SlideShare una empresa de Scribd logo

Bloque iii replicacion sintesis de proteinas envio

Biologia I bloque III

1 de 167
Bloque iii replicacion sintesis de proteinas envio
Bloque iii replicacion sintesis de proteinas envio
Bloque iii replicacion sintesis de proteinas envio
• Compuestos de
CHONP
• Son
macromoléculas
formadas por
subunidades
llamadas
nucleótidos.
• (monómeros de
los ácidos
nucleicos)
Bloque iii replicacion sintesis de proteinas envio
Bases Nitrogenadas
Purinas y Pirimidinas
Anillo Purina
(2 fusionados) :
A-G
Anillo Pirimidina:
C,T y U
Publicidad

Recomendados

Clase x bloque iv epigenetica, genoma y tecnologia del adn 2015
Clase x bloque iv epigenetica, genoma y tecnologia del adn 2015Clase x bloque iv epigenetica, genoma y tecnologia del adn 2015
Clase x bloque iv epigenetica, genoma y tecnologia del adn 2015clauciencias
 
Bloque iii division celular envio
Bloque iii division celular envioBloque iii division celular envio
Bloque iii division celular envioclauciencias
 
Clase vii bloque iii replicacion sintesis de proteinas 2105
Clase vii bloque iii replicacion sintesis de proteinas 2105Clase vii bloque iii replicacion sintesis de proteinas 2105
Clase vii bloque iii replicacion sintesis de proteinas 2105clauciencias
 
Bases moleculares de la herencia. 2016. Dr. Igor Pardo Zapata. Docente Titular
Bases moleculares de la herencia. 2016. Dr. Igor Pardo Zapata. Docente TitularBases moleculares de la herencia. 2016. Dr. Igor Pardo Zapata. Docente Titular
Bases moleculares de la herencia. 2016. Dr. Igor Pardo Zapata. Docente TitularIgor Pardo
 
Epigenetica la-esencia-del-cambio.-como ves-pdf
Epigenetica la-esencia-del-cambio.-como ves-pdfEpigenetica la-esencia-del-cambio.-como ves-pdf
Epigenetica la-esencia-del-cambio.-como ves-pdfclauciencias
 

Más contenido relacionado

La actualidad más candente

Biologia celular y molecular
Biologia celular y molecularBiologia celular y molecular
Biologia celular y molecularmolbio1984
 
Bases de La Herencia
Bases de La HerenciaBases de La Herencia
Bases de La Herenciaguest8896bb
 
Clase 3 Procariontes Y Eucariontes
Clase 3 Procariontes Y EucariontesClase 3 Procariontes Y Eucariontes
Clase 3 Procariontes Y EucariontesLoby
 
Alteraciones de la información genética
Alteraciones de la información genéticaAlteraciones de la información genética
Alteraciones de la información genéticaJulio Sanchez
 
Unidad 4 Revolución genética
Unidad 4   Revolución genéticaUnidad 4   Revolución genética
Unidad 4 Revolución genéticaElena
 
Bloque iii sistema nervioso 2017
Bloque iii sistema nervioso 2017Bloque iii sistema nervioso 2017
Bloque iii sistema nervioso 2017clauciencias
 
Material genetico y division celular
Material genetico y division celularMaterial genetico y division celular
Material genetico y division celularDaniela Soto Amparán
 
Genetica Celular
Genetica CelularGenetica Celular
Genetica Celularguest14fe92
 
4 eso.t2.la informaci�n gen�tica.santillana
4 eso.t2.la informaci�n gen�tica.santillana4 eso.t2.la informaci�n gen�tica.santillana
4 eso.t2.la informaci�n gen�tica.santillanaRosiJimenezBarrientos
 
Genoma de las células eucariotas
Genoma de las células eucariotasGenoma de las células eucariotas
Genoma de las células eucariotasJoel Gutierrez
 
Tema 6. La revolucióon genética.
Tema 6. La revolucióon genética.Tema 6. La revolucióon genética.
Tema 6. La revolucióon genética.ies delgado hernadez
 
Tema 6. a revolución genética
Tema 6. a revolución genéticaTema 6. a revolución genética
Tema 6. a revolución genéticajosemanuel7160
 
I5 replicacion
I5 replicacionI5 replicacion
I5 replicacionbiogeo
 

La actualidad más candente (20)

Biologia celular y molecular
Biologia celular y molecularBiologia celular y molecular
Biologia celular y molecular
 
Erwin. bases de la herencia
Erwin. bases de la herenciaErwin. bases de la herencia
Erwin. bases de la herencia
 
