SlideShare una empresa de Scribd logo
1 de 82
INTRODUCCIÓN
GENERAL
ESPECÍFICA

DESARROLLO
MECANISMO
IMPRINTING
APLICACIÓN

CONCLUSIÓNES
CONSIDERACIONES ÉTICAS
CONCLUSIÓN
CURIOSIDADES
¿¿ Qué es la CLONACIÓN ??
Proceso por el que se consiguen copias
idénticas de un organismo, célula o
molécula ya desarrollado de forma
asexual.
 Se parte de un animal "desarrollado”
interés por obtener copias de
un animal. Sólo cuando es adulto conocemos sus características.
 Creación de forma asexual
la reproducción sexual no nos
permite obtener copias idénticas, genera diversidad.
¿ Como surgió la CLONACIÓN?
INTERÉS : proporcionar animales
transgénicos idénticos que
secreten productos farmacéuticos
en su leche >> factores de
coagulación sanguíneo; insulina.

• Lactoferrina
• Lisozima
Quién fue Dolly??
-1997Wilmut
Los clones pueden
presentar:

1º mamífero creado a
partir de una célula
adulta
Producida por
transferencia nuclear

Mayor riesgo de enfermedades genéticas o cáncer debido a la
acumulación de mutaciones en el núcleo adulto.
Envejecimiento prematuro por presencia de telómeros más cortos.
Desarrollo anormal.
La CLONACIÓN promete…
 Conservar y reproducir especies en peligro de
extinción.
 Curar enfermedades genéticas en animales de
granja.
 Proporcionar modelos animales de enfermedades
humanas para los que todavía no hay modelos de
investigación.
CLONACIÓN
NATURAL

ARTIFICIAL
Molecular
Celular
Reproductiva
TERAPÉUTICA
La clonación terapéutica es la transferencia de
material nuclear aislado de una célula somática a
un ovocito enucleado formando de este modo un
embrión que no está destinado a la transferencia
en el útero sino para obtener células con el mismo
genoma que el donante nuclear.
¿ Cuál es la diferencia con la clonación reproductiva?

Fuente: Fischbach and Fischbach
Gran potencial para crear varios tipos de tejidos
Evitaría el uso de fármacos inmunosupresores con fuertes
efectos secundarios
Podría salvar un número incontable de vidas, y aumentar
la calidad de vida de muchos otros
Comparando con el trasplante de órganos…
- Ningún peligro de rechazo de trasplante
- No haría falta que alguien muera para salvar a otra persona
- El paciente no recibiría un órgano viejo y con funcionalidad
reducida
- Podría salvar vidas que de otro modo no podrían salvarse
El ADN extraído de la persona donante se puede manipular
genéticamente introduciendole trans-genes con el fin de:
- Extender la longevidad de las células trasplantadas
- Ayudar a la interacción de las células trasplantadas con el tejido del huésped
- Inducir la regeneración de los tejidos del huésped
Baja disponibilidad de oocitos con fines de investigación
«Síndrome de hiperestimulación ovárica»
Grandes variaciones en la capacidad de los diferentes tipos de
tejidos adultos para apoyar con éxito la transferencia nuclear

La edad del donante es una problema por la integridad de su genoma
Posibilidad de mutación de células madres
¿Que son las células madres?
Propiedades de las células madres
¿Qué es la transferencia nuclear?
¿Cuál es su relación con la clonación terapéutica?
Mecanismo de la clonación terapéutica
Alternativas para la clonación terapéutica
PARA RECORDAR………

¿Que son las células madres?
Una célula madre es una célula que tiene la
capacidad de autorrenovarse mediante
divisiones
mitótica o bien de continuar la vía de
diferenciación para la que está programada y,
por lo tanto, producir células de uno o más
tejidos maduros, funcionales y plenamente
diferenciados.

Fuente: Barreno, 2003
¿Que son las células madres?
Propiedades de las células madres
¿Qué es la transferencia nuclear?
¿Cuál es su relación con la clonación terapéutica?
Mecanismo de la clonación terapéutica
Alternativas para la clonación terapéutica
SEGUIMOS RECORDANDO…

¿ Cuáles son las propiedades de las células madres?
Células indiferenciadas
Se han identificado en varios tejidos adultos

Capaces de proliferar y autorregularse

Capacidad para regenerar tejidos
¿Que son las células madres?
Propiedades de las células madres
¿Qué es la transferencia nuclear?
¿Cuál es su relación con la clonación terapéutica?
Mecanismo de la clonación terapéutica
Alternativas para la clonación terapéutica
¿ Qué es la transferencia nuclear?
PASOS:
Enucleación del oocito
- Micro-manipulación
- Métodos químicos

Transferencia del núcleo
- Electofusión
- Micro-inyección

Activación del oocito
- Estímulo químico

Fuente: Colman and Kind

Pero…. ¿Cuál es su relación
con la clonación terapéutica?
¿Que son las células madres?
Propiedades de las células madres
¿Qué es la transferencia nuclear?
¿Cuál es su relación con la clonación terapéutica?
Mecanismo de la clonación terapéutica
Alternativas para la clonación terapéutica
¿ Cuál es su relación con la clonación terapéutica?

«Las células obtenidas mediante esta técnica
son genéticamente idénticas al núcleo
donante, se podría utilizar para el trasplante
celular en el donante sin temor a que se
produjera un rechazo por causas
inmunitarias»

Fuente: Colman and Kind
¿Que son las células madres?
Propiedades de las células madres
¿Qué es la transferencia nuclear?
¿Cuál es su relación con la clonación terapéutica?
Mecanismo de la clonación terapéutica
Alternativas para la clonación terapéutica
MECANISMO DE LA CLONACIÓN TERAPÉUTICA…
1- TRANSFERENCIA NUCLEAR
2- DIVISIÓN DEL CIGOTO

Fuente: Fischbach and Fischbach
3- FORMACIÓN DE LÍNEAS CELULARES

Fuente: Fischbach and Fischbach
4- INCORPORACIÓN DE LAS CÉLULAS AL PACIENTE ENFERMO

Fuente: Kirschstein and Skirboll, 2001
5- ¿CÓMO LLEGAN LAS CÉLULAS A SU DESTINO Y CÓMO SE
ACTIVAN EN DICHO TEJIDO?

