Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
14
Genética molecular
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
14
Genética molecular
1. E...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
“Collar de
perlas”
1. El A...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
“Collar de
perlas”
El ADN ...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
“Collar de
perlas”
El ADN ...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
“Collar de
perlas”
El ADN ...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
1. ADN COMO MATERIAL GENÉT...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
1. ADN COMO MATERIAL GENÉT...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Experiencias de F. Griffit...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
CONCLUSIÓN. En las bacteri...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
1. Se inoculan ratones con...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
EXPERIMENTO DE AVERY (1944...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
EXPERIMENTO DE AVERY (1944...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
EXPERIMENTO DE AVERY (1944...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
En 1944 Avery y colaborado...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
2. El concepto molecular d...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
1941. Experimento de G. Be...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Experimento de G. Beadle y...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Experimento de G. Beadle y...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
1 gen 1 enzima
2. CONCEPTO...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Desde el punto de vista fu...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
REPASEMOS ALGUNOS CONCEPTOS
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
El ciclo celular
Fase G0
F...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Capacidad de hacer copias ...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
3. REPLICACIÓN DEL ADN ¿Có...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
TEORÍA CONSERVATIVA
Una do...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
TEORÍA DISPERSIVA
ADN copi...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
TEORÍA SEMICONSERVATIVA
Ca...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
La duplicación del ADN
Med...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
3. La duplicación del ADN
...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
3. La duplicación del ADN
...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
3. La duplicación del ADN
...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
3. La duplicación del ADN
...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
3. La duplicación del ADN
...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
ADN POLIMERASA I
(Retira f...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
RECUERDA
La actividad poli...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Fases de la replicación: e...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
3. La duplicación del ADN:...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Fases de la replicación: i...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Fases de la replicación: i...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Fases de la replicación: i...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
3’
5’
5’
3’
5’
3’
5’
3’
La...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
RECUERDA
La ADN polimerasa...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
3’
5’
5’
3’
3’
5’
El mecan...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Tema 6: Estructura y45
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
El mecanismo de elongación...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Síntesis de nuevas cadenas...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Fases de terminación
Tiene...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Burbuja de
replicación
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
CORRECCIÓN DE ERRORES DE L...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
5’
3’
5’
3’
Replicación en...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
El mecanismo de duplicació...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
LA TELOMERASA
En las célul...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
La telomerasa podría deten...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
ADN ARNm
Transcripción Tra...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
REDEFINICIÓN DEL DOGMA CEN...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
4. La expresión del mensaj...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
DOGMA CENTRAL DE LA BIOLOG...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
AATTCGAGCTAGCAGCCACTTACGAG...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Síntesis de ARN: requisito...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
5. La transcricpción. Sínt...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
5. La transcricpción. Sínt...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
El proceso de la transcrip...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
5. Transcripción: maduraci...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Transcripción: maduración ...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Transcripción: maduración ...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Transcripción en eucariota...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Transcripción en eucariota...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
¿ LO SABÍAS?
La toxicidad ...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
COMPARACIÓN TRANSCRIPCIÓN
...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
6. El código genético
¿Cóm...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
El código genético
Si solo...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
3 bases
43
= 64 aa
SUFICIE...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
EL CÓDIGO GENÉTICO
AUG
Ini...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
El código genético
El códi...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Características del código...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
7. La traducción. Biosínte...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
EL PROCESO DE TRADUCCIÓN
L...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
La traducción. Biosíntesis...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
ZONA E: liberación: de don...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
(Unión a la
peptidil-
tran...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
U C G
COOH
NH2
CH2
OH
H C ...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
La traducción. Biosíntesis...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
La traducción. Síntesis de...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
La traducción. Biosíntesis...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
La traducción. Biosíntesis...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
La traducción. Biosíntesis...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Microfotografía electrónic...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
¿ LO SABÍAS?
Determinados ...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
1. Estructura del genoma e...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
1. Estructura del genoma e...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
1. Estructura del genoma e...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
1. Estructura del genoma e...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
ADN NO CODIFICANTE “ADN ba...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Lo sabías… En septiembre d...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
ADN repetitivo satélite
8....
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
EL PROYECTO GENOMA HUMANO
...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
EL PROYECTO GENOMA HUMANO
...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
EL PROYECTO GENOMA HUMANO
...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
El 26 de junio de 2000 dos...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
OBJETIVOS DEL PROYECTO
GEN...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Aplicaciones del PGH
1. Pe...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
Conclusiones del PGH
1. El...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
3,5 mil millones de pares ...
Biología. 2º bachillerato
Unidad 14. Genética molecular
C.E.M HIPATIA-FUHEM
Miguel Ángel Madrid
PROTEÓMICA: disciplina que...
Próxima SlideShare
Cargando en…5
×

Ud.14. genética molecular nuevo

6.289 visualizaciones

Publicado el

0 comentarios
6 recomendaciones
Estadísticas
Notas
  • Sé el primero en comentar

Sin descargas
Visualizaciones
Visualizaciones totales
6.289
En SlideShare
0
De insertados
0
Número de insertados
3.222
Acciones
Compartido
0
Descargas
435
Comentarios
0
Recomendaciones
6
Insertados 0
No insertados

No hay notas en la diapositiva.

Ud.14. genética molecular nuevo

  1. 1. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 14 Genética molecular
  2. 2. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 14 Genética molecular 1. El ADN como depositario de la información genética. 2. Concepto molecular de gen. 3. Replicación del ADN 1. Etapas de la replicación 2. Diferencias entre el proceso replicativo en procariotas y eucariotas. 4. Expresión de la información genética: dogma central de la biología molecular. 5. Transcripción. 6. El código genético 7. Traducción. 8. El genoma de procariotas y eucariotas 9. El proyecto genoma humano. 10. Concepto de proteoma y proteómica. Aplicaciones en biociencias.