Bases de La Herencia
Bases de La HerenciaBases de La Herencia
Bases de La Herencia
 
Clase 3 Procariontes Y Eucariontes
Clase 3 Procariontes Y EucariontesClase 3 Procariontes Y Eucariontes
Clase 3 Procariontes Y Eucariontes
 
Alteraciones de la información genética
Alteraciones de la información genéticaAlteraciones de la información genética
Alteraciones de la información genética
 
Tema 4
Tema 4Tema 4
Tema 4
 
Unidad 4 Revolución genética
Unidad 4   Revolución genéticaUnidad 4   Revolución genética
Unidad 4 Revolución genética
 
Bloque iii sistema nervioso 2017
Bloque iii sistema nervioso 2017Bloque iii sistema nervioso 2017
Bloque iii sistema nervioso 2017
 
Material genetico y division celular
Material genetico y division celularMaterial genetico y division celular
Material genetico y division celular
 
Genetica Celular
Genetica CelularGenetica Celular
Genetica Celular
 
Tema 35
Tema 35Tema 35
Tema 35
 
4 eso.t2.la informaci�n gen�tica.santillana
4 eso.t2.la informaci�n gen�tica.santillana4 eso.t2.la informaci�n gen�tica.santillana
4 eso.t2.la informaci�n gen�tica.santillana
 
Genoma de las células eucariotas
Genoma de las células eucariotasGenoma de las células eucariotas
Genoma de las células eucariotas
 
Tema 5 La revolución genética
Tema 5 La revolución genéticaTema 5 La revolución genética
Tema 5 La revolución genética
 
Tema 6. La revolucióon genética.
Tema 6. La revolucióon genética.Tema 6. La revolucióon genética.
Tema 6. La revolucióon genética.
 
Material genético para cuartos 2013
Material genético para cuartos  2013Material genético para cuartos  2013
Material genético para cuartos 2013
 
Material Genetico
Material GeneticoMaterial Genetico
Material Genetico
 
Tema 6. a revolución genética
Tema 6. a revolución genéticaTema 6. a revolución genética
Tema 6. a revolución genética
 
Tema 15
Tema 15Tema 15
Tema 15
 
I5 replicacion
I5 replicacionI5 replicacion
I5 replicacion
 

Destacado

Bloque ii estructura celular y transporte celular parte ii envio
Bloque ii estructura celular  y transporte celular parte ii envioBloque ii estructura celular  y transporte celular parte ii envio
Bloque ii estructura celular y transporte celular parte ii envioclauciencias
 
Bloque iv herencia envio
Bloque iv herencia envioBloque iv herencia envio
Bloque iv herencia envioclauciencias
 
Bloque ii estructura celular y transporte celular i parte envio
Bloque ii estructura celular  y transporte celular i parte envioBloque ii estructura celular  y transporte celular i parte envio
Bloque ii estructura celular y transporte celular i parte envioclauciencias
 
Bloque iv epigenetica, genoma y tecnologia del adn envio
Bloque iv epigenetica, genoma y tecnologia del adn envioBloque iv epigenetica, genoma y tecnologia del adn envio
Bloque iv epigenetica, genoma y tecnologia del adn envioclauciencias
 
Clase vi bloque ii respiracion celular 2015 web
Clase vi bloque ii respiracion celular 2015 webClase vi bloque ii respiracion celular 2015 web
Clase vi bloque ii respiracion celular 2015 webclauciencias
 
Clase v bloque ii fotosintesis i parte i fase luminosa envio
Clase v bloque ii fotosintesis i parte i fase luminosa envioClase v bloque ii fotosintesis i parte i fase luminosa envio
Clase v bloque ii fotosintesis i parte i fase luminosa envioclauciencias
 
Clase i bloque ii composicion celular parte i blog
Clase i bloque ii composicion celular parte i blogClase i bloque ii composicion celular parte i blog
Clase i bloque ii composicion celular parte i blogclauciencias
 
Clase I bloque II composicion celular parte ii blog
Clase I bloque II composicion celular parte ii blogClase I bloque II composicion celular parte ii blog
Clase I bloque II composicion celular parte ii blogclauciencias
 
Bloque ii fotosintesis parte ii envio
Bloque ii fotosintesis parte ii envioBloque ii fotosintesis parte ii envio
Bloque ii fotosintesis parte ii envioclauciencias
 

Destacado (9)

Bloque ii estructura celular y transporte celular parte ii envio
Bloque ii estructura celular  y transporte celular parte ii envioBloque ii estructura celular  y transporte celular parte ii envio
Bloque ii estructura celular y transporte celular parte ii envio
 