Fuente:Blau, Brazelton and Weimann, 2001
¿Que son las células madres?
Propiedades de las células madres
¿Qué es la transferencia nuclear?
¿Cuál es su relación con la clonación terapéutica?
Mecanismo de la clonación terapéutica
Alternativas para la clonación terapéutica
ALTERNATIVAS PARA EVITAR LA CLONACIÓN TERAPÉUTICA…

Fuente: Colman and Kind
IN VIVO……

Fuente: Kirschstein and Skirboll, 2001
• Ambos alelos se expresan simultáneamente
• Expresión monoalélica
IMPRINTING: DETERMINACIÓN DEL SEXO
EXPERIMENTOS DE TRANSPLANTE DE NÚCLEO

que para un normal desarrollo se requiere la
contribución tanto del genoma materno
como del paterno
Ratón partenogenético o
Ratón partenogenético o
ginogenético
ginogenético

Ratón androgenético
Ratón androgenético

LOS GENES EXPRESADOS PROVENIENTES DE CADA
PROGENITOR NO SON LOS MISMOS
Pero…
Fenómeno epigenético en el cual algunos genes
son expresados a partir de un solo alelo (que
depende del progenitor)

se produce una marca que distingue a los alelos paternos y
tiene como resultado la expresión de un patrón
monoalelíco parental específico
MARCA EPIGENÉTICA

Metilaciones
Modificaciones de histona
IMPORTANTES PARA EL DESARROLLO
NORMAL DEL ORGANISMO
El hecho de que sólo uno de los dos alelos se pueda expresar expone aaun
El hecho de que sólo uno de los dos alelos se pueda expresar expone un
gran riesgo genómico debido aaque una mutación (genética o epigenética)
gran riesgo genómico debido que una mutación (genética o epigenética)
SÍNDROME DE BECKWITH-WIEDEMANN
SÍNDROME DE BECKWITH-WIEDEMANN

SÍNDROME DE SILVER-RUSSELL
SÍNDROME DE SILVER-RUSSELL
SÍNDROME DE PRADER-WILLI
SÍNDROME DE PRADER-WILLI

SÍNDROME DE ANGELMAN
SÍNDROME DE ANGELMAN
¿Cuáles son sus funciones?
¿Dónde se encuentran?
¿Cómo se encuentran?
Genes de ambos padres que se expresan
Regiones de control de impresión

Bartolomei 2009, GENES & DEVELOPMENT 23:2124–2133
GENES METILADOS

ATTGCTTCGCGCGGCCGTCGCTCGATCGCGCGCGATGCTAGCTGATTCGTAGCTAGCTACGTATGCTCTCTAGCCGATC

¡¡GEN NO SE TRANSCRIBE!!
GENES NO METILADOS

ATTGCTTCGCGCGGCCGTCGCTCGATCGCGCGCGATGCTAGCTGATTCGTAGCTAGCTACGTATGCTCTCTAGCCGATC

¡¡¡GEN SE TRANSCRIBE!!!
DEJA SIN EFECTO EL SILENCIAMIENTO
DE GENES IMPRESOS O SILENCIA GENES
NO IMPRESOS
PERO…
La impresión genómica puede causar problemas
en la clonación
en los clones muchas veces en DNA no
está metilado en la posición correcta

ESTO SE DEBE AL TIEMPO
ESTO SE DEBE AL TIEMPO
DE REPROGRAMACIÓN
DE REPROGRAMACIÓN
APLICACIONES DE LA CLONACIÓN
TERAPÉUTICA
Medicina regenerativa
+
Ingeniería en tejidos

Restaurar forma y función de
órganos y tejidos dañados

TRASPLANTE DE ÓRGANOS
CLONACIÓN TERAPÉUTICA

CÉLULAS EMBRIONARIAS

Escases de donantes
+ Factores de crecimiento e
inductores de diferenciación

CÉLULAS MADRES EMBRIONARIAS
CÉLULAS MADRES EMBRIONARIAS
Habilidad de proliferar en un estado pluripotente de
desdiferenciación.
C.J. Koh, A. Atala, 2004

Células clonadas, reconocidas
como propias

NO son rechazadas por
el sistema inmune
Reporte en modelos animales
Blastocitos de ratón clonado

Lanza et al

Mismas propiedades
morfológicas y marcadores
de expresión que blastocito
normal.
Rideot et al

TEJIDO SANGUÍNEO
TEJIDO SANGUÍNEO
Trasferencia

Núcleos somáticos de ratones
inmunodeficientes

Oocitos anucelados

Blastocitos clonados,
celulas madres

Reconstitición de
tejido
hematopoyético

Trasplante

Diferenciación

Progenitores hematopoyéticos
Otro estudio…

Clonado terapéutico
+
Ingeniería genética

CORAZÓN
CORAZÓN
Músculo cardíaco
clonado con IGUAL
material genético que la
vaca donante.
Blastocito implantado para su
crecimiento in vivo. Células
recolectadas y expandidas in
vitro.
6 semanas después del
trasplante, recuperadas.

Buena organización
celular y vascularización.
PÁNCREAS
PÁNCREAS

D'Amour et al , 2006

Diferenciación

Células madres embrionarias

Células endócrinas

Glucagón e insulina

Tratamiento de
Diabetes Mellitus
Trasplante

Células embrionarias clonadas
del paciente se diferenciarían en
células de la organogénesis del
páncreas
PARKINSON
PARKINSON
Síntomas:
Pérdida progresiva del control motor
Temblores
Rigidez muscular
Debido a… degeneración de neuronas dopaminérgidas.

¡SOLUCIÓN!
Concentración local de dopamina

No detiene la
progresión de la
enfermedad, efectos
secundarios.
¿ Alternativa??
Neuronas derivadas de células embrionarias humanas!!

Astrocitos

Oligodentroglías

Neuronas maduras

Respondieron a neurotransmisores, contuvieron canales dependientes
de voltaje, respondieron a acciones despolarizantes.
Progenitores neurales,
incorporados en el
parénquima cerebral del
ratón.

Se siguió en VIVO :
diferenciación en los tres tipos
fundamentales de neuronas.
Barbieri, et al

Obtuvieron por SCNT de células de la cola de un ratón
células madres embrionarias.
Interneuronas GABA minérgidas
Neuronas serotoninérgidas
Neuronas dopaminérgidas
Inyectadas en el cuerpo cortical
estriado de ratones con Parkinson.
80% de las neuronas vivieron 8
sem. post- transplante
CONCLUSIÓN
Estos estudios muestran que células derivadas del clonado
terapéutico :
Pueden ser exitosamente recolectadas;
Expandidas en cultivo;
Trasplantadas in vivo;
Organizarse en tejidos genética e inmuno- compatibles.
PERSONALISMO
Considera a la “persona” como la manifestación concreta de la
naturaleza humana, de procedencia divina y, por consecuencia,
receptáculo de valores trascendentes.