  3. 3. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid “Collar de perlas” 1. El ADN como portador de información genética Interfase Fibra de ADN unida a proteínas A principios del siglo XX se sabía… Análisis de los Cromosomas. (ADN + proteínas)
  4. 4. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid “Collar de perlas” El ADN como portador de información genética Interfase Fibra de ADN unida a proteínas ¿Qué molécula posee la información genética? ¿El ADN o las proteínas?
  5. 5. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid “Collar de perlas” El ADN como portador de información genética Interfase Fibra de ADN unida a proteínas ¿Las proteínas en su secuencia de aminoácidos?
  6. 6. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid “Collar de perlas” El ADN como portador de información genética Interfase Fibra de ADN unida a proteínas ¿El ADN en su secuencia de nucleótidos?
  7. 7. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 1. ADN COMO MATERIAL GENÉTICO ¿Quién es el depositario de la información genética? Primeras evidencias: Las proteínas. El ADN tiene una estructura demasiado sencilla. Las proteínas son más complejas y tienen funciones catalíticas. 1928. Experimento de Griffith (buscando vacuna contra la neumonía provocada por Streptococcus pneumoniae)
  8. 8. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 1. ADN COMO MATERIAL GENÉTICO Streptococcus pneumoniae (bacteria causante de la neumonía, presenta dos variantes o cepas distintas) Cepa S: (del inglés smooth, liso). Poseen cápsula gelatinosa de polisacáridos que impide que el sistema inmunológico del ratón las ataque. Provocan la enfermedad Cepa R: (del inglés rough, rugoso). Sin cápsula gelatinosa de polisacáridos. Forman colonias rugosas. No provocan la enfermedad ya que el sistema inmune del ratón las ataca rápidamente.
  9. 9. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Experiencias de F. Griffith Bacteria con cápsula (virulenta) Tipo S Bacterias S muertas por calor Tipo R Bacteria sin cápsula (no virulenta) Bacterias S muertas por calor Bacterias R vivas 1 2 3 4 De los ratones muertos se extraen bacterias vivas de la cepa S De los ratones inoculados no se extraen bacterias vivas De los ratones inoculados no se extraen bacterias vivas, pues no crecen en el animal. De los ratones muertos se extraen bacterias vivas de la cepa S
  10. 10. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid CONCLUSIÓN. En las bacterias muertas (cepa S) existía algo, llamado PRINCIPIO TRANSFORMANTE que era captado por las bacterias vivas no virulentas (cepa R) y transformaba sus caracteres hereditarios convirtiéndose en virulentas.
  11. 11. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 1. Se inoculan ratones con cepas S, contraen la enfermedad y mueren. De ellos se extraen bacterias S vivas. 2. Los ratones inoculados con cepas R no contraen la enfermedad. De ellos se extraen bacterias vivas pues no crecen en el animal 3. Se inoculan ratones con cepas S, muertas por el calor. No contraen la enfermedad. De ellos no se extraen bacterias vivas. 4. Los ratones inoculados con cepas S, muertas por el calor y, simultáneamente, cepas R vivas contraen la enfermedad y mueren. De ellos se extraen bacterias vivas S.
  12. 12. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid EXPERIMENTO DE AVERY (1944) (CULTIVO DE BACT. R EN UN MEDIO CON DNA PURIFICADO PROCEDENTE DE BACTERIAS S) Cultivaron las bacterias en tubos de ensayo (in vitro) Fueron destruyendo, uno por uno, todos los componentes bioquímicos de las células S para evitar la transformación e identificar el responsable. Degradaron polisacáridos de la pared y al inyectarlas en el ratón la transformación se producía. A continuación degradaron proteínas y la transformación se producía. Así sucesivamente hasta que atacar al ADN de las bacterias. La transformación no se producía
  13. 13. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid EXPERIMENTO DE AVERY (1944) (CULTIVO DE BACT. R EN UN MEDIO CON DNA PURIFICADO PROCEDENTE DE BACTERIAS S) La molécula de ADN contiene la información necesaria para convertir las bacterias R no virulentas en bacterias S virulentas. Demostraron además, del papel biológico del ADN, que las bacterias pueden intercambiar material genético (transformación)
  14. 14. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid EXPERIMENTO DE AVERY (1944) (CULTIVO DE BACT. R EN UN MEDIO CON DNA PURIFICADO PROCEDENTE DE BACTERIAS S)
  15. 15. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid En 1944 Avery y colaboradores demostraron que el principio transformante era el ADN, que determinaba o no la producción de la cápsula bacteriana. CONCLUSIÓN El ADN era el material genético en bacterias. En 1952 se demostró que era el material genético en el resto de organismos
  16. 16. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 2. El concepto molecular de gen Genética clásica Un gen contiene información para un determinado carácter El concepto de gen ha ido cambiando según aumentaban los conocimientos sobre genética molecular.
  17. 17. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 1941. Experimento de G. Beadle y E. Tatum con el hongo Neurospora crassa 2. CONCEPTO MOLECULAR DE GEN Sólo precisa una fuente de carbono, biotina y ciertos minerales. Sometieron al hongo a ciertas dosis de rayos X. Obtuvieron mutantes incapaces de sintetizar determinados aminoácidos, por lo que solo sobrevivían al añadir al medio los aminoácidos.
  18. 18. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Experimento de G. Beadle y E. Tatum con el hongo Neurospora crassa 2. CONCEPTO MOLECULAR DE GEN Descubrieron: A cada mutante le faltaba el enzima específico que catalizaba algún paso de la síntesis del aminoácido al que habían alterado. Los mutantes se diferenciaban de la cepa salvaje en un solo gen.
  19. 19. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Experimento de G. Beadle y E. Tatum con el hongo Neurospora crassa 2. CONCEPTO MOLECULAR DE GEN Descubrieron: Si se altera el gen, no se fabrica la enzima correspondiente y la ruta se bloquea.