Bloque iv herencia envio
Bloque iv herencia envioBloque iv herencia envio
Bloque iv herencia envio
 
Bloque ii estructura celular y transporte celular i parte envio
Bloque ii estructura celular  y transporte celular i parte envioBloque ii estructura celular  y transporte celular i parte envio
Bloque ii estructura celular y transporte celular i parte envio
 
Bloque iv epigenetica, genoma y tecnologia del adn envio
Bloque iv epigenetica, genoma y tecnologia del adn envioBloque iv epigenetica, genoma y tecnologia del adn envio
Bloque iv epigenetica, genoma y tecnologia del adn envio
 
Clase vi bloque ii respiracion celular 2015 web
Clase vi bloque ii respiracion celular 2015 webClase vi bloque ii respiracion celular 2015 web
Clase vi bloque ii respiracion celular 2015 web
 
Clase v bloque ii fotosintesis i parte i fase luminosa envio
Clase v bloque ii fotosintesis i parte i fase luminosa envioClase v bloque ii fotosintesis i parte i fase luminosa envio
Clase v bloque ii fotosintesis i parte i fase luminosa envio
 
Clase i bloque ii composicion celular parte i blog
Clase i bloque ii composicion celular parte i blogClase i bloque ii composicion celular parte i blog
Clase i bloque ii composicion celular parte i blog
 
Clase I bloque II composicion celular parte ii blog
Clase I bloque II composicion celular parte ii blogClase I bloque II composicion celular parte ii blog
Clase I bloque II composicion celular parte ii blog
 
Bloque ii fotosintesis parte ii envio
Bloque ii fotosintesis parte ii envioBloque ii fotosintesis parte ii envio
Bloque ii fotosintesis parte ii envio
 

Similar a Bloque iii replicacion sintesis de proteinas envio

Clase 1 adn historia, estructura y replicación
Clase 1 adn historia, estructura y replicaciónClase 1 adn historia, estructura y replicación
Clase 1 adn historia, estructura y replicaciónrominadg
 
Estructura y Funcion del ADN
Estructura y Funcion del ADNEstructura y Funcion del ADN
Estructura y Funcion del ADNalbertososa
 
UD 6. Genética molecular.
UD 6. Genética molecular.UD 6. Genética molecular.
UD 6. Genética molecular.martabiogeo
 
ADN y ARN.pdf
ADN y ARN.pdfADN y ARN.pdf
ADN y ARN.pdfPene49
 
Genética molecular
Genética molecularGenética molecular
Genética molecularmartabiogeo
 
Pactica computacion basica_ Segundo bimestre Biologia
Pactica computacion basica_ Segundo bimestre BiologiaPactica computacion basica_ Segundo bimestre Biologia
Pactica computacion basica_ Segundo bimestre BiologiaRomina Alejandra Luna
 
ReplicacióN Del Dna Nucleo
ReplicacióN Del Dna NucleoReplicacióN Del Dna Nucleo
ReplicacióN Del Dna NucleoVerónica Rosso
 
Material genético ADN ARN
Material genético ADN ARNMaterial genético ADN ARN
Material genético ADN ARNElsa Qr
 
Tema4 los genes y la manipulacion
Tema4 los genes y la manipulacionTema4 los genes y la manipulacion
Tema4 los genes y la manipulaciongeopaloma
 
Introducción a la genética, conceptos básicos.pptx
Introducción a la genética, conceptos básicos.pptxIntroducción a la genética, conceptos básicos.pptx
Introducción a la genética, conceptos básicos.pptxDANIELULISESTORRESRE
 

Similar a Bloque iii replicacion sintesis de proteinas envio (20)

áCidos nucleicos
áCidos nucleicosáCidos nucleicos
áCidos nucleicos
 
Biomoleculas: adn arn_atp
Biomoleculas: adn arn_atpBiomoleculas: adn arn_atp
Biomoleculas: adn arn_atp
 
Clase 1 adn historia, estructura y replicación
Clase 1 adn historia, estructura y replicaciónClase 1 adn historia, estructura y replicación
Clase 1 adn historia, estructura y replicación
 
Estructura y Funcion del ADN
Estructura y Funcion del ADNEstructura y Funcion del ADN
Estructura y Funcion del ADN
 
UD 6. Genética molecular.
UD 6. Genética molecular.UD 6. Genética molecular.
UD 6. Genética molecular.
 