HUMANISMO SECULAR
Se fundamenta conocimiento de lo humano desde una perspectiva
científica, en donde el hombre es quien genera los valores y es el
responsable de su destino.
“el estudio sistemático de las dimensiones
morales —visión moral, decisiones, conducta
y políticas— de las ciencias de la vida y la
atención a la salud, empleando diversas
metodologías éticas, con una orientación
interdisciplinaria”
Reemplazo de la vida
Producción de un ser -> atenta contra la identidad e
irrepetibilidad propia de la persona
Implica aceptar el dominio de unos sobre otros
Se violan ciertos derechos humanos
Limitación de la reproducción a su dimensión
biológica
Uso arbitrario del cuerpo humano como máquina
Cuestionamiento de si es ético modificar a voluntad
otro ser
¿Se asumen las consecuencias?
NUNCA ES LÍCITO USAR PERSONAS COMO UN
MEDIO… SON UN FÍN EN SI MISMA
Somos personas desde el momento de la
fecundación
En fin…
LOS EMBRIONES MANIPULADOS SON PERSONAS
IGUAL QUE NOSOTROS Y OCUPARLOS CON UN
FIN ES UN ATENTADO CONTRA SU SER Y
DERECHOS
Es preponderante lo que pueda traer beneficio a la
humanidad
Homo sapiens ser cuyas características tienen su
fuente en procesos biológicos y no en un alma
inmaterial
El hombre no es persona desde la fecundación, sino
que se “hace persona” en un momento posterior que
puede ser…
• En la fase de desarrollo embrionario que corresponde a
la implantación del cigoto.
• En el momento de la formación de la línea embrionaria
cuando el conjunto de células pierden la
totipotencialidad.
• En cuanto inicia la formación del sistema nervioso
central, condición de posibilidad para la percepción del
bienestar y el sufrimiento.
• En cuanto inicia la formación de la corteza cerebral.
• En el momento de la adquisición de la autoconciencia o
en el momento de la manifestación de la capacidad de
intelección y de autodeterminación.
Atribuye a los padres el derecho sobre sus
hijos y, por lo tanto, sobre sus embriones.
Legitimiza la utilización de embriones bajo dos
conceptos:
Atribución de titularidad de derecho sólo a aquellos
que tienen capacidad sensorial y sensibilidad al dolor
Mayor bien para el mayor número
En fin…
SUGIERE QUE SE REALICE CLONACIÓN DE SERES
HUMANOS SIEMPRE QUE TENGA UNA ADECUADA
REGLAMENTACIÓN
Para poder tomar una postura con respecto a temas así
es muy importante estar informado para que nuestra
postura esté bien fundamentada.
Toda discusión y controversia debe tener como
meta el progreso, no una victoria personal.
J. Joubert
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll
Genetica y-clonacionolll

Más contenido relacionado

La actualidad más candente

Determinación del sexo e hipótesis de Lyon
Determinación del sexo e hipótesis de Lyon Determinación del sexo e hipótesis de Lyon
Determinación del sexo e hipótesis de Lyon CiberGeneticaUNAM
 
Mitosis y miosis viviana gomez
Mitosis y miosis viviana gomezMitosis y miosis viviana gomez
Mitosis y miosis viviana gomezvivianagomez75
 
2017 asesoría embrio ciclo celular, mitosis, meiosis.
2017  asesoría embrio  ciclo celular, mitosis, meiosis.2017  asesoría embrio  ciclo celular, mitosis, meiosis.
2017 asesoría embrio ciclo celular, mitosis, meiosis.Jorge Alegría Baños
 
Clonación
ClonaciónClonación
Clonaciónleoplan2
 
citogenetica clinica
citogenetica clinicacitogenetica clinica
citogenetica clinicayojan
 
LA CIENCIA GENÉTICA
LA CIENCIA GENÉTICA LA CIENCIA GENÉTICA
LA CIENCIA GENÉTICA Clau Pjef
 
Principios de citogenética
Principios de citogenéticaPrincipios de citogenética
Principios de citogenéticaULEAM
 
La RevolucióN GenéTica 2009 10
La RevolucióN GenéTica 2009 10La RevolucióN GenéTica 2009 10
La RevolucióN GenéTica 2009 10Alberto Hernandez
 
Arreglos del ADN Y Cromosomas (Genética Médica)
Arreglos del ADN Y Cromosomas (Genética Médica)Arreglos del ADN Y Cromosomas (Genética Médica)
Arreglos del ADN Y Cromosomas (Genética Médica)Bryan Fernando Reyes
 

La actualidad más candente (20)

Determinación del sexo e hipótesis de Lyon
Determinación del sexo e hipótesis de Lyon Determinación del sexo e hipótesis de Lyon
Determinación del sexo e hipótesis de Lyon
 
La clonación
La clonaciónLa clonación
La clonación
 
Mitosis y miosis viviana gomez
Mitosis y miosis viviana gomezMitosis y miosis viviana gomez
Mitosis y miosis viviana gomez
 
2017 asesoría embrio ciclo celular, mitosis, meiosis.
2017  asesoría embrio  ciclo celular, mitosis, meiosis.2017  asesoría embrio  ciclo celular, mitosis, meiosis.
2017 asesoría embrio ciclo celular, mitosis, meiosis.
 
Ensayo j carvajal_52_b2
Ensayo j carvajal_52_b2Ensayo j carvajal_52_b2
Ensayo j carvajal_52_b2
 
La clonacion
La clonacion La clonacion
La clonacion
 
Clonación
ClonaciónClonación
Clonación
 
Citogenetica humana
Citogenetica humanaCitogenetica humana
Citogenetica humana
 
citogenetica clinica
citogenetica clinicacitogenetica clinica
citogenetica clinica
 
LA CIENCIA GENÉTICA
LA CIENCIA GENÉTICA LA CIENCIA GENÉTICA
LA CIENCIA GENÉTICA
 
Unidad 1.4ºeso
Unidad 1.4ºesoUnidad 1.4ºeso
Unidad 1.4ºeso
 
Clonacion 2011
Clonacion 2011Clonacion 2011
Clonacion 2011
 
Principios de citogenética
Principios de citogenéticaPrincipios de citogenética
Principios de citogenética
 