  20. 20. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 1 gen 1 enzima 2. CONCEPTO MOLECULAR DE GEN 1 gen 1 proteína 1 gen 1 cadena polipeptídica
  21. 21. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Desde el punto de vista funcional: Fragmento del ADN que lleva la información para fabricar una cadena polipeptídica de una proteína, necesaria para que se exprese un carácter en un individuo 2. CONCEPTO MOLECULAR DE GEN
  22. 22. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid REPASEMOS ALGUNOS CONCEPTOS
  23. 23. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid El ciclo celular Fase G0 Fase G0 Fase G1 Fase G1 Fase permanente en células que no entran nunca en mitosis. Estado de quiescencia. Fase permanente en células que no entran nunca en mitosis. Estado de quiescencia. Síntesis de proteínas y aumento del tamaño celular. Síntesis de proteínas y aumento del tamaño celular. Replicación del ADN y síntesis de histonas. Replicación del ADN y síntesis de histonas. Transcripción y traducción de genes que codifican proteínas necesarias para la división. Duplicación de los centriolos Transcripción y traducción de genes que codifican proteínas necesarias para la división. Duplicación de los centriolos División celularDivisión celular Fase de mitosis Fase de mitosis División del citoplasma División del citoplasma CitocinesisCitocinesis Fase SFase S Interfase Fase G2 Fase G2 REPASEMOS ALGUNOS CONCEPTOS
  24. 24. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Capacidad de hacer copias de si mismo. Esto permite transmitir la información genética a las células hijas. 3. REPLICACIÓN (DUPLICACIÓN) DEL ADN La replicación permite a las células hijas contener el mismo ADN que la célula madre. Las células duplican su ADN antes de la división celular (en eucariotas en la fase S de la interfase).
  25. 25. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 3. REPLICACIÓN DEL ADN ¿Cómo se produce la duplicación? 3 hipótesis Hipótesis semiconservativa Hipótesis conservativa Hipótesis dispersiva Cadena antigua Cadena nueva
  26. 26. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid TEORÍA CONSERVATIVA Una doble hélice conserva las dos cadenas originales, y la otra está formada por las dos cadenas de nueva síntesis.
  27. 27. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid TEORÍA DISPERSIVA ADN copia Cada una de las dos cadenas hijas contiene fragmentos de la cadena original y fragmentos de la nueva síntesis
  28. 28. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid TEORÍA SEMICONSERVATIVA Cada doble hélice conserva una hélice de las dos originales y sintetiza una nueva (Watson y Crick)
  29. 29. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid La duplicación del ADN Medio N15 Medio N14 ADN inicial ADN después de la 1.ª duplicación Experimento de Meselson y Stahl (1958) ADN después de la 2.ª duplicación ADN después de la 3.ª duplicación ADN N15 ADN N14-15 ADN N14 1- Cultivaron bacterias en un medio con N-15 (Las bases nitrogenadas incorporaron el isótopo). 2- Transfirieron las bacterias a un medio con N-14. El ADN obtenido tenia la misma proporción N14, N15. Cada bacteria había heredado la mitad de ADN de su progenitora y la otra mitad la sintetizaba de los componentes del medio. 3- Aparecían ADN hibrido (N14-N15) y ADN solo con N14
  30. 30. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 3. La duplicación del ADN ¿Dónde ocurre? ¿Cuándo ocurre? Núcleo (eucariotas) Nucleoide (procariotas) Matriz (mitocondrias) Estroma (cloroplastos) FASE S DEL CICLO CELULAR (en interfase)
  31. 31. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 3. La duplicación del ADN Principales características de la replicación  Es semiconservativa. Cada molécula de ADN está formada por una cadena de ADN original y otra recién formada. Se produce por adición de mononucleótidos en sentido 5´ 3`  Es bidireccional. Se forman dos horquillas de replicación que avanzan en sentidos opuestos.  En virus y bacterias hay un único punto de inicio, mientras que en eucariotas hay varios. Es semidiscontinua. En una cadena (llamada conductora) se sintetizan fragmentos bastante grandes de forma continua, mientras que en la otra (llamada retardada) la síntesis es discontinua, es decir, se sintetizan pequeños fragmentos de forma separada y después se unen (los llamados fragmentos de Okazaki). Ello se debe a que las dos cadenas son antiparalelas y a que la síntesis es siempre en sentido 5´ 3´
  32. 32. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 3. La duplicación del ADN ¿Qué necesitamos? - ADN molde - Nucleótidos: ATP, GTP, CTP, TTP - Proteínas SSB (impiden que se enrede el ADN) - Enzimas: - Helicasas: rompen puentes de H entre las dos cadenas complementarias, separándolas. - Topoisomeras (girasas). Desenrollan ADN, evitan tensiones - ADN ligasas (unen fragmentos ADN mediante enlaces fosfodiéster). Así sellan el hueco entre dos fragmentos de Okazaki. - ARN polimerasas (también llamadas primasas). Sintetizan fragmentos de ARN (llamados ARN cebador) usando como molde ADN y actúa como iniciador de la síntesis de ADN. - Nucleasas. Rompen enlaces fosfodiéster entre nucleótidos, escinden ARN cebador y reparan lesiones en el ADN. - ADN polimerasas. Catalizan la formación de enlaces fosfodiéster entre nucleótidos.
  33. 33. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 3. La duplicación del ADN ARN POLIMERASA (primasa) 3` 5` ARN cebador (40-50 nucleótidos) ADN molde ADN ADN polimerasa ARN polimerasa Sintetiza el ARN cebador usando como molde el ADN 5` 3`
  34. 34. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 3. La duplicación del ADN ADN POLIMERASA 3` 5` ARN cebador (40-50 nucleótidos) ADN molde ADN ADN polimerasa ARN polimerasa Función polimerasa Precisa ARN cebador (primer o iniciador) y la cadena molde de ADN Recoore la hebra de ADN, es decir lee en sentido 3´ 5´, y por tanto la hebra nueva crece en sentido 5´-> 3´ Función exonucleasa Detecta errores, elimina nucleótidos cuyas bases están mal emparentadas y fragmentos de ARN cebador 5` 3`
  35. 35. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid ADN POLIMERASA I (Retira fragmentos ARN cebador: exonucleasa Sintetiza ADN en los huecos: polimerasa Es correctora, ya que repara errores de la síntesis de ADN) ADN POLIMERASA II (Interviene en procesos de reparación del ADN Tiene actividad polimerasa en sentido 5` 3´y exonucleasa en 3´ 5´) ADN POLIMERASA III (Sintetiza ADN en sentido 5´ 3´: polimerasa) RECUERDA La ADN polimerasa: Precisa ARN cebador Lee en sentido 3´ 5 Sintetiza en sentido 5´ 3´ En procariotas distinguimos:
  36. 36. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid RECUERDA La actividad polimerasa consiste en catalizar la unión de nucleótidos a la cadena de ácido nucleico que se está sintetizando. La actividad exonucleasa consiste en escindir nucleótidos de los extremos de los ácidos nucleicos.