Acidos nucleicos y adn
Acidos nucleicos y adnAcidos nucleicos y adn
Acidos nucleicos y adn
 
Adn estructura
Adn estructuraAdn estructura
Adn estructura
 
Adn estructura
Adn estructuraAdn estructura
Adn estructura
 
Adn estructura
Adn estructuraAdn estructura
Adn estructura
 
ADN y ARN.pdf
ADN y ARN.pdfADN y ARN.pdf
ADN y ARN.pdf
 
Genética molecular
Genética molecularGenética molecular
Genética molecular
 
ADN
ADNADN
ADN
 
Pactica computacion basica_ Segundo bimestre Biologia
Pactica computacion basica_ Segundo bimestre BiologiaPactica computacion basica_ Segundo bimestre Biologia
Pactica computacion basica_ Segundo bimestre Biologia
 
ReplicacióN Del Dna Nucleo
ReplicacióN Del Dna NucleoReplicacióN Del Dna Nucleo
ReplicacióN Del Dna Nucleo
 
Código genético
Código genéticoCódigo genético
Código genético
 
Capitulo ac.nucleicos
Capitulo ac.nucleicosCapitulo ac.nucleicos
Capitulo ac.nucleicos
 
Material genético ADN ARN
Material genético ADN ARNMaterial genético ADN ARN
Material genético ADN ARN
 
Tema4 los genes y la manipulacion
Tema4 los genes y la manipulacionTema4 los genes y la manipulacion
Tema4 los genes y la manipulacion
 
Acidos nucleicos
Acidos nucleicosAcidos nucleicos
Acidos nucleicos
 
Introducción a la genética, conceptos básicos.pptx
Introducción a la genética, conceptos básicos.pptxIntroducción a la genética, conceptos básicos.pptx
Introducción a la genética, conceptos básicos.pptx
 

Más de clauciencias

Clase i bloque ii enlace quimico parte i 2020 envio
Clase i bloque ii enlace quimico parte i 2020 envioClase i bloque ii enlace quimico parte i 2020 envio
Clase i bloque ii enlace quimico parte i 2020 envioclauciencias
 
Bloque ii parte ii sangre, circulacion y linfatico e inmune 2020envio
Bloque ii parte ii sangre, circulacion y linfatico e inmune 2020envioBloque ii parte ii sangre, circulacion y linfatico e inmune 2020envio
Bloque ii parte ii sangre, circulacion y linfatico e inmune 2020envioclauciencias
 
Clase iv bloque ii tabla periodica 2020 envio 1
Clase iv bloque ii tabla periodica 2020 envio 1Clase iv bloque ii tabla periodica 2020 envio 1
Clase iv bloque ii tabla periodica 2020 envio 1clauciencias
 
Clase iii bloque ii modelo actual y configuracion electronica2020 envio
Clase iii bloque ii modelo actual y configuracion electronica2020 envioClase iii bloque ii modelo actual y configuracion electronica2020 envio
Clase iii bloque ii modelo actual y configuracion electronica2020 envioclauciencias
 
Clase ii bloque i isotopos 2020 envio
Clase ii bloque i isotopos 2020 envioClase ii bloque i isotopos 2020 envio
Clase ii bloque i isotopos 2020 envioclauciencias
 
Bloque ii tsb introduccion al cuerpo humano envio
Bloque ii tsb introduccion al cuerpo humano envioBloque ii tsb introduccion al cuerpo humano envio
Bloque ii tsb introduccion al cuerpo humano envioclauciencias
 
Clase i tsb bloque i nivel tisular 2019 envio
Clase i tsb bloque i nivel tisular 2019 envioClase i tsb bloque i nivel tisular 2019 envio
Clase i tsb bloque i nivel tisular 2019 envioclauciencias
 
Temas selectos de biología clase i nivel celular envío
Temas selectos de biología clase i nivel celular envíoTemas selectos de biología clase i nivel celular envío
Temas selectos de biología clase i nivel celular envíoclauciencias
 
Bloque iii sales envio
Bloque iii sales envioBloque iii sales envio
Bloque iii sales envioclauciencias
 
Bloque iii acidos hidruros
Bloque iii acidos hidrurosBloque iii acidos hidruros
Bloque iii acidos hidrurosclauciencias
 
Bloque iii oxidos envio
Bloque iii oxidos envioBloque iii oxidos envio
Bloque iii oxidos envioclauciencias
 
Bloque iii introduccion quimica i envio
Bloque iii introduccion quimica i envioBloque iii introduccion quimica i envio
Bloque iii introduccion quimica i envioclauciencias
 
