Se ha denunciado esta presentación.
Utilizamos tu perfil de LinkedIn y tus datos de actividad para personalizar los anuncios y mostrarte publicidad más relevante. Puedes cambiar tus preferencias de publicidad en cualquier momento.

Genome editing as a tool for enhancing disease resistance in crops - Vladimir Nekrasov

545 visualizaciones

Publicado el

-

Publicado en: Medio ambiente
  • DOWNLOAD FULL BOOKS, INTO AVAILABLE FORMAT ......................................................................................................................... ......................................................................................................................... 1.DOWNLOAD FULL. PDF EBOOK here { https://tinyurl.com/y3nhqquc } ......................................................................................................................... 1.DOWNLOAD FULL. EPUB Ebook here { https://tinyurl.com/y3nhqquc } ......................................................................................................................... 1.DOWNLOAD FULL. doc Ebook here { https://tinyurl.com/y3nhqquc } ......................................................................................................................... 1.DOWNLOAD FULL. PDF EBOOK here { https://tinyurl.com/y3nhqquc } ......................................................................................................................... 1.DOWNLOAD FULL. EPUB Ebook here { https://tinyurl.com/y3nhqquc } ......................................................................................................................... 1.DOWNLOAD FULL. doc Ebook here { https://tinyurl.com/y3nhqquc } ......................................................................................................................... ......................................................................................................................... ......................................................................................................................... .............. Browse by Genre Available eBooks ......................................................................................................................... Art, Biography, Business, Chick Lit, Children's, Christian, Classics, Comics, Contemporary, Cookbooks, Crime, Ebooks, Fantasy, Fiction, Graphic Novels, Historical Fiction, History, Horror, Humor And Comedy, Manga, Memoir, Music, Mystery, Non Fiction, Paranormal, Philosophy, Poetry, Psychology, Religion, Romance, Science, Science Fiction, Self Help, Suspense, Spirituality, Sports, Thriller, Travel, Young Adult,
       Responder 
    ¿Estás seguro?    No
    Tu mensaje aparecerá aquí
  • Sé el primero en recomendar esto

Genome editing as a tool for enhancing disease resistance in crops - Vladimir Nekrasov