Cervantes canto lilianaelena_m16s2_elciclocelular
Cervantes canto lilianaelena_m16s2_elciclocelularCervantes canto lilianaelena_m16s2_elciclocelular
Cervantes canto lilianaelena_m16s2_elciclocelular
 
Citogenetica
CitogeneticaCitogenetica
Citogenetica
 
La RevolucióN GenéTica 2009 10
La RevolucióN GenéTica 2009 10La RevolucióN GenéTica 2009 10
La RevolucióN GenéTica 2009 10
 
Gametogénesis
GametogénesisGametogénesis
Gametogénesis
 
Arreglos del ADN Y Cromosomas (Genética Médica)
Arreglos del ADN Y Cromosomas (Genética Médica)Arreglos del ADN Y Cromosomas (Genética Médica)
Arreglos del ADN Y Cromosomas (Genética Médica)
 
Genética y comportamiento
Genética y comportamientoGenética y comportamiento
Genética y comportamiento
 
Ciclo celular
Ciclo celularCiclo celular
Ciclo celular
 

Destacado

Donbosco 120425082257-phpapp02
Donbosco 120425082257-phpapp02Donbosco 120425082257-phpapp02
Donbosco 120425082257-phpapp02buesa
 
El cáncer
El cáncerEl cáncer
El cáncerbuesa
 
Genoma humano
Genoma humanoGenoma humano
Genoma humanobuesa
 
Anarquismo
Anarquismo Anarquismo
Anarquismo buesa
 
Guerra Nuclear, biológica y quimica
 Guerra Nuclear, biológica y quimica Guerra Nuclear, biológica y quimica
Guerra Nuclear, biológica y quimicaJorge Ibarra Ferado
 
Manipulacion genetica religion
Manipulacion genetica religionManipulacion genetica religion
Manipulacion genetica religioncaatheerinee95
 
Presentacion manipulación genética dhtic
Presentacion manipulación genética dhticPresentacion manipulación genética dhtic
Presentacion manipulación genética dhticJose Eduardo Moxo Perez
 
Ética y Valores II Bioética
Ética y Valores II  BioéticaÉtica y Valores II  Bioética
Ética y Valores II BioéticaAnaLaura
 
Manipulación genética
Manipulación genéticaManipulación genética
Manipulación genéticaJuan Quintana
 
LinkedIn SlideShare: Knowledge, Well-Presented
LinkedIn SlideShare: Knowledge, Well-PresentedLinkedIn SlideShare: Knowledge, Well-Presented
LinkedIn SlideShare: Knowledge, Well-PresentedSlideShare
 

Destacado (17)

Donbosco 120425082257-phpapp02
Donbosco 120425082257-phpapp02Donbosco 120425082257-phpapp02
Donbosco 120425082257-phpapp02
 
El cáncer
El cáncerEl cáncer
El cáncer
 
Genoma humano
Genoma humanoGenoma humano
Genoma humano
 
Anarquismo
Anarquismo Anarquismo
Anarquismo
 
La Clonación
La ClonaciónLa Clonación
La Clonación
 
Clonacion huama
Clonacion huama Clonacion huama
Clonacion huama
 
Guerra Nuclear, biológica y quimica
 Guerra Nuclear, biológica y quimica Guerra Nuclear, biológica y quimica
Guerra Nuclear, biológica y quimica
 
Bioética.camila sanchez
Bioética.camila sanchezBioética.camila sanchez
Bioética.camila sanchez
 
Que es la bioetica?
Que es la bioetica?Que es la bioetica?
Que es la bioetica?
 
Manipulacion genetica religion
Manipulacion genetica religionManipulacion genetica religion
Manipulacion genetica religion
 
Clonación terapéutica.
Clonación terapéutica.Clonación terapéutica.
Clonación terapéutica.
 
Manipulacion genetica
Manipulacion geneticaManipulacion genetica
Manipulacion genetica
 
Clonacion
ClonacionClonacion
Clonacion
 
Presentacion manipulación genética dhtic
Presentacion manipulación genética dhticPresentacion manipulación genética dhtic
Presentacion manipulación genética dhtic
 
Ética y Valores II Bioética
Ética y Valores II  BioéticaÉtica y Valores II  Bioética
Ética y Valores II Bioética
 
Manipulación genética
Manipulación genéticaManipulación genética
Manipulación genética
 
LinkedIn SlideShare: Knowledge, Well-Presented
LinkedIn SlideShare: Knowledge, Well-PresentedLinkedIn SlideShare: Knowledge, Well-Presented
LinkedIn SlideShare: Knowledge, Well-Presented
 

Similar a Genetica y-clonacionolll

Similar a Genetica y-clonacionolll (20)

La clonación
La clonaciónLa clonación
La clonación
 
Clonacion y genetica parte 1
Clonacion y genetica parte 1Clonacion y genetica parte 1
Clonacion y genetica parte 1
 
Clonacion
ClonacionClonacion
Clonacion
 
La clonación
La clonaciónLa clonación
La clonación
 
Clonacion humana aspectos juridicos y derechos humanos
Clonacion humana aspectos juridicos y derechos humanosClonacion humana aspectos juridicos y derechos humanos
Clonacion humana aspectos juridicos y derechos humanos
 
Tipos_de_Clonacion.pptx
Tipos_de_Clonacion.pptxTipos_de_Clonacion.pptx
Tipos_de_Clonacion.pptx
 
La clonación
La clonación La clonación
La clonación
 
Aplicaciones de la clonación
Aplicaciones de la clonaciónAplicaciones de la clonación
Aplicaciones de la clonación
 
Clonacion
ClonacionClonacion
Clonacion
 
De células adultas a células madre. 09/10 CMC 1º Bach
De células adultas a células madre. 09/10 CMC 1º BachDe células adultas a células madre. 09/10 CMC 1º Bach
De células adultas a células madre. 09/10 CMC 1º Bach
 
Biotecnologia
BiotecnologiaBiotecnologia
Biotecnologia
 
GenéTica
GenéTicaGenéTica
GenéTica
 
Clonación Animal
Clonación AnimalClonación Animal
Clonación Animal
 
Clonacionc
ClonacioncClonacionc
Clonacionc
 
Clonacionc
ClonacioncClonacionc
Clonacionc
 
Clonación bioquimica
Clonación bioquimicaClonación bioquimica
Clonación bioquimica
 
Clonacion 2011
Clonacion 2011Clonacion 2011
Clonacion 2011
 
La clonación...
La clonación...La clonación...
La clonación...
 
