RNA Codon Workshect Detennination of peptide chain sequence .pdf

RNA Codon Workshect Detennination of peptide chain sequence from m-RNA codon Wheel. The "Wheel" shows you how to detemine which amino acid goes with which m-RNA three letter "codon". To decode a codon start at the middle of the circle and move outward. 1. Identify the amino acids that would be attached to a peptide chain from the following m-RNA sequence. You may use the three letter abbreviations, a. AAC c. UCU b. GAU d. CCC 2. What would the codon sequence(s) be for: a. Leucine b. Valine e. Serine 3. What are the mRNA stop codons? 4. What is the mRNA start codon and wlsat amino acid does it code for? 5. Suppose the DNA sequence TACGCTATATCG was changed to TACGCGATATCG? How would the products of transcription and translation be affected? DNA IRNA sequence Amino acid sequence TACGCTATATCG a a TACGCGATATCG al a 6. First transeribe the following DNA segment into mRNA, then translate the mRNA to a peptide chain. (While translation would be continuous for the whole length of the DNA, transeription would only begin when the RNA transcriptase attached at a start codon.).

RNA Codon Workshect Detennination of peptide chain sequence from m-RNA codon Wheel. The
"Wheel" shows you how to detemine which amino acid goes with which m-RNA three letter
"codon". To decode a codon start at the middle of the circle and move outward. 1. Identify the
amino acids that would be attached to a peptide chain from the following m-RNA sequence. You
may use the three letter abbreviations, a. AAC c. UCU b. GAU d. CCC 2. What would the codon
sequence(s) be for: a. Leucine b. Valine e. Serine 3. What are the mRNA stop codons? 4. What is
the mRNA start codon and wlsat amino acid does it code for? 5. Suppose the DNA sequence
TACGCTATATCG was changed to TACGCGATATCG? How would the products of transcription
and translation be affected? DNA IRNA sequence Amino acid sequence TACGCTATATCG a a
TACGCGATATCG al a 6. First transeribe the following DNA segment into mRNA, then translate
the mRNA to a peptide chain. (While translation would be continuous for the whole length of the
DNA, transeription would only begin when the RNA transcriptase attached at a start codon.)

Recomendados

Protein synthesis with turning point por
Protein synthesis with turning pointProtein synthesis with turning point
Protein synthesis with turning pointtas11244
9.6K vistas69 diapositivas
5’GGCTATATATTACCGATGAGGCGTTCGAATGACTAGCTACACATTATAACGAATTTT3’ 3’CCGA.pdf por
5’GGCTATATATTACCGATGAGGCGTTCGAATGACTAGCTACACATTATAACGAATTTT3’ 3’CCGA.pdf5’GGCTATATATTACCGATGAGGCGTTCGAATGACTAGCTACACATTATAACGAATTTT3’ 3’CCGA.pdf
5’GGCTATATATTACCGATGAGGCGTTCGAATGACTAGCTACACATTATAACGAATTTT3’ 3’CCGA.pdfarcotstarsports
2 vistas2 diapositivas
1. The DNA sequence below was used as a template for producing RNA, G.pdf por
1. The DNA sequence below was used as a template for producing RNA, G.pdf1. The DNA sequence below was used as a template for producing RNA, G.pdf
1. The DNA sequence below was used as a template for producing RNA, G.pdfpallavi953613
3 vistas1 diapositiva
CDU BIOINFORMATICS The central dogma.docx por
CDU BIOINFORMATICS The central dogma.docxCDU BIOINFORMATICS The central dogma.docx
CDU BIOINFORMATICS The central dogma.docxKrishaMaeVillanueva
11 vistas6 diapositivas
Q3 W3 Ppt 4.1 Protein Synthesis-1.pdf por
Q3 W3 Ppt 4.1 Protein Synthesis-1.pdfQ3 W3 Ppt 4.1 Protein Synthesis-1.pdf
Q3 W3 Ppt 4.1 Protein Synthesis-1.pdfxeniavi
8 vistas46 diapositivas
Genetic code por
Genetic codeGenetic code
Genetic codeLheanne Tesoro
1.1K vistas18 diapositivas

