-------T-CAAAGG -7 -A2 ATCACAGTGATGCTCGT-CAAAGG WT #30-A1 ATCACAGTGATGCTCGTTCAAAGG +1 #31-A1 ATCACAGTGATGCTCGTTCAAAGG +1 #33-A1 ATCACAGTGATGCTCGTTCAAAGG +1 #34-A1 ATCACAGTGATGCTCGTTCAAAGG +1 #28 (WT) #24 (bi-allelic) #30 (bi-allelic , homo) -RGEN +RGEN
  23. 23. 23 Does the biallelic heterozygous line exhibit any phenotype? ATCACAGTGATGCTCGT-CAAAGG WT #24-A1 ATCACAGTGATGCTCGTTCAAAGG +1 -A2 ATCACAGTGATGCTCG--CAAAGG -1 #26 (WT) ATCACAGTGATGCTCGT-CAAAGG
  24. 24. 24 Germline transmission of the edited mutations Bar = 10 cm
  25. 25. 25 Number of potential off-target sites in the lettuce genome (Cas-OFFinder www.regenome.net)
  26. 26. 26 Negligible Indel frequencies at the on-target and 91 potential off-target sites : : :
  27. 27. 27 8. phyB sgRNA (ggX20) 60 mg + cas9 protein 30 mg 9. phyB sgRNA (gtX20) 60 mg + cas9 protein 30 mg 10. phyB sgRNA (gX19) 60 mg + cas9 protein 30 mg Indels (%) NGS 0.020 0.046 0.021 1.7 4.6 4.5 4.2 27 8.7 48 1 2 3 4 5 6 7 8 9 10 12 hours ** Indels (%) NGS 0.0066 0.042 0.016 4.0 9.6 9.6 9.5 36 14 49 1 2 3 4 5 6 7 8 9 10 24 hours ** Plasmid DNA method RNP method 1. Control (PEG treatment only) 2. 35Sp-cas9 plasmid only 12 mg 3. U626p-phyB sgRNA plasmid only 12 mg 4. 35Sp-cas9 plasmid 3 mg + U626p-phyB sgRNA plasmid 3 mg 5. 35Sp-cas9 plasmid 6 mg + U626p-phyB sgRNA plasmid 6 mg 6. 35Sp-cas9 plasmid 12 mg + U626p-phyB sgRNA plamisd 12 mg 7. 35Sp-cas9 plasmid 24 mg + U626p-phyB sgRNA plamisd 24 mg 2*105 cell RNP method Comparison of RNP vs DNA methods: time course efficiency
  28. 28. 28 Cas9 plasmid 3 mg + sgRNA plasmid 3 mg CACTAGGAGCAACACCC-----------------------------------AACGGG WT CACTAGGAGCAACACCTGATGATCAGGTCCTTCTTCACCTCCTTGTAGCCCTAACGGG + 35bp (2/90518) DNA vs RNP method: Unwanted DNA integration issue
  29. 29. 29 DNA-free genome editing procedure
  30. 30. 30 Comparison of different genome editing methods
  31. 31. 31 Comparison of different genome editing methods Comparison Way of CRISPR/Cas delivery Transgenic Transient T-DNA DNA mRNA RNP Mutation efficiency ++ ++ + +++ Specificity + + + ++ Duration 10-16 weeks 6-8 weeks 6-8 weeks 6-8 weeks Foreign DNA integration Yes Yes/No No Never Antibiotic selection Yes No No No
  32. 32. 32 Pros and cons of the DNA-free RNP method in plants • Pros • Cas9 protein expression and sgRNA processing in vivo not needed • No foreign DNA remained in the genome • Homozygous mutant for multiple genes at single generation • Cons • Possibility of accompanying somaclonal variation during tissue culture • Difficulty regeneration of whole plants from some crop protoplasts like maize and soybean • Safe and efficient delivery of RNPs
  33. 33. 33 Working together with • Prof. Jin-Soo Kim • Jungeun Kim • Seung Woo Cho, Ph.D. • Sang-Gyu Kim • Je Wook Woo Seoul National University • Soon Il Kwon , Ph.D. • Claudia Corvalán • Jongjin Park G+FLAS LIFE SCIENCES • Sunmee Choi

×