La clonación
La clonaciónLa clonación
La clonación
 
Clonación
ClonaciónClonación
Clonación
 

Último

Imágenes de documento con firma de Juan Guaidó.pdf
Imágenes de documento con firma de Juan Guaidó.pdfImágenes de documento con firma de Juan Guaidó.pdf
Imágenes de documento con firma de Juan Guaidó.pdfteleSUR TV
 
Conversación traducida de amenazas contra la periodista.pdf
Conversación traducida de amenazas contra la periodista.pdfConversación traducida de amenazas contra la periodista.pdf
Conversación traducida de amenazas contra la periodista.pdfteleSUR TV
 
Imágenes de amenazas traducidas - Williams.pdf
Imágenes de amenazas traducidas - Williams.pdfImágenes de amenazas traducidas - Williams.pdf
Imágenes de amenazas traducidas - Williams.pdfteleSUR TV
 
Por la designación de la jueza transitoria del Juzgado de Instrucción nº 1 de...
Por la designación de la jueza transitoria del Juzgado de Instrucción nº 1 de...Por la designación de la jueza transitoria del Juzgado de Instrucción nº 1 de...
Por la designación de la jueza transitoria del Juzgado de Instrucción nº 1 de...Eduardo Nelson German
 
Informe sobre el Bono Verde en el Parque Eólico Arauco
Informe sobre el Bono Verde en el Parque Eólico AraucoInforme sobre el Bono Verde en el Parque Eólico Arauco
Informe sobre el Bono Verde en el Parque Eólico AraucoEduardo Nelson German
 
Estados Financieros - Programa Federal Plurianual de Construcción de Viviendas
Estados Financieros - Programa Federal Plurianual de Construcción de ViviendasEstados Financieros - Programa Federal Plurianual de Construcción de Viviendas
Estados Financieros - Programa Federal Plurianual de Construcción de ViviendasEduardo Nelson German
 
Parque Eólico Arauco: Reporte sobre el Estado de Aplicación de Fondos
Parque Eólico Arauco: Reporte sobre el Estado de Aplicación de FondosParque Eólico Arauco: Reporte sobre el Estado de Aplicación de Fondos
Parque Eólico Arauco: Reporte sobre el Estado de Aplicación de FondosEduardo Nelson German
 
Boletin semanal informativo 19. Mayo 2024.pdf
Boletin semanal informativo 19. Mayo 2024.pdfBoletin semanal informativo 19. Mayo 2024.pdf
Boletin semanal informativo 19. Mayo 2024.pdfNueva Canarias-BC
 
Entra en vigencia sanciones contra padres que incumplen manutención
Entra en vigencia sanciones contra padres que incumplen manutenciónEntra en vigencia sanciones contra padres que incumplen manutención
Entra en vigencia sanciones contra padres que incumplen manutenciónpegazohn1978
 
Denuncia realizada por la periodistas.pdf
Denuncia realizada por la periodistas.pdfDenuncia realizada por la periodistas.pdf
Denuncia realizada por la periodistas.pdfteleSUR TV
 
ESTIMULOS FISCALES SEGUN LA LEY DEL ISR.
ESTIMULOS FISCALES SEGUN LA LEY DEL ISR.ESTIMULOS FISCALES SEGUN LA LEY DEL ISR.
ESTIMULOS FISCALES SEGUN LA LEY DEL ISR.21680564
 
PRECIOS_M_XIMOS_VIGENTES_DEL_12_AL_18_DE_MAYO_DE_2024.pdf
PRECIOS_M_XIMOS_VIGENTES_DEL_12_AL_18_DE_MAYO_DE_2024.pdfPRECIOS_M_XIMOS_VIGENTES_DEL_12_AL_18_DE_MAYO_DE_2024.pdf
PRECIOS_M_XIMOS_VIGENTES_DEL_12_AL_18_DE_MAYO_DE_2024.pdfredaccionxalapa
 
Imágenes de documentos originales de HSH.pdf
Imágenes de documentos originales de HSH.pdfImágenes de documentos originales de HSH.pdf
Imágenes de documentos originales de HSH.pdfteleSUR TV
 
CAMARA OLIVICOLA RIOJANA ( COR) Y OTRO c/ SECRETARIA DE ENERGIA DE LA NACION ...
CAMARA OLIVICOLA RIOJANA ( COR) Y OTRO c/ SECRETARIA DE ENERGIA DE LA NACION ...CAMARA OLIVICOLA RIOJANA ( COR) Y OTRO c/ SECRETARIA DE ENERGIA DE LA NACION ...
CAMARA OLIVICOLA RIOJANA ( COR) Y OTRO c/ SECRETARIA DE ENERGIA DE LA NACION ...Eduardo Nelson German
 
PRECIOS_M_XIMOS_VIGENTES_DEL_19_AL_25_DE_MAYO_DE_2024.pdf
PRECIOS_M_XIMOS_VIGENTES_DEL_19_AL_25_DE_MAYO_DE_2024.pdfPRECIOS_M_XIMOS_VIGENTES_DEL_19_AL_25_DE_MAYO_DE_2024.pdf
PRECIOS_M_XIMOS_VIGENTES_DEL_19_AL_25_DE_MAYO_DE_2024.pdfredaccionxalapa
 
Impacto del desplazamiento como consecuencia de las etapas de gentrificación...
Impacto del desplazamiento como consecuencia de las etapas de gentrificación...Impacto del desplazamiento como consecuencia de las etapas de gentrificación...
Impacto del desplazamiento como consecuencia de las etapas de gentrificación...Kenneth Cortés
 

Último (17)

Imágenes de documento con firma de Juan Guaidó.pdf
Imágenes de documento con firma de Juan Guaidó.pdfImágenes de documento con firma de Juan Guaidó.pdf
Imágenes de documento con firma de Juan Guaidó.pdf
 
Conversación traducida de amenazas contra la periodista.pdf
Conversación traducida de amenazas contra la periodista.pdfConversación traducida de amenazas contra la periodista.pdf
Conversación traducida de amenazas contra la periodista.pdf
 
Imágenes de amenazas traducidas - Williams.pdf
Imágenes de amenazas traducidas - Williams.pdfImágenes de amenazas traducidas - Williams.pdf
Imágenes de amenazas traducidas - Williams.pdf
 
Por la designación de la jueza transitoria del Juzgado de Instrucción nº 1 de...
Por la designación de la jueza transitoria del Juzgado de Instrucción nº 1 de...Por la designación de la jueza transitoria del Juzgado de Instrucción nº 1 de...
Por la designación de la jueza transitoria del Juzgado de Instrucción nº 1 de...
 
