Numbers 1 and 2 answer with detailed explanations, please 1. A numbe.pdf

•

0 likes•2 views

This document contains questions about different types of RNA and their roles in transcription and translation. It asks the reader to fill in blanks for nucleotide sequences of mRNA and tRNA based on a given DNA template strand, and write out the corresponding amino acid sequence using the genetic code table. There were enough blanks provided to fully write out the mRNA, tRNA, and amino acid sequences based on the given DNA non-template strand.

Education

Numbers 1 and 2 answer with detailed explanations, please 1. A number of different types of
RNA exist in prokaryotic and eukaryotic cells. Answer the questions about the following types
of RNA to complete the table below. 2a. Given your understanding of transcription and
translation, fill in the blanks below for each nucleotide and polypeptide sequence. Assume that
translation requires a start codon and that there is no processing of the pre-mRNA before
translation. Remember to mark which end is 5 and which is 3 for each answer and when done
write out the sequence of amino acids below. Non-template strand of DNA 5C A G T A T G T A
T G A C A A T G C A 3' Template strand of DNA: G mRNA: C tRNA: Sequence of Amino
Acids (you can refer to the codon table found in this document): 2b. Were there enough blanks
for all the tRNAs and amino acids? Were there too many blanks?

Similar to Numbers 1 and 2 answer with detailed explanations, please 1. A numbe.pdf

AP Bio Ch 17 part 1 translation

Stephanie Beck

BI 101 Week 5 Homework

AbrahamNolitos

Hw1 Gen320fall07revised

ariddlegirl

Transcription

enamifat

Central Dogma Assignment Print Name ___________________________________________ Directions: Complete this worksheet after listening to the Central Dogma recorded lecture posted on Blackboard. Each student will turn in his/her individual worksheet at the beginning of class. COMPLETE THE TABLE. LABEL YOUR 5’ AND 3’ ENDS. YOU MUST GET THE ENTIRE TABLE CORRECT FOR CREDIT. NO PARTIAL CREDIT. DNA template (-) 5’ GTACTATTAATT TACTGGGTGCAT CCGCATGGTACG 3’ DNA coding (+) strand mRNA (+) codons Only write the tRNA anticodons for actual codons coding for amino acids amino acid sequence 1. You isolate and sequence a novel cytoplasmic membrane protein from Staphylococcus aureus that appears to function in the transport of cations into the cell. A colleague working in a competing lab in France isolates a cytoplasmic membrane protein from Streptococcus pyogenes that appears to have the identical function as your protein. In fact, the primary structure of the S. pyogenes protein is identical to the S. aureus protein. Does this mean that the genes for these two proteins are identical in Staphylococcus aureus and Streptococcus pyogenes? Explain your answer. 2. What is the effect of DNA mutation on protein sequence? 3. In sickle-cell disease, the replacement of A by T at the 17th nucleotide of the gene for the beta chain of hemoglobin changes the mRNA codon as shown below (in red). Wild-type mRNA 5’… A C U C C U G A G G A G… Sickle-cell mRNA 5’… A C U C C U G U G G A G…. a. What amino acids are encoded by the two mRNAs? Wild-type amino acids: Sickle-cell amino acids: b. What kind of mutation does this cause in the protein? Bio 241 Quiz #3 March 22, 2018 Print First and Last Name _______________________________________ I. Multiple Choice: Read each question carefully and select the one best answer for each question. Write your answer using CAPITAL LETTERS on the line in front of each question. Questions will be counted wrong if the answer is not written on the line. (1 point each) _____1. Which of the following is incorrect? A. RNA polymerase – makes a molecule of RNA from an RNA template B. DNA polymerase – makes a molecule of DNA from a DNA template C. DNA ligase – joins segments of DNA D. DNA gyrase (topoisomerase) – releases overwinding strain and untwists DNA E. All of the above are correct. _____2. A nucleotide is A. a five-carbon sugar, a phosphate group and a nitrogen-containing base B. a sugar with an attached base containing nitrogen C. a six-carbon sugar, a phosphate group and a nitrogen-containing base D. a nitrogen-containing base with an attached five-carbon sugar E. A is correct for DNA and C is correct for RNA _____3. In DNA synthesis, the primer is synthesized by A. RNA polymerase B. DNA polymerase I C. DNA polymerase III D. Helicase E. DNA gyrase ...