  1. 1. Vladimir Nekrasov Genome editing as a tool for enhancing disease resistance in crops OECD Conference on Genome Editing: Applications in Agriculture Paris, 28-29 June 2018
  2. 2. Nicotiana benthamiana Tomato Barley Maize Brassica Wheat Model plant: Crop plants: Applying CRISPR-Cas9 technology in model and crop plants Arabidopsis thaliana
  3. 3. CRISPR/Cas applications in crops Gene function studies: Crop Improvement: engineering beneficial traits and speeding up the breeding cycle Gene knockout Phenotype??? adapted from Scheben et al. Science (2017) CRISPR/Cas
  4. 4. The pipeline of targeted mutagenesis in plants using the CRISPR/Cas9 system Belhaj et al. Current Opinion in Biotechnology (2015)
  5. 5. Susceptible cultivar S GENES Resistant cultivar GENES Recessive resistance R GENES Dominant resistance + R GENES R - Resistance (R) gene S - Susceptibility (S) gene CRISPR/Cas can be used to engineer both recessive and dominant disease resistance in crops
  6. 6. T3SS Xanthomonas oryzae Plant Cell Disease Engineered resistance Engineering mutations in the avrXa7 effector binding element (EBE) within the Os11N3 S-gene promoter results in enhanced resistance to Xanthomonas oryzae in rice TALEN-induced mutations within the Os11N3 S-gene promoter TALEN-engineered lines are more resistant to X. oryzae Li et al. Nat Biotech (2012) adapted from Doyle et al. Trends Cell Biol (2013)
  7. 7. MLO (WT) mlo MLO is a conserved S gene that confers susceptibility to powdery mildew in a number of plant species Pathotest with Blumeria graminis f. sp. hordei on barley (Hordeum vulgare) http://www.bio1.rwthaachen.de/PlantMolCellBiology/research.html
  8. 8. LB P1 ORF1 T1 P2 ORF2 T2 P3 ORF3 T3 P4 ORF4 T4 P5 ORF5 T5 P6 ORF6 T6 P7 ORF7 T7 P8 ORF8 T8 P11 ORF11 T11 P9 ORF9 T9 P10 1 2 3 4 5 6 7 8 11 9 10ORF10 T10 Level 2 multigene constructs 35S ORF Ter Level 1 transcription units Level 0 Choice of modules P ORF Ter Promoter 5' UTR ORF Ter P1 Ter106 P2 Ter107 P3 Ter128 P4 Ter139 P5 Ter1410 Ter6 Ter7 Ter8 Ter Ter9 Ter1 Ter2 Ter3 Ter4 Ter5 ORF1 ORF2 ORF3 ORF4 ORF5 ORF6 ORF7 ORF8 ORF9 ORF10 ORF11 ORF12 ORF13 ORF14 ORF15 P6 P7 P8 P9 P10 P11 P12 P13 P14 P15 1 2 3 4 5 SP1 SP2 SP3 SP4 SP5 SP6 SP7 SP8 SP9 SP10 SP11 SP12 SP13 SP14 SP15 Libraries of basic modules Promoters 5' UTR ORF TerminatorsSignal Peptides RB The Golden Gate cloning system allows easy assembly of multiple expression units In collaboration with S. Marillonnet
  9. 9. GCAA TTAC ACTA Kan LB RB + Carb NPTII GGGA Red TGCC TGCC BpiI GCAABpiI BpiI BpiI BpiI + ligase + Carb Cas9 BpiI BpiI ACTA + Carb sgRNA1 BpiI BpiI + pICH47732:: NOSp::NPTII-OCST Level 1 pICH47742:: 35Sp::Cas9-NOST Level 1 pICH47751 AtU6p::sgRNA1 Level 1 pAGM4723 Level 2 vector RBGGGA Kan LB Cas9NPTII ACTA sgRNA1 TTACGCAATGCC NPTII-Cas9-sgRNA Level 2 select white colonies CAGA GGGA BpiI BpiI Spec L4E pICH41780 Linker CAGATTAC Carb sgRNA2 BpiI BpiI pICH47761 AtU6p::sgRNA2 Level 1 + sgRNA2 CAGA L4E Using the Golden Gate cloning system to assemble CRISPR constructs
  10. 10. Generating a knockout deletion in the SlMlo1 locus of the Moneymaker tomato using CRISPR/Cas 500 - 400 - 300 - bp 200 - 1 2 83 4 5 6 7 9 10 * * * 500 - 400 - 300 - bp 1 2 8 10WT * * * ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG ACATAGTAAAAGGTGTACCTGTGGTGGAGACTGGTGACCATCTTTTCTGGTTTAATCGCCCTGCCCTTGTCCTATTCTTGATTAACTTTGTACTCTTTCAGG ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48 ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48 ACATAGTAAAAGGTGTACCTGTGGTGGA------------------------------------------------CTTGATTAACTTTGTACTCTTTCAGG -48 ACATAGTAAAAGGTGTACCTGTGGTGGA-------------------------------------------------TTGATTAACTTTGTACTCTTTCAGG -49 WT Plant 1 Plant 2 Plant 8 Plant 10 PAM PAMTarget 1 Target 2 * * * over 80% of T0 plants carry deletions Nekrasov et al. Scientific Reports (2017)
  11. 11. slmlo1 SlMLO1 (WT) CRISPR/Cas-engineered slmlo1 tomato line is fully resistant to the powdery mildew pathogen Oidium neolycopersici
  12. 12. T1 generation slmlo1 plants were screened for the absence of T-DNA 500 - 400 - 300 - 8-1 500 - 400 - 300 - bp 8-2 8-3 8-4 8-5 WT T-DNA slmlo1 8-6 SlMlo1 T-DNA slmlo1 WT slmlo1 8-2 slmlo1 8-4 slmlo1 8-6 (T-DNA) Illumina reads matching the T-DNA T-DNA LB RB Nekrasov et al. Scientific Reports (2017)
  13. 13. Illumina whole genome sequencing confirmed presence of a homozygous deletion in the SlMlo1 locus WT slmlo1 8-2 slmlo1 8-4 slmlo1 8-6 (T-DNA) WT slmlo1 8-2 slmlo1 8-4 slmlo1 8-6 (T-DNA) Nekrasov et al. Scientific Reports (2017)