Más contenido relacionado

Similar a RNA Codon Workshect Detennination of peptide chain sequence .pdf

Transcriptionand translation por
Transcriptionand translationTranscriptionand translation
Transcriptionand translationAmy Allen
4.6K vistas25 diapositivas
Central Dogma-Cell Theory.pptx por
Central Dogma-Cell Theory.pptxCentral Dogma-Cell Theory.pptx
Central Dogma-Cell Theory.pptxAdrianPerezTastar
12 vistas45 diapositivas
Shown below is a segment of DNA from a Eukaryotic cell which contains.pdf por
Shown below is a segment of DNA from a Eukaryotic cell which contains.pdfShown below is a segment of DNA from a Eukaryotic cell which contains.pdf
Shown below is a segment of DNA from a Eukaryotic cell which contains.pdfAdrianj6tHamiltonn
6 vistas1 diapositiva
transcription and rna por
transcription and rna  transcription and rna
transcription and rna Dr-HAMDAN
58.5K vistas31 diapositivas
Week4-RNA and Protein Synthesis - Final Updated.pptx por
Week4-RNA and Protein Synthesis - Final Updated.pptxWeek4-RNA and Protein Synthesis - Final Updated.pptx
Week4-RNA and Protein Synthesis - Final Updated.pptxShammaAhmed7
14 vistas31 diapositivas
Transcription and Translation.pptx por
Transcription and Translation.pptxTranscription and Translation.pptx
Transcription and Translation.pptxMANJUSINGH948460
8 vistas46 diapositivas

Similar a RNA Codon Workshect Detennination of peptide chain sequence .pdf(20)

Transcriptionand translation por Amy Allen
Transcriptionand translationTranscriptionand translation
Transcriptionand translation
Amy Allen4.6K vistas
Shown below is a segment of DNA from a Eukaryotic cell which contains.pdf por Adrianj6tHamiltonn
Shown below is a segment of DNA from a Eukaryotic cell which contains.pdfShown below is a segment of DNA from a Eukaryotic cell which contains.pdf
Shown below is a segment of DNA from a Eukaryotic cell which contains.pdf
transcription and rna por Dr-HAMDAN
transcription and rna  transcription and rna
transcription and rna
Dr-HAMDAN58.5K vistas
Week4-RNA and Protein Synthesis - Final Updated.pptx por ShammaAhmed7
Week4-RNA and Protein Synthesis - Final Updated.pptxWeek4-RNA and Protein Synthesis - Final Updated.pptx
Week4-RNA and Protein Synthesis - Final Updated.pptx
ShammaAhmed714 vistas
12.3 DNA - RNA - Amino Acid - Protein por sbcvmi06
12.3 DNA - RNA - Amino Acid - Protein12.3 DNA - RNA - Amino Acid - Protein
12.3 DNA - RNA - Amino Acid - Protein
sbcvmi067.9K vistas
Dna translation and protein synthesis por sbarkanic
Dna translation and protein synthesisDna translation and protein synthesis
Dna translation and protein synthesis
sbarkanic366 vistas
Biology lecture 5 por Etugen
Biology lecture 5Biology lecture 5
Biology lecture 5
Etugen3.1K vistas
Unit B7 8 Protein Synthesis2 por sciencechris
Unit B7 8 Protein Synthesis2Unit B7 8 Protein Synthesis2
Unit B7 8 Protein Synthesis2
sciencechris1.5K vistas
I think I may be overthinking this one, can someone please help with.pdf por rupeshmehta151
I think I may be overthinking this one, can someone please help with.pdfI think I may be overthinking this one, can someone please help with.pdf
I think I may be overthinking this one, can someone please help with.pdf
rupeshmehta1512 vistas
Protein Synthesis por ncvpselise
Protein SynthesisProtein Synthesis
Protein Synthesis
ncvpselise1.5K vistas
Transcription and translation por Bethany Kent
Transcription and translation Transcription and translation
Transcription and translation
Bethany Kent80 vistas
IB Biology HL Transcription and Translation por Soumya N Sharma
IB Biology HL Transcription and TranslationIB Biology HL Transcription and Translation
IB Biology HL Transcription and Translation
Soumya N Sharma2.2K vistas
4th hour por syaheer77
4th hour4th hour
4th hour
syaheer77552 vistas
Different types of rna & translation por enamifat
Different types of rna & translationDifferent types of rna & translation
Different types of rna & translation
enamifat4.5K vistas