Central Dogma Assignment Print Name ________________.docx

cravennichole326

IB Biology HL Transcription and Translation

Soumya N Sharma

Gene Expression_AA1.ppt

midolyon1990gmailcom

Transcriptionand translation

Amy Allen

AP Biology Ch. 14 part 2 Translation

Stephanie Beck

Central dogma

neizylah

Lab 15: DNA Model Discovery Kit Answer sheet (For use with DNA Model Kit with instructions based on those by KD Blographics) DNA and RNA - Compounds and Structure: DNA the genetic material found in the nucleus of eukaryotic cells, is a very complex molocule formed using six compounds, PHOSPHATE, a SUGAR (deoxyribose), and four BASES (adenine, guanine, cylosine, and trymine), Lkewise, the complex RNA molecule found in cells is formed using six compounds, PHOSPHATE, a SUGAR (ribose), and four BASES (adenine, guanine, cytosine, and uracil). Foliow the instructions found with the DNA puzzie kit to categorize puzzfe pieces, and ibontify the specific compound name for each puzzle piece labeled 1 - 8 . You will not be able to fill out the entire chart at once, but list the name of each pioce when you can identily it and whether it is found in DNA, RNA, or BOTH. a. Write the inltial of the bases in the order found in your DNA ladder, below. DNA iop strand: C G A A I G A S Q. Briefly describe the pairing of bases in the "rungs" of your DNA ladder. Is there a pattern to the base pairing (use base names), and is there a pattern to the base types (purines and pyrimldines) found in the pairs? Why do you think they pair up in this manner? Kes) Guantie and Cu Mosine, Adiec and Thamire. DNA REPLICATION: Before cells car divide inso new cells, they must make components for the new cels. Duplicating DNA called DNA replication, is part of thil process. Foliow DNA wit instructions to make new DNA using the original double strand, then answer the following. Q. Describe the role hydrogen bonding plays in the process of replication, and the compesition of the resulting DNA strands including whether or not they are identical using key words like "original" and "eopy". Higlvogen ponding heivs to kec an ins shuchere of plda stroid TRANSCRIPTION - DNA to RNA: Although DNA carries the code to make proteins, it cannot leave the nucleus and travel to the ribosomes where protein synthesis occurs. Something else must take the message. Follow the instructions with your DNA kit to explore transcription, and then answer the questions, below. Describe the base sequence of the mRNA you have formed showing which bases pair up with the bases of the oriainal DNA. Briefly describe how the results of transcription differ from the process of DNA replication. Tronsciption differs from DNp repicatiop, making RNA COpy TRANSLATION - RNA to PROTEINS: The genetic code is carried in linear sequence of bases. A protein is made of a linear sequence of amino acids. The languages are different, but if translated, the codes are the same. Follow the instructions in your DNA kit to study translation. When you've completed the puzzle activity, fill in the answers, below. Fill in each three bese sequence in the mRNA and the tRNA that you used in this lab activily. Look at the table of amino acids on the last page. Each column represents the base sequences from DNA. mRNA and TRNA that transiate to an .