  37. 37. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Fases de la replicación: elongación Junto a las enzimas que participan en la iniciación, en esta fase actúan las ADN polimerasas. POLIMERASA EXONUCLEASA POLIMERIZACIÓN INICIACIÓN dirección función dirección función I 5’→ 3’ 3’→ 5’ elimina cebador reparación 5’→ 3’ síntesis no II 3’→ 5’ reparación 5’→ 3’ síntesis no III 3’→ 5’ reparación 5’→ 3’ síntesis no
  38. 38. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 3. La duplicación del ADN: Mecanismo de la duplicación en procariotas Fase de iniciación Fase de elongación Fase de terminación
  39. 39. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Fases de la replicación: iniciación Consiste en el desenrollamiento y apertura de la doble hélice de ADN Ori C (abundan secuencias ricas en GATC) La replicación empieza en un punto del ADN donde abundan las secuencias de bases GATC (Ori C) En él se separan las dos cadenas de ADN por acción de las enzimas. Origen de replicación
  40. 40. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Fases de la replicación: iniciación Consiste en el desenrollamiento y apertura de la doble hélice de ADN Ori C (abundan secuencias ricas en GATC) Proteínas específicas La helicasa rompe los enlaces de hidrógeno entre las bases y abre la doble hélice Proteínas SSB Helicasa Topoisomerasa Girasa Evitan las tensiones debidas a un superenrrollamiento Impiden que el ADN se vuelva a enrollar Las proteínas específicas se unen al punto de iniciación
  41. 41. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Fases de la replicación: iniciación Resultado: se forma una burbuja de replicación en la que hay dos zonas en forma de “Y”, llamadas horquillas de replicación, donde se sintetizan las nuevas cadenas de ADN
  42. 42. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 3’ 5’ 5’ 3’ 5’ 3’ 5’ 3’ La primasa (ARN polimerasa) sintetiza un ARN cebador o primer La ADN polimerasa III sintetiza un corto fragmento de ADN 1. La primasa (ARN polimerasa) sintetiza un fragmento de ARN cebador, de unos 10 nucleótidos que es complementario del fragmento correspondiente de ADN 2. La ADN polimerasa III reconoce los nucleótidos de la cadena molde y los empareja según complementariedad de bases (A-T y G-C) FRAGMENTO DE OKAZAKI ( procariotas: 1000 – 2000 nucleótidos, en eucariotas de 150 a 200 nucleótidos) Cadena continua conductora Cadena retardada La ADN poli I va eliminando el cebador y rellenando los nucleótidos de ADN. Finalmente la ADN ligasa suelda todos los fragmentos obtenidos
  43. 43. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid RECUERDA La ADN polimerasa III: Precisa ARN cebador Lee en sentido 3´ 5 Sintetiza en sentido 5´ 3´ Burbuja de replicación
  44. 44. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 3’ 5’ 5’ 3’ 3’ 5’ El mecanismo de elongación o formación de las nuevas cadenas de ADN 5’ 3’ 3’ 5’ 3’ La ADN polimerasa III necesita un fragmento de ARN (cebador o primer) con el extremo 3’ libre para iniciar la síntesis. La ADN polimerasa recorre las hebras molde en el sentido 3’-5’ uniendo los nuevos nucleótidos en el extremo 3’. Una de las hebras se sintetiza de modo contínuo por la ADN polimerasa III. Es la conductora o lider.Fragmentos de Okazaki La otra hebra se sintetiza de modo discontinuo formándose fragmentos que se unirán más tarde. Es la retardada. RECUERDA La ADN polimerasa: Precisa ARN cebador Lee en sentido 3´ 5 Sintetiza en sentido 5´ 3´
  45. 45. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Tema 6: Estructura y45
  46. 46. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  47. 47. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid El mecanismo de elongación (II) 1 2 3 4 5 6 La primasa (ARN polim) sintetiza un cebador en cada hebra de la burbuja de replicación. Las ADN polimerasa III comienzan la síntesis de la hebra conductora por el extremo 3’ de cada cebador. La primasa sintetiza un nuevo cebador sobre cada hebra retardada. La ADN polimerasa III comienza a sintetizar un fragmento de ADN a partir del nuevo cebador. Cuando la ADN polimerasa III llega al cebador de ARN, lo elimina y lo reemplaza por ADN. La ligasa une los fragmentos de ADN. Nuevo cebador Cebador Ligasas Hebra retardada Hebra retardada Primasas Cebador Nuevo cebador
  48. 48. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Síntesis de nuevas cadenas de ADN Horquillas observadas 3’ 5’ 3’ 5’ 3’ 5’ 5’ 3’ 5’ 3’ 5’ 3’ Punto de inicio Ninguna polimerasa añade nucleótidos en estos puntos 5’ 5’ 3’ 3’ Origen de replicación Crecimiento discontinuo Crecimiento continuo Fragmentos de Okazaki
  49. 49. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Fases de terminación Tiene lugar cuando las dos horquillas de replicación del cromosoma circular de E. coli se encuentran, y se han formado dos cromosomas completos que permanecen ligados
  50. 50. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Burbuja de replicación