Informe sobre el Bono Verde en el Parque Eólico Arauco
Informe sobre el Bono Verde en el Parque Eólico AraucoInforme sobre el Bono Verde en el Parque Eólico Arauco
Informe sobre el Bono Verde en el Parque Eólico Arauco
 
LA CRÓNICA COMARCA DE ANTEQUERA _ Nº 1081
LA CRÓNICA COMARCA DE ANTEQUERA _ Nº 1081LA CRÓNICA COMARCA DE ANTEQUERA _ Nº 1081
LA CRÓNICA COMARCA DE ANTEQUERA _ Nº 1081
 
Estados Financieros - Programa Federal Plurianual de Construcción de Viviendas
Estados Financieros - Programa Federal Plurianual de Construcción de ViviendasEstados Financieros - Programa Federal Plurianual de Construcción de Viviendas
Estados Financieros - Programa Federal Plurianual de Construcción de Viviendas
 
Parque Eólico Arauco: Reporte sobre el Estado de Aplicación de Fondos
Parque Eólico Arauco: Reporte sobre el Estado de Aplicación de FondosParque Eólico Arauco: Reporte sobre el Estado de Aplicación de Fondos
Parque Eólico Arauco: Reporte sobre el Estado de Aplicación de Fondos
 
Boletin semanal informativo 19. Mayo 2024.pdf
Boletin semanal informativo 19. Mayo 2024.pdfBoletin semanal informativo 19. Mayo 2024.pdf
Boletin semanal informativo 19. Mayo 2024.pdf
 
Entra en vigencia sanciones contra padres que incumplen manutención
Entra en vigencia sanciones contra padres que incumplen manutenciónEntra en vigencia sanciones contra padres que incumplen manutención
Entra en vigencia sanciones contra padres que incumplen manutención
 
Denuncia realizada por la periodistas.pdf
Denuncia realizada por la periodistas.pdfDenuncia realizada por la periodistas.pdf
Denuncia realizada por la periodistas.pdf
 
ESTIMULOS FISCALES SEGUN LA LEY DEL ISR.
ESTIMULOS FISCALES SEGUN LA LEY DEL ISR.ESTIMULOS FISCALES SEGUN LA LEY DEL ISR.
ESTIMULOS FISCALES SEGUN LA LEY DEL ISR.
 
PRECIOS_M_XIMOS_VIGENTES_DEL_12_AL_18_DE_MAYO_DE_2024.pdf
PRECIOS_M_XIMOS_VIGENTES_DEL_12_AL_18_DE_MAYO_DE_2024.pdfPRECIOS_M_XIMOS_VIGENTES_DEL_12_AL_18_DE_MAYO_DE_2024.pdf
PRECIOS_M_XIMOS_VIGENTES_DEL_12_AL_18_DE_MAYO_DE_2024.pdf
 
Imágenes de documentos originales de HSH.pdf
Imágenes de documentos originales de HSH.pdfImágenes de documentos originales de HSH.pdf
Imágenes de documentos originales de HSH.pdf
 
CAMARA OLIVICOLA RIOJANA ( COR) Y OTRO c/ SECRETARIA DE ENERGIA DE LA NACION ...
CAMARA OLIVICOLA RIOJANA ( COR) Y OTRO c/ SECRETARIA DE ENERGIA DE LA NACION ...CAMARA OLIVICOLA RIOJANA ( COR) Y OTRO c/ SECRETARIA DE ENERGIA DE LA NACION ...
CAMARA OLIVICOLA RIOJANA ( COR) Y OTRO c/ SECRETARIA DE ENERGIA DE LA NACION ...
 
PRECIOS_M_XIMOS_VIGENTES_DEL_19_AL_25_DE_MAYO_DE_2024.pdf
PRECIOS_M_XIMOS_VIGENTES_DEL_19_AL_25_DE_MAYO_DE_2024.pdfPRECIOS_M_XIMOS_VIGENTES_DEL_19_AL_25_DE_MAYO_DE_2024.pdf
PRECIOS_M_XIMOS_VIGENTES_DEL_19_AL_25_DE_MAYO_DE_2024.pdf
 
Impacto del desplazamiento como consecuencia de las etapas de gentrificación...
Impacto del desplazamiento como consecuencia de las etapas de gentrificación...Impacto del desplazamiento como consecuencia de las etapas de gentrificación...
Impacto del desplazamiento como consecuencia de las etapas de gentrificación...
 