Lab 15- DNA Model Discovery Kit Answer sheet (For use with DNA Model K.pdf

PeterM9sWhitej

translation.ppsx

SudhaKavitha1

Central Dogma of Molecular Biology-for LIVE Teaching.pptx

RowelVeridianoEngres

Transcription

Rinaldo John

The coding region of a BACTERIAL gene has the following sequence: \"AGAGCCAACATGTCGAGCATATGCTGATATACG\' Draw and label the DNA (including ALLEABIS of the gene, sequence information) The info you need is in the sides. Label the template/coding strands Label 5\' and 3\' ends of each DNA strand Label where RNA polymerase binds \"Transcribe\" this gene into mRNA, as shown in Bb video. Write the mRNA nucleotide sequence, starting at the correct nucleotide, starting at the correct nucleotide Show the 5\' and 3\' ends of the RNA. Use the codon chart to \"translate\" the mRNA into a protein, and write the correct amino acid sequence of the protein. Only translate the part of the gene that a cell would translate. Label the N-terminus and C-terminus of the protein. If the sequence of the gene were changed to: AGACCCAACATGTCGGACATATGCTGATATACG what would happen to the properties of the protein? Explain why write out the entire process of bacterial transcription step by step in the correct order, in detail. Solution 4. Process of Bacterial Transcription: Bacterial transcription is the process in which mRNA transcripts of genetic material in bacteria are produced; it is further translated to produce proteins. Unlike in eukaryotes, bacterial transcription and translation can occur simultaneously in the cytoplasm. RNA polymerases are enzymes that transcribe DNA into RNA. Using a DNA template, RNA polymerase builds a new RNA molecule through base pairing. For instance, if there is a G in the DNA template, RNA polymerase will add a C to the new, growing RNA strand. Three steps are involved in bacterial transcription: Initiation: To begin transcribing a gene, RNA polymerase binds to the DNA of the gene at a region called the promoter. Basically, the promoter tells the polymerase where to locate on the DNA and begin transcribing. Elongation: Once RNA polymerase is in position at the promoter, the next step of transcription—elongation—can begin. Basically, elongation is the stage when the RNA strand gets longer, thanks to the addition of new nucleotides. During elongation, RNA polymerase \"walks\" along one strand of DNA, known as the template strand, in the 3\' to 5\' direction. For each nucleotide in the template, RNA polymerase adds a matching (complementary) RNA nucleotide to the 3\' end of the RNA strand. Termination: RNA polymerase will keep transcribing until it gets signals to stop. The process of ending transcription is called termination, and it happens once the polymerase transcribes a sequence of DNA known as a terminator. There are two major termination strategies found in bacteria: Rho-dependent and Rho- independent. In Rho-dependent termination, the RNA contains a binding site for a protein called Rho factor. Rho factor binds to this sequence and starts \"climbing\" up the transcript towards RNA polymerase. When it catches up with the polymerase at the transcription bubble, Rho pulls the RNA transcript and the template DNA strand apart, releasing .

The coding region of a BACTERIAL gene has the following sequence A.pdf

mckenziecast21211

Complete all three parts and answer all questions. Download Graphic Organizer for answering all questions and genetics exercises in this assignment. Part I: Genetics – From Genes to Proteins, Mutations Background: DNA represents the architectural blueprint for all living systems, encoding specific instructions in the sequence of its four nitrogen-containing base pairs that are necessary for building the organism. During the process of transcription, the information in the DNA codons of a gene is transcribed into RNA. A change in the DNA sequence, for example as a result of a "mistake" during DNA replication, is defined as a mutation. Mutations may result in a change in the "blueprint," which may then change the resulting protein product. Assignment details for part one: Transcribe and translate EACH of the three following DNA gene sequences. Turn these in using the graphic organizer. The letters represent the DNA N-base sequences of the genes. The first is the original gene. The next two are mutations of the original. Note that the changes (mutations) are shown in red. Original Gene sequence 3'-T A C C C T T T A G T A G C C A C T-5 Mutated gene sequence 1 3’-T A C G C T T T A G T A G C C A T T-5' Mutated gene sequence 2 3’-T A A C C T T T A C T A G G C A C T-5’ Also, answer the following questions: What is the significance of the first and last codons of an mRNA transcript? What meaning do these mRNA codons have for protein synthesis? Did the mutations result in a change in the final proteins? If so, describe the change. In general, why might a change in amino acid sequence affect protein function? Part II: Inheritance of Traits or Genetic Disorders Background : Cystic fibrosis is an inherited disease that affects the respiratory, digestive, or reproductive systems of the body, with symptoms ranging from mild to severe. Bob and Sally are recently married. Upon deciding to plan a family, both Sally and Bob find out that they are both heterozygous for cystic fibrosis , but neither of them has symptoms of the disorder. Assignment details: Complete a Punnett Square for cystic fibrosis for this couple using the following alleles: C = normal allele ; and c = allele for cystic fibrosis . Complete the Punnett Square in the graphic organizer. Also answer the following questions: Based on the Punnett square, calculate chances (percentages) for the following: for having a healthy child (not a carrier) a child that is a carrier for the cystic fibrosis trait a child with cystic fibrosis Be sure to submit these percentages as part of your assignment in the Graphic Organizer. Part III: Cell division, sexual reproduction and genetic variability Background : Eukaryotic cells can divide by mitosis or meiosis. In humans, mitosis produces new cells for growth and repair; meiosis produces sex cells (gametes) called sperm and eggs. Although mutations are the ultimate source of genetic variability, both meiosis and sexual reprod.