  51. 51. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid CORRECCIÓN DE ERRORES DE LA ADN POLIMERASA Durante la replicación, es frecuente que se produzcan errores y se incorporen nucleótidos incorrectos. Gracias a la acción exonucleasa, la ADN polimerasa elimina nucleótidos mal apareados y adiciona los correctos. Número de errores 1 por cada 100 000 bases Aunque el mecanismo de corrección de errores es muy eficiente, a veces queda alguno sin corregir. Esos errores suelen ser importantes en la evolución
  52. 52. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 5’ 3’ 5’ 3’ Replicación en los eucariontes Es muy parecida a la de los procariontes, salvo en algunas diferencias: La replicación se inicia simultáneamente en carios puntos del cromosoma llamados replicones. Existen cinco tipos de ADN polimerasas (α, β, γ, δ, y ε ). Las histonas se duplican durante la replicación. Junto al ADN formarán el nucleosoma. Los nuevos nucleosomas se incorporan a la hebra retardada y los viejos en la conductora. Cuando se elimina el último cebador, la ADN polimerasa no podrá rellenar el hueco, al no poder sintetizar en dirección 3’ - 5’. 5’ 5’ 5’ 3’ 5’3’5’ Cebador Último cebador Telómero Eliminación de cebadores Debido a esto el extremo del cromosoma (telómero) se va acortando cada vez que la célula se divide. Esto se asocia al envejecimiento y muerte celular. La ADN polimerasa polimeriza desde el extremo 3’ libre Hebra más corta 5’ Los fragmentos de Okazaki en eucariotas son más cortos, entre 150-200 nucleótidos (en procariotas de 1000 – 2000 nucleótidos)
  53. 53. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid El mecanismo de duplicación del ADN en eucariotas Origen de la replicación Horquilla de replicación Hebra retardada Hebra conductora Origen de la replicación Burbujas de replicación Hebra conductora Nucleosomas Nuevos nucleosomas Hebra retardada
  54. 54. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid LA TELOMERASA En las células que se dividen continuamente (células madre de los gametos, células embrionarias y células cancerosas) hay una enzima, denominada telomerasa, que impide el acortamiento de los telómeros. Se forma por una porción proteica y ARN que actúa como molde. A partir de este molde, la enzima sintetiza ADN para completar la hebra retardada. Recuerda: los telómeros son los extremos de los cromosomas La telomerasa podría detener el envejecimiento, pero guarda una estrecha relación con el cáncer. Los investigadores trabajan con ratones para alargar la vida sin aumentar el riesgo de cáncer.
  55. 55. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid La telomerasa podría detener el envejecimiento, pero guarda una estrecha relación con el cáncer. Los investigadores trabajan con ratones para alargar la vida sin aumentar el riesgo de cáncer. María Blasco. Centro de Investigaciones oncológicas
  56. 56. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid ADN ARNm Transcripción Traducción ARNt PROTEÍNA Replicación Este esquema fue considerado durante muchos años el “dogma central de la biología molecular”., pero los cirus son una excepción a este dogma RIBOSOMASNÚCLEO 4. La expresión del mensaje genético En 1970 Francis Crick enunció el Dogma Central de la Biología Molecular.
  57. 57. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid REDEFINICIÓN DEL DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR ARNADN Traducción Transcripción Transcripción inversa Replicación PROTEÍNAS Transcriptasa inversa Transcriptasa inversa Transcriptasa inversa Transcriptasa inversa ARN vírico Envoltura RETROVIRUS Membrana plasmática de la célula huésped Algunos virus poseen ARN replicasa, capaz de obtener copias de su ARN. Otros poseen transcriptasa inversa que sintetiza ADN a partir de ARN mediante un proceso de retrotranscripción. Replicación ADNc (complementario) ADNc bicatenario ADNc monocatenarioDegradación del ARN DOGMA CENTRAL DE LA BIOLOGÍA MOLECULAR
  58. 58. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 4. La expresión del mensaje genético ADN ARNm Proteína Transcripción Transcripción inversa Duplicación Duplicación Traducción Las secuencias de ADN que pueden moverse a diferentes partes del genoma de una célula se conocen como transposones o «genes saltarines». Fueron descubiertos por Bárbara McClintock, por lo que recibió el premio Nobel en 1983.
  59. 59. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid DOGMA CENTRAL DE LA BIOLOGÌA MOLECULARDOGMA CENTRAL DE LA BIOLOGÌA MOLECULAR Hebra moldeHebra molde TranscripciónTranscripción TraducciónTraducción 3´ 5´ 3´5´
  60. 60. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid
  61. 61. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid AATTCGAGCTAGCAGCCACTTACGAGTACGTA C ADN ACUUUCCCGACGCAAAACGUUUUUCGAACUU ARN TRIPLETE CODON Triplete: Cada una de las secuencias posibles de tres nucleótidos en el ADN. Codon: Secuencia de tres nucleótidos en el ARN ¿Qué es un triplete y un codon?