  14. 14. Target sequence (PAM is in Green) Sites chromosome position off-target sequence Reference base Called base (slmlo1 8-2) Rate of the called base Mutation? Different from wild type? Reference base Called base (wild type) Rate of the called base Mutation? CCAATTCTTGATTAACTTTGTAC 1 chr0 15022112 CCAATTCTTtATTAttTTTGTAC C C 0.995 - - C C 0.992 - 2 chr0 15022113 CCAATTCTTtATTAttTTTGTAC C C 0.989 - - C C 0.985 - 3 chr0 15022114 CCAATTCTTtATTAttTTTGTAC A A 1 - - A A 1 - 4 chr0 15022115 CCAATTCTTtATTAttTTTGTAC A A 0.995 - - A A 1 - 5 chr0 15022116 CCAATTCTTtATTAttTTTGTAC T T 1 - - T T 1 - 6 chr0 15022117 CCAATTCTTtATTAttTTTGTAC T T 0.925 - - T T 0.947 - 7 chr0 15022118 CCAATTCTTtATTAttTTTGTAC C C 1 - - C C 0.985 - 8 chr0 15022119 CCAATTCTTtATTAttTTTGTAC T T 0.995 - - T T 0.993 - 9 chr0 15022120 CCAATTCTTtATTAttTTTGTAC T T 1 - - T T 1 - 10 chr0 15022121 CCAATTCTTtATTAttTTTGTAC t T 1 - - t T 0.993 - 11 chr0 15022122 CCAATTCTTtATTAttTTTGTAC A A 0.995 - - A A 0.993 - 12 chr0 15022123 CCAATTCTTtATTAttTTTGTAC T T 1 - - T T 1 - 13 chr0 15022124 CCAATTCTTtATTAttTTTGTAC T T 0.995 - - T T 1 - 14 chr0 15022125 CCAATTCTTtATTAttTTTGTAC A A 0.995 - - A A 1 - 15 chr0 15022126 CCAATTCTTtATTAttTTTGTAC t T 0.995 - - t T 0.986 - 16 chr0 15022127 CCAATTCTTtATTAttTTTGTAC t T 1 - - t T 0.98 - 17 chr0 15022128 CCAATTCTTtATTAttTTTGTAC T T 1 - - T T 1 - 18 chr0 15022129 CCAATTCTTtATTAttTTTGTAC T T 1 - - T T 1 - 19 chr0 15022130 CCAATTCTTtATTAttTTTGTAC T T 0.995 - - T T 1 - 20 chr0 15022131 CCAATTCTTtATTAttTTTGTAC G G 0.995 - - G G 0.988 - 21 chr0 15022132 CCAATTCTTtATTAttTTTGTAC T T 1 - - T T 1 - 22 chr0 15022133 CCAATTCTTtATTAttTTTGTAC A A 0.99 - - A A 0.987 - 23 chr0 15022134 CCAATTCTTtATTAttTTTGTAC C C 1 - - C C 0.994 - Off-target analysis: 145 putative off-targets with up to 4 mismatches analysed Result: no off-target mutations detected suggesting that CRISPR/Cas is a highly precise tool in tomato Nekrasov et al. Scientific Reports (2017)
  15. 15. Transform with Cas9/sgRNAs Callus tissue T0 plantlets T1 seeds slmlo1 T-DNA segregating Screen for homozygous slmlo1 T0 mutants Screen T1 generation for T-DNA-free plants T2 seeds slmlo1 T-DNA-free 0 3 6 9.5 Time, months3 months 3 months 3.5 months Homozygous T-DNA free slmlo1 tomato lines have been produced in less than 1 year Nekrasov et al. Scientific Reports (2017)
  16. 16. Susceptible cultivar S GENES Resistant cultivar GENES Recessive resistance R GENES Dominant resistance + R GENES R - Resistance (R) gene S - Susceptibility (S) gene CRISPR/Cas can be used to engineer both recessive and dominant disease resistance in crops
  17. 17. Baltes et al (2015) Nat Plants control Susceptible Nicotiana benthamiana + BeYDV DNA virus Cas9 + sgRNA Resistant Chaparro-Garcia et al (2015) Genome Biol Improvement of disease resistance to geminiviruses in Nicotiana benthamiana using CRISPR/Cas as an R gene
  18. 18. plant cell RNA virus Cas13a-gRNA targeting viral RNA adapted from Mahas et al (2018) Biotech Advances empty vector Susceptible Aman et al (2018) Genome Biol Nicotiana benthamiana + TMV RNA virus Improvement of disease resistance to an RNA virus (TMV) in Nicotiana benthamiana using CRISPR/Cas as an R gene Cas13a + gRNA Resistant
  19. 19. Transgene Transgene Transgene based approach (GMO) The Transgene (e.g. R-gene) insertion makes the product Transgene Transgene Transgene Transgene Segregation in T1 Accept Discard Genome editing (e.g. CRISPR/Cas) (non-GMO) Final product with the edit but no transgene The Transgene delivers what makes the product (e.g. mutation in an S-gene)
  20. 20. Improvement of disease resistance in crops using CRISPR/Cas Solanum lycopersicum (tomato) + Oidium neolycopersici Susceptible Resistant SlMlo1 slmlo1 CRISPR KO Nekrasov et al (2017) Sci Reports Non-GM S gene KO plant cell RNA virus Cas13a-gRNA targeting viral RNA adapted from Mahas et al (2018) Biotech Advances empty vector Cas13a + gRNA Susceptible Resistant Aman et al (2018) Genome Biol Nicotiana benthamiana + TMV RNA virus Baltes et al (2015) Nat Plants Chaparro-Garcia et al (2015) Genome Biol control Cas9 + sgRNA Susceptible Resistant Nicotiana benthamiana + BeYDV DNA virus GM + R gene + R gene
  21. 21. Sophien Kamoun Jonathan Jones Cold Spring Harbor Laboratories Zachary Lippman Chris Brooks Boyce Thompson Institute Joyce van Eck MPI Tubingen Detlef Weigel Acknowledgements Caroline Sparks Angela Doherty Melloney St-Leger Florian Hahn Andrey Korolev

×