Complete all three parts and answer all questions.Download Graph.docx

luellaj

Chapter 10

guest67f2eb

TRANSCRIPTION/TRANSLATION 2015

Dobbs Ferry High School

transcription and rna

Dr-HAMDAN

Gene expresion transcription.pdf

Mohamed Alashram

More from aliracreations

One unit of A is made of three units of B, one unit of C, and two un.pdf

aliracreations

One of the methods that astronomer use to detect the presence of pla.pdf

aliracreations

One of the important uses of portfolio management tools isa. to .pdf

aliracreations

One common result of phospholipid signaling pathways downstream of G-protein activation is a phenomenon by which waves and oscillations of calcium ions can be produced that sweep across a cell. The statements below are characteristic of these calcium ion waves EXCEPT: A. They are much slower than diffusion of calcium ions through the cytoplasm. B. They maintain the same strength (i.e., calcium ion concentration peaks) throughout the wave. C. They move in a directional pattern due to both positive and negative feedback mechanisms. D. They occur due to opening and closing of phospholipid-gated ion channels in the ER membrane. E. They can be compared to how an action potential will travel along the membrane of an axon..

One common result of phospholipid signaling pathways downstream of G.pdf

aliracreations

Once you have completed your Exploratory research you have decided t.pdf

aliracreations

Once you have your list, respond to the following: List the current events you selected in Weeks 14. Write a one-sentence summary of each current event. Week 1- This week's current event is about water policy and environmental health. The article discusses the EPA's recent approval of chromium-6 in drinking water. Week 2- The topic of the article is the overfishing and climate change-related decline in the North Sea fish population. Week 3- The article focuses on the significant rise in sea level and its causes. Week 4- world has failed to meet any of the biodiversity targets set for 2020 is the current event that I have chosen to highlight the urgent need for action to protect the planet's ecosystems. Discuss the scientific accuracy of the statements within the selected current event articles and how they might impact public environmental science literacy. Be specific and explain your thinking. How has searching for and synthesizing these current event articles impacted the way you think about your role as environmental scientist? Explain your thinking. How has your awareness of processes and practices that enable organizations to reduce environmental impacts influenced your thinking on how to manage the current events?.

