Recommended
Recommended
More Related Content
What's hot
What's hot (20)
Viewers also liked
Viewers also liked (20)
Similar to Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas
Similar to Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas (20)
Recently uploaded
Recently uploaded (20)
Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas
- 1. Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas A. Mathelier, C. Lefebvre, A.W. Zhang, D.J. Arenilas, J. Ding, W.W. Wasserman, and S.P. Shah Genome Biology, 2015, 16:84 2015 June 8th anthony.mathelier@gmail.com @AMathelier 1
- 2. A cancer gene discovery gap M.S. Lawrence et al., Nature, 2013. Highly mutated cancer genes revealed through The Cancer Genome Atlas project. Still a discovery gap in the search of new cancer genes. We assert this gap can be partially filled through the analysis of the non-coding genome. 2
- 3. Cis-regulatory mutations may impact gene expression Variation TF ..GATCC.. ..GAACC.. TF TFBS adapted from W. Shi’s figure 3
- 4. Cis-regulatory mutations may impact gene expression Variation TF ..GATCC.. ..GAACC.. TF TFBS adapted from W. Shi’s figure One needs to accurately locate TFBSs to identify and characterize the regulatory sequences controlling specific genes transcription. 3
- 5. Predicting cis-regulatory elements genome wide ...gctaaGTAACAATgcgca... ...cttaaGTAAACATcgctc... ...ccaatGTAAACAAacgga... MANTA Adapted from Szalkowski and Schmid. Briefings in Bioinfomatics, 2010 Mathelier et al., Nucleic Acids Research, 2014. 4
- 6. TFBSs defined as cis-regulatory elements 477 ChIP-seq data from ENCODE and literature 103 TFs with a JASPAR2014 TF binding profiles 76,160,599bp in TFBSs predicted in ChIP-seq peaks (∼2% of the human genome) 5
- 7. Somatic cis-regulatory mutations in B-cell lymphomas Whole genome sequence for 84 B-cell lymphoma patient samples with matched control samples : cohort 1 : 40 diffuse large B-cell lymphomas (DLBCL) cohort 2 : 44 of mixed histology – 14 Burkitt lymphomas, 15 DLBCLs, 1 primary mediastinal B-cell lymphoma (PMBCL), and 14 follicular lymphomas (FL) 406,611 SNVs and 15,739 indels in samples from cohort 1 282,636 SNVs and 8,080 indels in samples from cohort 2 RNA-seq for the cancer samples Richter et al., Nat. Genetics, 2012 ; Morin et al., Blood, 2013 6
- 8. Promoters are frequent targets of cis-regulatory mutations A BCohort1 Cohort2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 x y HIST1H1B ST6GAL1 TMSB4X ZFP36L1 NEDD9 BCL7A RHOH BIRC3 CIITA IG LL5 BTG2 SG K1 CD74 BCL2 BCL6 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 x y HIST1H1C HIST1H1E TMSB4X ZFP36L1 BCL2L11 BZRAP1 DNM T1 ZNF860 N CO A3 FOXO1 BACH2 CXCR4 DUSP2 RFTN1 TCL1A BCL7A SOCS1 SEPT9 P2RX5 S1PR2 RHOH EPS15 BIRC3 CIITA DTX1 IG LL5 BTG2 BTG1 SG K1 CD74 CD83 BCL2 BCL6 PIM1 MYC B2M IRF1 IRF4 LTB ID3 p = 1.16 x 10-75 p = 3.28 x 10-156 7
- 9. Promoters are frequent targets of cis-regulatory mutations A BCohort1 Cohort2 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 x y HIST1H1B ST6GAL1 TMSB4X ZFP36L1 NEDD9 BCL7A RHOH BIRC3 CIITA IG LL5 BTG2 SG K1 CD74 BCL2 BCL6 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 x y HIST1H1C HIST1H1E TMSB4X ZFP36L1 BCL2L11 BZRAP1 DNM T1 ZNF860 N CO A3 FOXO1 BACH2 CXCR4 DUSP2 RFTN1 TCL1A BCL7A SOCS1 SEPT9 P2RX5 S1PR2 RHOH EPS15 BIRC3 CIITA DTX1 IG LL5 BTG2 BTG1 SG K1 CD74 CD83 BCL2 BCL6 PIM1 MYC B2M IRF1 IRF4 LTB ID3 p = 1.16 x 10-75 p = 3.28 x 10-156 12 genes targeted in both cohorts independently Additional 13 genes from combined cohorts not previously described as hypermutated −→ 6 of them exclusively mutated in their promoters 7