Genetica y-clonacionolll

  • 1.
  • 3.
  • 4. ¿¿ Qué es la CLONACIÓN ?? Proceso por el que se consiguen copias idénticas de un organismo, célula o molécula ya desarrollado de forma asexual.  Se parte de un animal "desarrollado” interés por obtener copias de un animal. Sólo cuando es adulto conocemos sus características.  Creación de forma asexual la reproducción sexual no nos permite obtener copias idénticas, genera diversidad.
  • 5. ¿ Como surgió la CLONACIÓN? INTERÉS : proporcionar animales transgénicos idénticos que secreten productos farmacéuticos en su leche >> factores de coagulación sanguíneo; insulina. • Lactoferrina • Lisozima
  • 6. Quién fue Dolly?? -1997Wilmut Los clones pueden presentar: 1º mamífero creado a partir de una célula adulta Producida por transferencia nuclear Mayor riesgo de enfermedades genéticas o cáncer debido a la acumulación de mutaciones en el núcleo adulto. Envejecimiento prematuro por presencia de telómeros más cortos. Desarrollo anormal.
  • 7. La CLONACIÓN promete…  Conservar y reproducir especies en peligro de extinción.  Curar enfermedades genéticas en animales de granja.  Proporcionar modelos animales de enfermedades humanas para los que todavía no hay modelos de investigación.
  • 9.
  • 10. La clonación terapéutica es la transferencia de material nuclear aislado de una célula somática a un ovocito enucleado formando de este modo un embrión que no está destinado a la transferencia en el útero sino para obtener células con el mismo genoma que el donante nuclear.
  • 11. ¿ Cuál es la diferencia con la clonación reproductiva? Fuente: Fischbach and Fischbach
  • 12. Gran potencial para crear varios tipos de tejidos Evitaría el uso de fármacos inmunosupresores con fuertes efectos secundarios Podría salvar un número incontable de vidas, y aumentar la calidad de vida de muchos otros
  • 13. Comparando con el trasplante de órganos… - Ningún peligro de rechazo de trasplante - No haría falta que alguien muera para salvar a otra persona - El paciente no recibiría un órgano viejo y con funcionalidad reducida - Podría salvar vidas que de otro modo no podrían salvarse El ADN extraído de la persona donante se puede manipular genéticamente introduciendole trans-genes con el fin de: - Extender la longevidad de las células trasplantadas - Ayudar a la interacción de las células trasplantadas con el tejido del huésped - Inducir la regeneración de los tejidos del huésped
  • 14. Baja disponibilidad de oocitos con fines de investigación «Síndrome de hiperestimulación ovárica» Grandes variaciones en la capacidad de los diferentes tipos de tejidos adultos para apoyar con éxito la transferencia nuclear La edad del donante es una problema por la integridad de su genoma Posibilidad de mutación de células madres
  • 15.
  • 16. ¿Que son las células madres? Propiedades de las células madres ¿Qué es la transferencia nuclear? ¿Cuál es su relación con la clonación terapéutica? Mecanismo de la clonación terapéutica Alternativas para la clonación terapéutica
  • 17. PARA RECORDAR……… ¿Que son las células madres? Una célula madre es una célula que tiene la capacidad de autorrenovarse mediante divisiones mitótica o bien de continuar la vía de diferenciación para la que está programada y, por lo tanto, producir células de uno o más tejidos maduros, funcionales y plenamente diferenciados. Fuente: Barreno, 2003
  • 18. ¿Que son las células madres? Propiedades de las células madres ¿Qué es la transferencia nuclear? ¿Cuál es su relación con la clonación terapéutica? Mecanismo de la clonación terapéutica Alternativas para la clonación terapéutica
  • 19. SEGUIMOS RECORDANDO… ¿ Cuáles son las propiedades de las células madres? Células indiferenciadas Se han identificado en varios tejidos adultos Capaces de proliferar y autorregularse Capacidad para regenerar tejidos
  • 20. ¿Que son las células madres? Propiedades de las células madres ¿Qué es la transferencia nuclear? ¿Cuál es su relación con la clonación terapéutica? Mecanismo de la clonación terapéutica Alternativas para la clonación terapéutica
  • 21. ¿ Qué es la transferencia nuclear? PASOS: Enucleación del oocito - Micro-manipulación - Métodos químicos Transferencia del núcleo - Electofusión - Micro-inyección Activación del oocito - Estímulo químico Fuente: Colman and Kind Pero…. ¿Cuál es su relación con la clonación terapéutica?
  • 22. ¿Que son las células madres? Propiedades de las células madres ¿Qué es la transferencia nuclear? ¿Cuál es su relación con la clonación terapéutica? Mecanismo de la clonación terapéutica Alternativas para la clonación terapéutica
  • 23. ¿ Cuál es su relación con la clonación terapéutica? «Las células obtenidas mediante esta técnica son genéticamente idénticas al núcleo donante, se podría utilizar para el trasplante celular en el donante sin temor a que se produjera un rechazo por causas inmunitarias» Fuente: Colman and Kind
  • 24. ¿Que son las células madres? Propiedades de las células madres ¿Qué es la transferencia nuclear? ¿Cuál es su relación con la clonación terapéutica? Mecanismo de la clonación terapéutica Alternativas para la clonación terapéutica
  • 25. MECANISMO DE LA CLONACIÓN TERAPÉUTICA… 1- TRANSFERENCIA NUCLEAR 2- DIVISIÓN DEL CIGOTO Fuente: Fischbach and Fischbach
  • 26. 3- FORMACIÓN DE LÍNEAS CELULARES Fuente: Fischbach and Fischbach
  • 27. 4- INCORPORACIÓN DE LAS CÉLULAS AL PACIENTE ENFERMO Fuente: Kirschstein and Skirboll, 2001
  • 28. 5- ¿CÓMO LLEGAN LAS CÉLULAS A SU DESTINO Y CÓMO SE ACTIVAN EN DICHO TEJIDO? Fuente:Blau, Brazelton and Weimann, 2001
  • 29. ¿Que son las células madres? Propiedades de las células madres ¿Qué es la transferencia nuclear? ¿Cuál es su relación con la clonación terapéutica? Mecanismo de la clonación terapéutica Alternativas para la clonación terapéutica
  • 30. ALTERNATIVAS PARA EVITAR LA CLONACIÓN TERAPÉUTICA… Fuente: Colman and Kind
  • 31. IN VIVO…… Fuente: Kirschstein and Skirboll, 2001
  • 32.
  • 33.
  • 34. • Ambos alelos se expresan simultáneamente • Expresión monoalélica
  • 36. EXPERIMENTOS DE TRANSPLANTE DE NÚCLEO que para un normal desarrollo se requiere la contribución tanto del genoma materno como del paterno
  • 37. Ratón partenogenético o Ratón partenogenético o ginogenético ginogenético Ratón androgenético Ratón androgenético LOS GENES EXPRESADOS PROVENIENTES DE CADA PROGENITOR NO SON LOS MISMOS
  • 39. Fenómeno epigenético en el cual algunos genes son expresados a partir de un solo alelo (que depende del progenitor) se produce una marca que distingue a los alelos paternos y tiene como resultado la expresión de un patrón monoalelíco parental específico