Once you have your list, respond to the followingList the current.pdf

aliracreations

One day, Alex got tired of climbing in a gym and decided to take a very large group of climber friends outside to climb. The climbing area where they went, had a huge wide boulder, not very tall, with various marked hand and foot holds. Alex quickly determined an allowed set of moves that her group of friends can perform to get from one hold to another. The overall system of holds can be described by a rooted tree T with n vertices, where each vertex corresponds to a hold and each edge corresponds to an allowed move between holds. The climbing paths converge as they go up the boulder, leading to a unique hold at the summit, represented by the root of T. Alex and her friends (who are all excellent climbers) decided to play a game, where as many climbers as possible are simultaneously on the boulder and each climber needs to perform a sequence of exactly k moves. Each climber can choose an arbitrary hold to start from, and all moves must move away from the ground. Thus, each climber traces out a path of k edges in the tree T, all directed toward the root. However, no two climbers are allowed to touch the same hold; the paths followed by different climbers cannot intersect at all. Describe and analyze an efficient dynamic programming algorithm to compute the maximum number of climbers that can play this game. State and prove the recurrence relation and also give the bottom-up implementation..

One day, Alex got tired of climbing in a gym and decided to take a v.pdf

aliracreations

On November 1, 2021 a company sign a $200,000.12 percent six-month n.pdf

aliracreations

On January 1, Year 2, Kincaid Company's Accounts Receivable and the Allowance for Doubtful Accounts carried balances of $73,200 and $3,400, respectively. During the year, Kincaid reported $201,000 of credit sales. Kincaid also wrote off $1,900 of receivables as uncollectible in Year 2. Cash collections of receivables amounted to $246,700. Kincaid estimates that it will be unable to collect one percent (1%) of credit sales. Kincaid's entry required to recognize the uncollectible accounts expense for Year 2 will.

On January 1, Year 2, Kincaid Companys Accounts Receivable and the .pdf

aliracreations

On January 1, 2021, Daniel Corp. acquired 80% of the voting common stock of Phillips Inc. During the year, Daniel sold to Phillips for $315,000 goods that cost $210,000. At year-end, Phillips owned 30% of the goods transferred. Phillips reported net income of $305,000, and Daniels net income was $986,000. Daniel decided to use the equity method to account for this investment. What amount of intra-entity gross profit would be deferred in 2021?.

On January 1, 2021, Daniel Corp. acquired 80 of the voting common s.pdf

aliracreations

On December 31, Year 3, Mueller Corp. acquired 80% of the outstanding shares of Wilson Inc. for a total cost of $274,000. The carrying amount of Wilsons assets, liabilities, and equity was equal to fair value except for the following: Carrying Amount Fair Value Inventory $ 61,500 $ 71,000 Equipment, net 285,000 291,000 Patent 43,000 Long-term debt 195,000 163,000 Common shares 190,000 ? Retained earnings 45,000 ?.

On December 31, Year 3, Mueller Corp. acquired 80 of the outstandin.pdf

aliracreations

No plagiarism. At least 250 wordsWhat is the relationship be.pdf

aliracreations

On August 1, 2024, Trico Technologies, an aeronautic electronics company, borrows $21 million cash to expand operations. The loan is made by FirstBanc Corporation under a short-term line of credit arrangement. Trico signs a six-month, 9% promissory note. Interest is payable at maturity. Tricos year-end is December 31. Required: 1. to 3. Record the necessary entries in the Journal Entry Worksheet below for Trico Technologies. (If no entry is required for a particular transaction/event, select "No Journal.

On August 1, 2024, Trico Technologies, an aeronautic electronics com.pdf

aliracreations

On April 1, Mathis purchased merchandise on account from Reece with credit terms of 2/10, n/30. The selling price of the merchandise was $3,600, and the cost of the merchandise sold was $2,450. On April 1, Mathis paid freight charges of $100 cash to have the goods delivered to its warehouse. On April 8, Mathis returned $1,000 of the merchandise, which had originally cost Reece $700. On April 10, Mathis paid Reece the balance due..

On April 1, Mathis purchased merchandise on account from Reece with .pdf

aliracreations

On 1 January 2021, Alpha Ltd sold inventory to Beta Ltd for $90 000..pdf

aliracreations

New York State, county, city, school district, and other government employees in New York State have the option to participate in the pension system, New York State & Local Retirement System (NYSLRS) a. What are the financial reporting requirements related to the amount that these government entities must meet? b. What account type do you think is used to manage the employees matching contributions while they are in the employers control, before they are moved to the state pension fund?.