- 10. Promoters of apoptic, B-cell, and cancer pathway genes are frequent targets of cis-regulatory mutations Cohort1 lymphoma small cell lung cancer apoptosis in apoptotic signaling role of mitochondria hiv-1 nef: negative effector of fas and tnf keratinocyte differentiation ceramide signaling pathway regulation of B cell proliferation positive regulation of B cell proliferation lymphocyte differentiationnegative regulation of lymphocyte apoptotic process leukocyte activation negative regulation of B cell apoptotic process regulation of B cell activation leukocyte differentiation positive regulation of lymphocyte proliferation regulation of cell growth lymphocyte activation T cell differentiation positive regulation of B cell activation negative regulation of intracellular signal transduction positive regulation of leukocyte proliferation regulation of type 2 immune response regulation of B cell apoptotic process negative regulation of T cell differentiation positive regulation of mononuclear cell proliferation GO Biological Process OMIM KEGG Pathway BioCarta FDR < 0.05 8
- 11. Landscape of mutations and altered gene expression mutation TFBS Protein-coding exon TSS A B C xseq input Ding et al., submitted. 9
- 12. Landscape of mutations and altered gene expression mutation TFBS Protein-coding exon TSS A B C xseq input PC and disrupting TFBS Protein coding (PC) PC and TFBS Disrupting TFBS TFBS MYC EYS TP53 PTPRD SMARCA4 BCL6 RYR2 ITPKB WWC1 FCGBP SGK1 TBL1XR1 ID3 CSMD3 SIN3A VPS13C UNC5D NBAS MTOR PPP1R16B USP25 ASCC3 GPHN DHX35 PEX2 XRCC4 PXDN JRKL WHSC1L1 FBXW11 SRP72 CRIM1 FOXO1 DGKD PHIP PYGL USP15 BRD2 C2CD3 LMO4 FMN2 SRFBP1 N4BP2 CCNG1 RHOA DUSP2 TGFBR2 ARRDC3 CADPS2 PIM1 STIM2 GNA13 SA321012 SA320920 SA320824 SA320932 SA321004 SA320860 SA320992 SA320830 SA321030 SA320914 SA320842 SA320818 SA320980 SA320998 SA320848 SA320866 SA321106 SA320872 SA321119 SA320968 SA320962 SA320944 SA321050 SA321048 SA320956 SA321021 SA321103 SA320836 SA320902 SA321128 SA320974 0 2 4 6 8 10 12 0 5 10 15 20 Cohort2 9
- 13. Predicted genes and their deregulated interactors are enriched for pathways related to cancer Cohort2 phosphatidylinositol signaling system chronic myeloid leukemia gliomahuntingtons disease focal adhesion pancreatic cancer small cell lung cancer endometrial cancer non small cell lung cancer colorectal cancer cell cycle prostate cancer calcium signaling pathway inositol phosphate metabolism erbb signaling pathway mapk signaling pathway vegf signaling pathway long term potentiation fc epsilon ri signaling pathway gnrh signaling pathway Cohort1 chronic myeloid leukemia erbb signaling pathway acute myeloid leukemia pancreatic cancer prostate cancer endometrial cancer glioma ecm receptor interaction focal adhesion epithelial cell signaling in helicobacter pylori infection renal cell carcinoma small cell lung cancer oxidative phosphorylation colorectal cancer WikiPathways FDR < 0.05 10
- 14. Cis-regulatory mutation and associated gene with altered expression Scoredifference −202468bits 1 2 1 2 3 4 5 6 7 8 9 10 11 ATATCTGTGGATTGATAAGAGTCAGAATCAC ATATCTGTGGATTGATACGAGTCAGAATCAC ref. alt. GATA3 Reference Alternative GNA13 Expression Density 0 50 100 150 200 250 0.0000.0020.0040.006 Expression in sample harbouring mutation SOS1 F2RL3 CTNNA1ARHGEF2 AGTR1 ARHGAP4 ADRA1D PLEKHG5 ARHGEF1 RASGRF2 TBXA2R FGD1 ESR1 PIK3CA ECT2 PIK3R2 SOS2 GNG2 ARHGEF6 TIAM1 RAC2 PIK3R1 VAV1 GNA13 ARHGEF18 ARHGEF9 RGS22 RHOB CTNNB1 S1PR4 11
- 15. Summary We analyzed ∼ 700, 000 somatic mutations from 84 B-cell lymphoma samples We characterized a set of cis-regulatory elements from ChIP-seq Cis-regulatory mutations are enriched in promoter regions of genes involved in apoptosis or growth/proliferation We combined gene expression and mutation data from the coding and non-coding spaces We highlight candidate regulatory-disrupting variations dysregulating the gene expression program in cancer pathways 12
- 16. Acknowledgements Wasserman lab : Wyeth Wasserman David Arenillas Allen Zhang all the Wasserman lab members Shah lab : Sohrab Shah Calvin Lefebvre Jiarui Ding Funding : Centre for Molecular Medicine and Therapeutics 13