  • 41. IMPORTANTES PARA EL DESARROLLO NORMAL DEL ORGANISMO El hecho de que sólo uno de los dos alelos se pueda expresar expone aaun El hecho de que sólo uno de los dos alelos se pueda expresar expone un gran riesgo genómico debido aaque una mutación (genética o epigenética) gran riesgo genómico debido que una mutación (genética o epigenética)
  • 42. SÍNDROME DE BECKWITH-WIEDEMANN SÍNDROME DE BECKWITH-WIEDEMANN SÍNDROME DE SILVER-RUSSELL SÍNDROME DE SILVER-RUSSELL
  • 43. SÍNDROME DE PRADER-WILLI SÍNDROME DE PRADER-WILLI SÍNDROME DE ANGELMAN SÍNDROME DE ANGELMAN
  • 44. ¿Cuáles son sus funciones? ¿Dónde se encuentran? ¿Cómo se encuentran?
  • 45. Genes de ambos padres que se expresan Regiones de control de impresión Bartolomei 2009, GENES & DEVELOPMENT 23:2124–2133
  • 48.
  • 49. DEJA SIN EFECTO EL SILENCIAMIENTO DE GENES IMPRESOS O SILENCIA GENES NO IMPRESOS
  • 51. La impresión genómica puede causar problemas en la clonación en los clones muchas veces en DNA no está metilado en la posición correcta ESTO SE DEBE AL TIEMPO ESTO SE DEBE AL TIEMPO DE REPROGRAMACIÓN DE REPROGRAMACIÓN
  • 52.
  • 53. APLICACIONES DE LA CLONACIÓN TERAPÉUTICA Medicina regenerativa + Ingeniería en tejidos Restaurar forma y función de órganos y tejidos dañados TRASPLANTE DE ÓRGANOS CLONACIÓN TERAPÉUTICA CÉLULAS EMBRIONARIAS Escases de donantes
  • 54. + Factores de crecimiento e inductores de diferenciación CÉLULAS MADRES EMBRIONARIAS CÉLULAS MADRES EMBRIONARIAS Habilidad de proliferar en un estado pluripotente de desdiferenciación.
  • 55. C.J. Koh, A. Atala, 2004 Células clonadas, reconocidas como propias NO son rechazadas por el sistema inmune
  • 56. Reporte en modelos animales Blastocitos de ratón clonado Lanza et al Mismas propiedades morfológicas y marcadores de expresión que blastocito normal.
  • 57. Rideot et al TEJIDO SANGUÍNEO TEJIDO SANGUÍNEO Trasferencia Núcleos somáticos de ratones inmunodeficientes Oocitos anucelados Blastocitos clonados, celulas madres Reconstitición de tejido hematopoyético Trasplante Diferenciación Progenitores hematopoyéticos
  • 58. Otro estudio… Clonado terapéutico + Ingeniería genética CORAZÓN CORAZÓN Músculo cardíaco clonado con IGUAL material genético que la vaca donante. Blastocito implantado para su crecimiento in vivo. Células recolectadas y expandidas in vitro. 6 semanas después del trasplante, recuperadas. Buena organización celular y vascularización.
  • 59. PÁNCREAS PÁNCREAS D'Amour et al , 2006 Diferenciación Células madres embrionarias Células endócrinas Glucagón e insulina Tratamiento de Diabetes Mellitus Trasplante Células embrionarias clonadas del paciente se diferenciarían en células de la organogénesis del páncreas
  • 60. PARKINSON PARKINSON Síntomas: Pérdida progresiva del control motor Temblores Rigidez muscular Debido a… degeneración de neuronas dopaminérgidas. ¡SOLUCIÓN! Concentración local de dopamina No detiene la progresión de la enfermedad, efectos secundarios.
  • 61. ¿ Alternativa?? Neuronas derivadas de células embrionarias humanas!! Astrocitos Oligodentroglías Neuronas maduras Respondieron a neurotransmisores, contuvieron canales dependientes de voltaje, respondieron a acciones despolarizantes. Progenitores neurales, incorporados en el parénquima cerebral del ratón. Se siguió en VIVO : diferenciación en los tres tipos fundamentales de neuronas.
  • 62. Barbieri, et al Obtuvieron por SCNT de células de la cola de un ratón células madres embrionarias. Interneuronas GABA minérgidas Neuronas serotoninérgidas Neuronas dopaminérgidas Inyectadas en el cuerpo cortical estriado de ratones con Parkinson. 80% de las neuronas vivieron 8 sem. post- transplante
  • 63. CONCLUSIÓN Estos estudios muestran que células derivadas del clonado terapéutico : Pueden ser exitosamente recolectadas; Expandidas en cultivo; Trasplantadas in vivo; Organizarse en tejidos genética e inmuno- compatibles.
  • 64.
  • 65. PERSONALISMO Considera a la “persona” como la manifestación concreta de la naturaleza humana, de procedencia divina y, por consecuencia, receptáculo de valores trascendentes. HUMANISMO SECULAR Se fundamenta conocimiento de lo humano desde una perspectiva científica, en donde el hombre es quien genera los valores y es el responsable de su destino.
  • 66. “el estudio sistemático de las dimensiones morales —visión moral, decisiones, conducta y políticas— de las ciencias de la vida y la atención a la salud, empleando diversas metodologías éticas, con una orientación interdisciplinaria”
  • 67.
  • 68. Reemplazo de la vida Producción de un ser -> atenta contra la identidad e irrepetibilidad propia de la persona Implica aceptar el dominio de unos sobre otros Se violan ciertos derechos humanos Limitación de la reproducción a su dimensión biológica Uso arbitrario del cuerpo humano como máquina
  • 69. Cuestionamiento de si es ético modificar a voluntad otro ser ¿Se asumen las consecuencias? NUNCA ES LÍCITO USAR PERSONAS COMO UN MEDIO… SON UN FÍN EN SI MISMA Somos personas desde el momento de la fecundación
  • 70. En fin… LOS EMBRIONES MANIPULADOS SON PERSONAS IGUAL QUE NOSOTROS Y OCUPARLOS CON UN FIN ES UN ATENTADO CONTRA SU SER Y DERECHOS
  • 71. Es preponderante lo que pueda traer beneficio a la humanidad Homo sapiens ser cuyas características tienen su fuente en procesos biológicos y no en un alma inmaterial El hombre no es persona desde la fecundación, sino que se “hace persona” en un momento posterior que puede ser…
  • 72. • En la fase de desarrollo embrionario que corresponde a la implantación del cigoto. • En el momento de la formación de la línea embrionaria cuando el conjunto de células pierden la totipotencialidad. • En cuanto inicia la formación del sistema nervioso central, condición de posibilidad para la percepción del bienestar y el sufrimiento. • En cuanto inicia la formación de la corteza cerebral. • En el momento de la adquisición de la autoconciencia o en el momento de la manifestación de la capacidad de intelección y de autodeterminación.
  • 73. Atribuye a los padres el derecho sobre sus hijos y, por lo tanto, sobre sus embriones. Legitimiza la utilización de embriones bajo dos conceptos: Atribución de titularidad de derecho sólo a aquellos que tienen capacidad sensorial y sensibilidad al dolor Mayor bien para el mayor número
  • 74. En fin… SUGIERE QUE SE REALICE CLONACIÓN DE SERES HUMANOS SIEMPRE QUE TENGA UNA ADECUADA REGLAMENTACIÓN
  • 75. Para poder tomar una postura con respecto a temas así es muy importante estar informado para que nuestra postura esté bien fundamentada.
  • 76. Toda discusión y controversia debe tener como meta el progreso, no una victoria personal. J. Joubert