Más de adaacollections

Robert opened an RRSP deposit account on December 1 2008 w.pdf por
Robert opened an RRSP deposit account on December 1 2008 w.pdfRobert opened an RRSP deposit account on December 1 2008 w.pdf
Robert opened an RRSP deposit account on December 1 2008 w.pdfadaacollections
13 vistas1 diapositiva
riamiter 21A2b00B2b01c2b102611 lwa yo y Case i.pdf por
riamiter 21A2b00B2b01c2b102611 lwa yo y Case i.pdfriamiter 21A2b00B2b01c2b102611 lwa yo y Case i.pdf
riamiter 21A2b00B2b01c2b102611 lwa yo y Case i.pdfadaacollections
8 vistas1 diapositiva
Rod an industrial engineer manager with XYZ Corporation ha.pdf por
Rod an industrial engineer manager with XYZ Corporation ha.pdfRod an industrial engineer manager with XYZ Corporation ha.pdf
Rod an industrial engineer manager with XYZ Corporation ha.pdfadaacollections
2 vistas1 diapositiva
Robert opened an RRSP deposh acoount on December 12008 wi.pdf por
Robert opened an RRSP deposh acoount on December 12008  wi.pdfRobert opened an RRSP deposh acoount on December 12008  wi.pdf
Robert opened an RRSP deposh acoount on December 12008 wi.pdfadaacollections
2 vistas1 diapositiva
Robert Reiss Davas httpsdocsgooglecomfiled0B9rgPFly.pdf por
Robert Reiss Davas  httpsdocsgooglecomfiled0B9rgPFly.pdfRobert Reiss Davas  httpsdocsgooglecomfiled0B9rgPFly.pdf
Robert Reiss Davas httpsdocsgooglecomfiled0B9rgPFly.pdfadaacollections
2 vistas1 diapositiva
Revisin de gramticamecnica 14 Revisin total Las sigui.pdf por
Revisin de gramticamecnica 14 Revisin total  Las sigui.pdfRevisin de gramticamecnica 14 Revisin total  Las sigui.pdf
Revisin de gramticamecnica 14 Revisin total Las sigui.pdfadaacollections
2 vistas1 diapositiva

Más de adaacollections(20)