  62. 62. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Síntesis de ARN: requisitos previos La síntesis de ARN o transcripción necesita: CADENA DE ADN QUE ACTÚE COMO MOLDE ARN -POLIMERARAS RIBONUCLEÓTIDOS TRIFOSFATO DE A, G, C y U Ribonucleótido trifosfato Ribosa Bases En eucariotas • ARN polimerasa I ARNr • ARN polimerasa II ARNm • ARN polimerasa III ARNt y ARNr ¿Dónde ocurre?. NÚCLEO
  63. 63. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 5. La transcricpción. Síntesis de ARN RECUERDA LA ARN polimerasa RECORRE LA CADENA DE ADN EN SENTIDO 3` 5´Y AÑADE LOS NUCLEÓTIDOS COMPLEMENTARIOS A LOS DE LA CADENA DE ADN QUE SE TRANSCRIBE
  64. 64. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 5. La transcricpción. Síntesis de ARN Fase de iniciación Fase de elongación Fase de terminación Fase de maduración
  65. 65. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid El proceso de la transcripción Cadena inactiva de ADN ARN - polimerasa Cadena molde de ADN (transcrita) ARN Señal de corte Punto de corte Cola poli-A Poli-A polimerasa INICIACIÓN ELONGACIÓN TERMINACIÓN La ARN-polimerasa reconoce los centros promotores (ricos en A y T). Luego abre la doble hélice para que los ribonucleótidos se unan a la cadena molde. La ARN-polimerasa avanza en sentido 3’-5’ y sintetiza el ARN en sentido 5’-3’. . La ARN-polimerasa reconoce en el ADN unas señales de terminación que indican el final de la transcripción. En procariontes son secuencias palindrómicas. En eucariontes 1 2 3 NO OLVIDES La ARN polimerasa lee en dirección 3` 5´
  66. 66. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 5. Transcripción: maduración en procariotas Promotor 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ ARN-polimerasa ARN Iniciación Elongación Finalización ARN transcrito completo 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’ No existe maduración del ARNm, se unen a los ribosomas y se traducen Los ARNr y ARNt (transcritos primarios) precisan de un proceso de maduración para ser funciones Los ARN que se forman son policistrónicos (contienen información para la síntesis de varios polipéptidos)
  67. 67. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Transcripción: maduración en procariotas Promotor 5’ 3’ 5’ 3’ 5’ 3’ 5’ 3’ ARN-polimerasa ARN Iniciación Elongación Finalización ARN transcrito completo 3’ 5’ 3’ 5’ 3’ 5’ 3’ 5’
  68. 68. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Transcripción: maduración en eucariotas Promotor 5’ 3’ 5’ 3’ 5’ 3’ ARN Unidad de transcripción Iniciación 3’ 5’ 3’ 5’ 3’ 5’ m7 -Gppp Capucha 5'Elongación m7 -Gppp ARN-polimerasa CONTINUAR 1. Tras la unión de los 30 primeros ribonucleótidos se añade una caperuza de metilguanosina en 5´ Los ARN que se forman son monocistrónicos
  69. 69. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Transcripción en eucariotas 5’ 3’ 3’ 5’ Finalización PoliA-polimerasa m7 -Gppp Capucha 5' OH ARN heterogéneo nuclear Cola de poli-A OHm7 -Gppp Capucha 5' 2. Después de la separación del ARN, una enzima la poliA- polimerasa añade una secuencia de unos 200 nucleótidos de adenina (cola de poli A)
  70. 70. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Transcripción en eucariotas. Proceso de maduración 5’ 3’Maduración 3’5’ Exón 1 Intrón Exón 2 RNPpn Proteína Espliceosoma. 5’ 3’ Intrón ARNm Exón 1 Exón 2 Mecanismo de splicing El ARNm ya está en condiciones de salir del núcleo 3. Eliminación de intrones (segmentos de ARN que no se traducen)
  71. 71. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid ¿ LO SABÍAS? La toxicidad de la Amanita phalloides (provoca diarreas, vómitos, dolores abdominales e incluso la muerte) se debe a una sustancia, 1 alfa amanitina, que no se destruye con la cocción y se comporta como un inhibidor de la ARN polimerasa II en eucariotas, lo que bloquea la síntesis de ARNm
  72. 72. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid COMPARACIÓN TRANSCRIPCIÓN PROCARIOTAS EUCARIOTAS Localización Nucleoide (citoplasma) Núcleo Genes Continuos Fragmentos (intrones y exones) ADN Bajo grado de empaquetamiento Muy empaquetado ARN polimerasa 1 ARN polimerasa que sintetiza ARNm, ARNr, ARNt… ARN poli I: ARNr ARN poli II: ARNm ARN poli III: ARNt Tipos de genes Policistrónicos Monocistrónicos Maduración ARNr y ARNt ARNm
  73. 73. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 6. El código genético ¿Cómo se pasaba de un lenguaje de cuatro letras a otro lenguaje formado por 20 elementos distintos? Se necesitaba un diccionario Ese diccionario es el código genético ARN polímero lineal de 4 nucleótidos diferentes. Proteínas: polímeros de 20 aminoácidos
  74. 74. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid El código genético Si solo fuesen 2 bases 42 = 16 aa INSUFICIENTE Si solo fuese 1 base 41 = 4 aa INSUFICIENTE 3 bases 43 = 64 aa SUFICIENTE
  75. 75. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 3 bases 43 = 64 aa SUFICIENTE, pero sobran palabras, lo que significa que varios tripletes son sinónimos, porque codifican (significan) el mismo aminoácido El código genético
  76. 76. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid EL CÓDIGO GENÉTICO AUG Iniciación UGAUAAUAG Terminación Ej. ¿Qué aminoácido está codificado por el codón GAC?