New York State, county, city, school district, and other government .pdf

aliracreations

Objective: The purpose of this exercise is to create a Linked List data structure that mimics the behavior of the Java Standard Library Version (Java API). The outcomes/results of using the library features should be identical with your own version (My API). However, the underlying implementation should follow with the descriptions listed below. Instructions : Create the following Linked List Data Structure with the given description below in your utils package and use "for loops" for your repetitive tasks. Where to find starter code in my-api package.class : utils.LinkedList package.class : tests.console.week04.LinkedListTest Where to find your JUNIT test in my-api package.class : tests.junit.LinkedListJUnitTest Nested Class that has to be added to LinkedList class package.class : utils.LinkedList.Node Task Check List ONLY "for" loops should be used within the data structure class. There is an automatic 30% deduction, if other loops are used. The names of identifiers MUST match the names listed in the description below. Deductions otherwise. Complete coding Assignment in your "my-api" GitHub Repository. You will not be graded otherwise and will receive a 0, if not uploaded there. Run JUNIT TEST and take a SNAPSHOT of results. Upload PDF of snapshot of your JUnitTest results to Canvas. Description The internal structure of the Linked List is a doubly linked Node data structure and should have at a minimum the following specifications: data fields: The data fields to declare are private and you will keep track of the size of the list with the variable size and the start of the list with the reference variable data. first is a reference variable for the first Node in the list. last is a reference variable for the last Node in the list. size keeps track of the number of nodes in the list of type int. This will allow you to know the current size of the list without having to traversing the list. constructors: The overloaded constructors will initialize the data fields size and data. A constructor that is a default constructor initializes the starting node location first and size to a zero equivalent, that is, constructs an empty list. methods: methods that manages the behavior of the linked nodes. Together, the methods below give the illusion of a index or countable location. Implement these methods within your generic Linked List class. Method Description Header public boolean add(E item) public void add(int index, E item) public void append( E item) private void checkIndex(int index) public boolean contains(E item) public void clear() private E detach(int index) public E get(int index) public int indexOf(E item) private void insertBefore(int index, E item) public boolean isEmpty() private Node node(int index) public E remove(int index) public boolean remove(E item) public E set(int index, E item) public int size() public String toString() Node Data Structure The generic Linked List class includes a static Node class as a nested class, i.e. a st.

Objective The purpose of this exercise is to create a Linked List d.pdf

aliracreations

nsan davranlar �almasnda, �rg�tsel liderler insanlarn deerleri, tutu.pdf

aliracreations

nsan adaptasyonu genetik, geliimsel, iklimlendirme ve kltrel olmak zere drt dzeyde gerekleir. T/F Scak bir ortamda bulunan bir kiinin yznn kzarmas vazokonstriksiyonun bir sonucudur. T/F Bir rkn her birinde ve baka bir rkn hi birinde bulunmayan genetik belirteler yoktur. T/F Modl balantlarna gre burun ekli, kafa boyutu ve ten rengi yakndan ilikili zelliklerdir. T/F nsanlar, kltrel evre de dahil olmak zere genlerden ve evreden etkilenmitir. T/F.

nsan adaptasyonu genetik, geliimsel, iklimlendirme ve k�lt�rel olmak.pdf

aliracreations

Nurse is performing a vaginal exan on a patient who is in labor and observes the umbilical cord protruding from the vaginal. After calling for assistance, which actions should the nurse take? -Insert two gloved fingers into the vaginal and apply upward pressure to the presenting part. -Wrap the visible cord tightly with sterile, dry gauze. -Apply oxygen to the client at 2 L/min via nasal cannula. -Place the client in the lithotomy position and apply fundal pressure..

Nurse is performing a vaginal exan on a patient who is in labor .pdf

aliracreations

More from aliracreations (20)