Robert opened an RRSP deposit account on December 1 2008 w.pdf por adaacollections
Robert opened an RRSP deposit account on December 1 2008 w.pdfRobert opened an RRSP deposit account on December 1 2008 w.pdf
Robert opened an RRSP deposit account on December 1 2008 w.pdf
adaacollections13 vistas
riamiter 21A2b00B2b01c2b102611 lwa yo y Case i.pdf por adaacollections
riamiter 21A2b00B2b01c2b102611 lwa yo y Case i.pdfriamiter 21A2b00B2b01c2b102611 lwa yo y Case i.pdf
riamiter 21A2b00B2b01c2b102611 lwa yo y Case i.pdf
adaacollections8 vistas
Rod an industrial engineer manager with XYZ Corporation ha.pdf por adaacollections
Rod an industrial engineer manager with XYZ Corporation ha.pdfRod an industrial engineer manager with XYZ Corporation ha.pdf
Rod an industrial engineer manager with XYZ Corporation ha.pdf
adaacollections2 vistas
Robert opened an RRSP deposh acoount on December 12008 wi.pdf por adaacollections
Robert opened an RRSP deposh acoount on December 12008  wi.pdfRobert opened an RRSP deposh acoount on December 12008  wi.pdf
Robert opened an RRSP deposh acoount on December 12008 wi.pdf
adaacollections2 vistas
Robert Reiss Davas httpsdocsgooglecomfiled0B9rgPFly.pdf por adaacollections
Robert Reiss Davas  httpsdocsgooglecomfiled0B9rgPFly.pdfRobert Reiss Davas  httpsdocsgooglecomfiled0B9rgPFly.pdf
Robert Reiss Davas httpsdocsgooglecomfiled0B9rgPFly.pdf
adaacollections2 vistas
Revisin de gramticamecnica 14 Revisin total Las sigui.pdf por adaacollections
Revisin de gramticamecnica 14 Revisin total  Las sigui.pdfRevisin de gramticamecnica 14 Revisin total  Las sigui.pdf
Revisin de gramticamecnica 14 Revisin total Las sigui.pdf
adaacollections2 vistas
Revise el Caso 91 Valle pacfico en la pgina 234235 de .pdf por adaacollections
Revise el Caso 91  Valle pacfico en la pgina 234235 de .pdfRevise el Caso 91  Valle pacfico en la pgina 234235 de .pdf
Revise el Caso 91 Valle pacfico en la pgina 234235 de .pdf
adaacollections2 vistas
Robben Manufacturing tiene los dos proyectos posibles siguie.pdf por adaacollections
Robben Manufacturing tiene los dos proyectos posibles siguie.pdfRobben Manufacturing tiene los dos proyectos posibles siguie.pdf
Robben Manufacturing tiene los dos proyectos posibles siguie.pdf
adaacollections2 vistas
RNA is different than DNA in that RNA is disposable and is d.pdf por adaacollections
RNA is different than DNA in that RNA is disposable and is d.pdfRNA is different than DNA in that RNA is disposable and is d.pdf
RNA is different than DNA in that RNA is disposable and is d.pdf
adaacollections2 vistas
rn iin dijital pazarlama programn yrtmek zere yeni bi.pdf por adaacollections
rn iin dijital pazarlama programn yrtmek zere yeni bi.pdfrn iin dijital pazarlama programn yrtmek zere yeni bi.pdf
rn iin dijital pazarlama programn yrtmek zere yeni bi.pdf
adaacollections3 vistas
River A at a certain date has a discharge of 1242 cfs and a .pdf por adaacollections
River A at a certain date has a discharge of 1242 cfs and a .pdfRiver A at a certain date has a discharge of 1242 cfs and a .pdf
River A at a certain date has a discharge of 1242 cfs and a .pdf
adaacollections2 vistas
Risk management plan Draft question 1 Description Compan.pdf por adaacollections
Risk management plan Draft question 1 Description Compan.pdfRisk management plan Draft question 1 Description Compan.pdf
Risk management plan Draft question 1 Description Compan.pdf
adaacollections6 vistas
Rise of the Killer Virus 2014 46m There may never be a vi.pdf por adaacollections
Rise of the Killer Virus 2014 46m There may never be a vi.pdfRise of the Killer Virus 2014 46m There may never be a vi.pdf
Rise of the Killer Virus 2014 46m There may never be a vi.pdf
adaacollections2 vistas
Revise las siguientes declaraciones de diagnstico y asigne .pdf por adaacollections
Revise las siguientes declaraciones de diagnstico y asigne .pdfRevise las siguientes declaraciones de diagnstico y asigne .pdf
Revise las siguientes declaraciones de diagnstico y asigne .pdf
adaacollections2 vistas
Revise las 11 leyes del pensamiento sistmico de Peter Senge.pdf por adaacollections
Revise las 11 leyes del pensamiento sistmico de Peter Senge.pdfRevise las 11 leyes del pensamiento sistmico de Peter Senge.pdf
Revise las 11 leyes del pensamiento sistmico de Peter Senge.pdf
adaacollections2 vistas
Review your states mandated reporter statute Provide detai.pdf por adaacollections
Review your states mandated reporter statute Provide detai.pdfReview your states mandated reporter statute Provide detai.pdf
Review your states mandated reporter statute Provide detai.pdf
adaacollections6 vistas
Review the information security policies of an educational e.pdf por adaacollections
Review the information security policies of an educational e.pdfReview the information security policies of an educational e.pdf
Review the information security policies of an educational e.pdf
adaacollections4 vistas
Review Questions 1 True of Falat An operating systain is.pdf por adaacollections
Review Questions 1 True of Falat An operating systain is.pdfReview Questions 1 True of Falat An operating systain is.pdf
Review Questions 1 True of Falat An operating systain is.pdf
adaacollections2 vistas
Resumir la estructura horizontal y vertical tpica de un fre.pdf por adaacollections
Resumir la estructura horizontal y vertical tpica de un fre.pdfResumir la estructura horizontal y vertical tpica de un fre.pdf
Resumir la estructura horizontal y vertical tpica de un fre.pdf
adaacollections2 vistas
Results from the Choi et al 2002 study on 401k automati.pdf por adaacollections
Results from the Choi et al 2002 study on 401k automati.pdfResults from the Choi et al 2002 study on 401k automati.pdf
Results from the Choi et al 2002 study on 401k automati.pdf
adaacollections2 vistas

Último

Psychology KS4 por
Psychology KS4Psychology KS4
Psychology KS4WestHatch
90 vistas4 diapositivas
Monthly Information Session for MV Asterix (November) por
Monthly Information Session for MV Asterix (November)Monthly Information Session for MV Asterix (November)
Monthly Information Session for MV Asterix (November)Esquimalt MFRC
58 vistas26 diapositivas
Ch. 7 Political Participation and Elections.pptx por
Ch. 7 Political Participation and Elections.pptxCh. 7 Political Participation and Elections.pptx
Ch. 7 Political Participation and Elections.pptxRommel Regala
105 vistas11 diapositivas
Create a Structure in VBNet.pptx por
Create a Structure in VBNet.pptxCreate a Structure in VBNet.pptx
Create a Structure in VBNet.pptxBreach_P
75 vistas8 diapositivas
Jibachha publishing Textbook.docx por
Jibachha publishing Textbook.docxJibachha publishing Textbook.docx
Jibachha publishing Textbook.docxDrJibachhaSahVetphys
47 vistas14 diapositivas
Pharmaceutical Inorganic chemistry UNIT-V Radiopharmaceutical.pptx por
Pharmaceutical Inorganic chemistry UNIT-V Radiopharmaceutical.pptxPharmaceutical Inorganic chemistry UNIT-V Radiopharmaceutical.pptx
Pharmaceutical Inorganic chemistry UNIT-V Radiopharmaceutical.pptxMs. Pooja Bhandare
93 vistas51 diapositivas