  77. 77. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid El código genético El código genético establece una relación de correspondencia entre las bases nitrogenadas del ARN y los aminoácidos que codifica
  78. 78. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Características del código genético UNIVERSAL El mismo para todos los organismos, incluso los virus. El código ha tenido un solo origen evolutivo. Existen excepciones en las mitocondrias y algunos protozoos. Existen más codones (64) que aminoácidos (20). A excepción de la metionina y el triptófano, un aminoácido está codificado por más de un codón. Esto es una ventaja ante las mutaciones. DEGENERADO Cada codón solo codifica a un aminoácido. SIN IMPERFECCIÓN Los tripletes se disponen de manera lineal y continua, sin espacios entre ellos y sin compartir bases nitrogenadas CARECE DE SOLAPAMIENTO Posibilidad de solapamiento Met Gli Tre His Ala Fen Ala Met Leu Leu Pro Solapamiento Codones de iniciación
  79. 79. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 7. La traducción. Biosíntesis de proteínas Si te has fijado, el proceso de transcripción es un proceso de copia donde no se cambia de idioma, pues se pasa del idioma del ADN a ARN Sin embargo, en la traducción, que no es un proceso de copia, si se cambia de idioma, se pasa del idioma de los ácidos nucleicos (A,G,C,U) al de las proteínas (20 aminoácidos)
  80. 80. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid EL PROCESO DE TRADUCCIÓN LA SÍNTESIS DE PROTEÍNAS ARN MENSAJEROAMINOÁCIDOS ENZIMAS Y ENERGÍA SUBUNIDAD PEQUEÑA SUBUNIDAD GRANDE SITIO A SITIO P SITIO E AMINOÁCIDO POLIPÉPTIDO ARNt Dondesesitúael Tienen tres lugares Formados por RIBOSOMAS Donde se unen los Donde se une el Donde se une el EXTREMO 3’ Tiene dos zonas ARN DE TRANSFERENCIA Por donde se une al ANTICODÓN AMINOACIL-ARNt -SINTETASA Como la necesita RIBOSOMAS ocurre
  81. 81. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid La traducción. Biosíntesis de proteínas Subunidad menor Subunidad mayor Aminoacil-ARNt ARNt Cadena polipeptídica en formación Anticodón 3’ 5’ ARNm Aminoácido ZONA E: liberación: de donde salen los ARNt libres ZONA P: peptidil: donde se va formando la cadena polipeptídica ZONA A: aminoacil, donde entran los aminoácidos Veamos primero cómo es un ribosoma
  82. 82. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid ZONA E: liberación: de donde salen los ARNt libres ZONA P: peptidil: donde se va formando la cadena polipeptídica ZONA A: aminoacil, donde entran los aminoácidos Otra imagen por si no te queda claro…
  83. 83. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid (Unión a la peptidil- transferasa en el ribosoma (Unión al ribosoma) (Unión al codon complementario del RNAm en el ribosoma) NOTA.- EXISTEN TANTOS RNAt como aminoácidos, uno para cada uno, en total 20 clases de RNAt Recordemos como era un ARNt
  84. 84. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid U C G COOH NH2 CH2 OH H C Aminoácido (serina) Anticodón ARNt Aquí en el extremo 3`es donde se une el aminoácido al ARNt Extremo 3` Una imagen más simple del ARNt por si no te quedaba claro…
  85. 85. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid La traducción. Biosíntesis de proteínas Paso previo: Activación de los aminoácidos Aminoacil-ARNt-sintetasa ARNt CONTINUAR Aminoacil-ARNt ESTA FASE PREVIA TIENE LUGAR EN EL CITOPLASMA Y NO EN LOS RIBOSOMAS Cada aminoácido se une a una molécula de ARNt especifica gracias a la enzima aminoacil-ARNt- sintetasa
  86. 86. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid La traducción. Síntesis de proteínas Fase de iniciación Fase de elongación Fase de terminación
  87. 87. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid La traducción. Biosíntesis de proteínas ARNt iniciador Subunidad menor 3’ 5’ U A C 5’ 3’ A U G 5’ 3’ E A Metionina 5’ 3’ GTP GDP Iniciación de la síntesis
  88. 88. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid La traducción. Biosíntesis de proteínas CONTINUAR Elongación de la cadena polipeptídica Anticodón Complementariedad entre codón y anticodón GTP GDP 5’ 3’ 3’ 5’ 5’ 5’ 3’ 3’GTP GDP Enlace peptídico El aminoácido se traslada al otro ARNt ARNt Aminoácido Se libera el ARNt que ha cedido el aminoácido E P A E P A El ribosoma se trasloca un codon A P E
  89. 89. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid La traducción. Biosíntesis de proteínas Finalización de la síntesis El codón de finalización puede ser UAA, UAG o UGA Último ARNt Factor de liberación Polipéptido libre Separación del ARNm y las subunidades ribosómicas 3’ 5’ 3’ 5’ E A P El triplete de terminación no es reconocido por ningún ARNt, y sí por unos factores de liberación de naturaleza proteica que se sitúan en el sito A, y hacen que la peptidil transferasa separe la cadena polipetídica del ARNt
  90. 90. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Microfotografía electrónica (MET, falso color) de un polirribosoma. Polirribosomas en eucariotas Si el ARN a traducir es lo suficientemente largo puede ser leído por más de un ribosoma a la vez, formando un polirribosoma o polisoma. La síntesis ocurre a razón de unos (15 aminoácidos unidos por segundo. Una proteína media (300 aa) se sintetizaría en unos 15 segundos. Después, el RNAm es destruído Ribosoma ARNm Proteína en formación
  91. 91. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid ¿ LO SABÍAS? Determinados antibióticos se utilizan como dardos para destruir bacterias, al actuar sobre dianas moleculares relacionadas con la traducción y bloquear algunas etapas de la síntesis e proteínas Estreptomicina: trisacárido que se une a la subunidad 30 S del ribosoma procariota e interfiere en la iniciación de la síntesis. Eritromicina: bloque la traslocación del ribosoma e inhibe la elongación. Tetraciclina: Se une a la subunidad 30 s del ribosoma y bloquea el sitio A, impidiendo la entrada del ARNt
  92. 92. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 1. Estructura del genoma en procariotas y eucariotas GENOMA Conjunto de genes de un organismo NO TODO EL ADN CONTENIDO EN LOS CROMOSOMAS CODIFICA PARA PROTEÍNAS, EXISTE GRAN CANTIDAD DE GENES REGULADORES
  93. 93. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 1. Estructura del genoma en procariotas y ORGANIZACIÓN DEL GENOMA EN PROCARIOTAS 1 Cromosoma circular (ADNdc) Presencia de plásmidos (número variable según tipo de bacteria). Contienen genes no esenciales para el crecimiento y la reproducción de la célula. Replicación independiente 1 200 – 12 000 genes Genes continuos (toda la información contenida en los genes se traduce en proteínas)
  94. 94. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 1. Estructura del genoma en procariotas y ORGANIZACIÓN DEL GENOMA EN VIRUS 1 Sola molécula lineal o circular de ADN o ARN
  95. 95. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 1. Estructura del genoma en procariotas y ORGANIZACIÓN DEL GENOMA EN EUCARIOTAS La mayor parte localizado en el núcleo. (repartido en los diferentes cromosomas lineales) Una pequeña parte en mitocondrias y cloroplastos (vegetales): ADNdc (similar procariotas) Humanos: genoma nuclear: 25 000 genes que codifican proteínas (exones) y los diversos tipos ARN (1,5 % del total); Genoma mitocondrial: 37 genes ADN no codificante (98,5 %)
  96. 96. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid ADN NO CODIFICANTE “ADN basura *” ADN repetitivo o satélite: situados en los extremos de los cromosomas y centrómeros. No se transcriben nunca (no codifican proteínas) ADN regulador (promotores…: Mucho de él hasta la fecha de función desconocida Intrones: situados en los extremos de los cromosomas y centrómeros. No se transcriben nunca (*) Se le llamó ADN basura pues se pensaba que no tenía función alguna; estudios recientes creen que regula la expresión diferencial de los genes.
  97. 97. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Lo sabías… En septiembre de 2008, investigadores americanos afirmaron haber descubierto una secuencia de ADN basura, responsable de que los humanos hayan desarrollado la capacidad de agarrar o manipular objetos o herramientas.
  98. 98. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid ADN repetitivo satélite 8. Genoma en organismos eucariontes No existe relación directa entre la complejidad del organismo y la cantidad de ADN. La mayor parte del ADN no codifica proteínas: ADN no codificante ADN repetitivo intermedio ADN de intrones Una parte del genoma se encuentra en los cloroplastos y las mitocondrias. Gen Gen regulador Promotor Operador Exones: secuencias codificantes Intrones ESTRUCTURA DE UN GEN EN EUCARIONTES
  99. 99. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid EL PROYECTO GENOMA HUMANO 1955. Joe Hin: establece en 46 el número de cromosomas humanos. 1977. Se inicia secuenciación del ADN 1981. Se completa la secuenciación del genoma mitocondrial humano 1995. Se completa la secuenciación del genoma de la bacteria Haemophilus influenzae. 1996. Secuenciación del genoma del primer eucariota: Saccharomyces cerevisiae 2000. Se completa la secuenciación del genoma del primer organismo pluricelular, el gusano Caenorhabditis elegans.
  100. 100. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid EL PROYECTO GENOMA HUMANO 2000. Secuenciación del genoma de Drosophila melanogaster 2001. Publicación del borrador de la secuencia completa del genoma humano 2003. (Coincidiendo con el 50º aniversario del descubrimiento de la estructura del ADN) Se completa la secuenciación del genoma humano. 2000. Secuenciación del genoma de la planta Arabidopsis thaliana
  101. 101. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid EL PROYECTO GENOMA HUMANO GENÓMICA: Estudia el genoma de los diferentes organismos 1988: Congreso de los EEUU. Autorización de financiación. Creación del consorcio público, dirigido por J.D. Watson. Colaboración con Reino Unido, Francia, Alemania, China y Japón. Nacimiento del PGH. 1996. Craig Venter solicitó la patente de uno de los genes secuenciados. Abandono del Consorcio público. Creación de Celera Genomics (privado) 26 junio 2000. El Consorcio Público y Celera Genomics dieron a conocer los borradores del PGH
  102. 102. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid El 26 de junio de 2000 dos prestigiosas revistas científicas dieron a conocer las dos versiones del borrador del PGH
  103. 103. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid OBJETIVOS DEL PROYECTO GENOMA HUMANO 1. Conocer en qué orden están colocados los genes 2. Determinar la distancia que existe entre los genes (elaboración de mapas génicos) 3. Secuenciar cada gen. (averiguar secuencia de nucleótidos de cada gen) 4. Determinar la función de cada gen
  104. 104. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Aplicaciones del PGH 1. Permite conocer nuestros orígenes al comparar nuestro genoma con el de otras especies. 2. Permite el desarrollo de la medicina genética y personalizada (hoy sabemos ya que diferencias en un solo nucleótido en un gen están asociadas a la enfermedad de Alzheimer)
  105. 105. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid Conclusiones del PGH 1. El número de genes es relativamente bajo (menos de 25 000) comparado con el de otros genomas. Tenemos unos 3 200 millones de nucleótidos 2. Cada gen puede codificar para unas 5 proteínas diferentes, gracias al procesamiento alternativo del ARNm 3. Sólo el 1,5 % del ADN constituye genes que codifican proteínas. El resto es ADN basura cuya función se desconoce. 4. Nos diferenciamos del chimpancé en un 1 % del genoma. 5. Con el análisis del genoma es imposible distinguir una etnia de otra. 6. Los seres humanos nos diferenciamos entre sí aproximadamente en un nucleótido de cada mil. Somos idénticos en un 99,9 %
  106. 106. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid 3,5 mil millones de pares de bases, unas 25 enciclopedias de tipo medio de 20 tomos cada una y con las letras: ........................................TTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTA GCCTACGGCTGCTAGCTGACTGAAGGCTTGAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAG CCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGAGGCCAGCTATATT AGTTAGTAGCCTTACCTTACCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATATTAGCCTATATATC CTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGC TAGCTGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACC TTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTTGGCCAGCTATATTAGCCTATATA TCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACT CTAGCCTTACCTTAACCTATAGCTGACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCA TTAGCTAGCTAGCCTTACCTTAACCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGAAGGCTAGCT GACTGAAGGCTTGAGGCCAGCTATATTAGCCTATATATCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAAC CTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGACTGTCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAA CCTAAACCTAGGCCTAGCCTACGGCTGCTAGCTGTCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCT AAACCTAGGCCTAGCCTACGGCTGCTAGCTGTCCTAGGCGCATTAGCTAGCTAGCCTTACCTTAACCTAAA CCTAGGCCTAGCCTACGGCTGCTAGCTGAAGGC........................................................
  107. 107. Biología. 2º bachillerato Unidad 14. Genética molecular C.E.M HIPATIA-FUHEM Miguel Ángel Madrid PROTEÓMICA: disciplina que realiza un estudio sistemático del conjunto de proteínas codificadas por el genoma de un individuo. La proteómica utiliza las siguientes técnicas: extracción de proteínas del tejido del individuo. Separación e identificación. Análisis e identificación con bancos de datos Las proteínas presentes en la especie humana supera el número de genes, y son estas ( y no los genes) las que desempeñan las actividades de la célula.

×