Último(20)

Psychology KS4 por WestHatch
Psychology KS4Psychology KS4
Psychology KS4
WestHatch90 vistas
Monthly Information Session for MV Asterix (November) por Esquimalt MFRC
Monthly Information Session for MV Asterix (November)Monthly Information Session for MV Asterix (November)
Monthly Information Session for MV Asterix (November)
Esquimalt MFRC58 vistas
Ch. 7 Political Participation and Elections.pptx por Rommel Regala
Ch. 7 Political Participation and Elections.pptxCh. 7 Political Participation and Elections.pptx
Ch. 7 Political Participation and Elections.pptx
Rommel Regala105 vistas
Create a Structure in VBNet.pptx por Breach_P
Create a Structure in VBNet.pptxCreate a Structure in VBNet.pptx
Create a Structure in VBNet.pptx
Breach_P75 vistas
Pharmaceutical Inorganic chemistry UNIT-V Radiopharmaceutical.pptx por Ms. Pooja Bhandare
Pharmaceutical Inorganic chemistry UNIT-V Radiopharmaceutical.pptxPharmaceutical Inorganic chemistry UNIT-V Radiopharmaceutical.pptx
Pharmaceutical Inorganic chemistry UNIT-V Radiopharmaceutical.pptx
Ms. Pooja Bhandare93 vistas
Classification of crude drugs.pptx por GayatriPatra14
Classification of crude drugs.pptxClassification of crude drugs.pptx
Classification of crude drugs.pptx
GayatriPatra1492 vistas
REPRESENTATION - GAUNTLET.pptx por iammrhaywood
REPRESENTATION - GAUNTLET.pptxREPRESENTATION - GAUNTLET.pptx
REPRESENTATION - GAUNTLET.pptx
iammrhaywood107 vistas
The Accursed House by Émile Gaboriau por DivyaSheta
The Accursed House  by Émile GaboriauThe Accursed House  by Émile Gaboriau
The Accursed House by Émile Gaboriau
DivyaSheta212 vistas
Psychology KS5 por WestHatch
Psychology KS5Psychology KS5
Psychology KS5
WestHatch103 vistas
How to empty an One2many field in Odoo por Celine George
How to empty an One2many field in OdooHow to empty an One2many field in Odoo
How to empty an One2many field in Odoo
Celine George72 vistas
The basics - information, data, technology and systems.pdf por JonathanCovena1
The basics - information, data, technology and systems.pdfThe basics - information, data, technology and systems.pdf
The basics - information, data, technology and systems.pdf
JonathanCovena1126 vistas
When Sex Gets Complicated: Porn, Affairs, & Cybersex por Marlene Maheu
When Sex Gets Complicated: Porn, Affairs, & CybersexWhen Sex Gets Complicated: Porn, Affairs, & Cybersex
When Sex Gets Complicated: Porn, Affairs, & Cybersex
Marlene Maheu73 vistas
On Killing a Tree.pptx por AncyTEnglish
On Killing a Tree.pptxOn Killing a Tree.pptx
On Killing a Tree.pptx
AncyTEnglish66 vistas
CUNY IT Picciano.pptx por apicciano
CUNY IT Picciano.pptxCUNY IT Picciano.pptx
CUNY IT Picciano.pptx
apicciano54 vistas

RNA Codon Workshect Detennination of peptide chain sequence .pdf

  • 1. RNA Codon Workshect Detennination of peptide chain sequence from m-RNA codon Wheel. The "Wheel" shows you how to detemine which amino acid goes with which m-RNA three letter "codon". To decode a codon start at the middle of the circle and move outward. 1. Identify the amino acids that would be attached to a peptide chain from the following m-RNA sequence. You may use the three letter abbreviations, a. AAC c. UCU b. GAU d. CCC 2. What would the codon sequence(s) be for: a. Leucine b. Valine e. Serine 3. What are the mRNA stop codons? 4. What is the mRNA start codon and wlsat amino acid does it code for? 5. Suppose the DNA sequence TACGCTATATCG was changed to TACGCGATATCG? How would the products of transcription and translation be affected? DNA IRNA sequence Amino acid sequence TACGCTATATCG a a TACGCGATATCG al a 6. First transeribe the following DNA segment into mRNA, then translate the mRNA to a peptide chain. (While translation would be continuous for the whole length of the DNA, transeription would only begin when the RNA transcriptase attached at a start codon.)