Bloque ii elementos usos envio
Bloque ii elementos usos envioBloque ii elementos usos envio
Bloque ii elementos usos envioclauciencias
 
Clase i bloque ii particulas subatomicas tutorial ejercicios envio
Clase i bloque ii particulas subatomicas tutorial ejercicios envioClase i bloque ii particulas subatomicas tutorial ejercicios envio
Clase i bloque ii particulas subatomicas tutorial ejercicios envioclauciencias
 
Clase i bloque ii atomo y particulas 2019 envio
Clase i bloque ii atomo y particulas 2019 envioClase i bloque ii atomo y particulas 2019 envio
Clase i bloque ii atomo y particulas 2019 envioclauciencias
 
Bloque i biologia i 2018 envio
Bloque i biologia i 2018 envioBloque i biologia i 2018 envio
Bloque i biologia i 2018 envioclauciencias
 
Nomenclatura de-alquinos
Nomenclatura de-alquinosNomenclatura de-alquinos
Nomenclatura de-alquinosclauciencias
 
Nomenclatura de-alquenos
Nomenclatura de-alquenosNomenclatura de-alquenos
Nomenclatura de-alquenosclauciencias
 
Nomenclatura de-alcanos
Nomenclatura de-alcanosNomenclatura de-alcanos
Nomenclatura de-alcanosclauciencias
 

Más de clauciencias (20)

Clase i bloque ii enlace quimico parte i 2020 envio
Clase i bloque ii enlace quimico parte i 2020 envioClase i bloque ii enlace quimico parte i 2020 envio
Clase i bloque ii enlace quimico parte i 2020 envio
 
Bloque ii parte ii sangre, circulacion y linfatico e inmune 2020envio
Bloque ii parte ii sangre, circulacion y linfatico e inmune 2020envioBloque ii parte ii sangre, circulacion y linfatico e inmune 2020envio
Bloque ii parte ii sangre, circulacion y linfatico e inmune 2020envio
 
Clase iv bloque ii tabla periodica 2020 envio 1
Clase iv bloque ii tabla periodica 2020 envio 1Clase iv bloque ii tabla periodica 2020 envio 1
Clase iv bloque ii tabla periodica 2020 envio 1
 
Clase iii bloque ii modelo actual y configuracion electronica2020 envio
Clase iii bloque ii modelo actual y configuracion electronica2020 envioClase iii bloque ii modelo actual y configuracion electronica2020 envio
Clase iii bloque ii modelo actual y configuracion electronica2020 envio
 
Clase ii bloque i isotopos 2020 envio
Clase ii bloque i isotopos 2020 envioClase ii bloque i isotopos 2020 envio
Clase ii bloque i isotopos 2020 envio
 
Bloque ii tsb introduccion al cuerpo humano envio
Bloque ii tsb introduccion al cuerpo humano envioBloque ii tsb introduccion al cuerpo humano envio
Bloque ii tsb introduccion al cuerpo humano envio
 
Clase 3 tsb envio
Clase 3 tsb envioClase 3 tsb envio
Clase 3 tsb envio
 
Clase i tsb bloque i nivel tisular 2019 envio
Clase i tsb bloque i nivel tisular 2019 envioClase i tsb bloque i nivel tisular 2019 envio
Clase i tsb bloque i nivel tisular 2019 envio
 
Temas selectos de biología clase i nivel celular envío
Temas selectos de biología clase i nivel celular envíoTemas selectos de biología clase i nivel celular envío
Temas selectos de biología clase i nivel celular envío
 
Bloque iii sales envio
Bloque iii sales envioBloque iii sales envio
Bloque iii sales envio
 
Bloque iii acidos hidruros
Bloque iii acidos hidrurosBloque iii acidos hidruros
Bloque iii acidos hidruros
 
Bloque iii oxidos envio
Bloque iii oxidos envioBloque iii oxidos envio
Bloque iii oxidos envio
 
Bloque iii introduccion quimica i envio
Bloque iii introduccion quimica i envioBloque iii introduccion quimica i envio
Bloque iii introduccion quimica i envio
 
Bloque ii elementos usos envio
Bloque ii elementos usos envioBloque ii elementos usos envio
Bloque ii elementos usos envio
 
Clase i bloque ii particulas subatomicas tutorial ejercicios envio
Clase i bloque ii particulas subatomicas tutorial ejercicios envioClase i bloque ii particulas subatomicas tutorial ejercicios envio
Clase i bloque ii particulas subatomicas tutorial ejercicios envio
 
Clase i bloque ii atomo y particulas 2019 envio
Clase i bloque ii atomo y particulas 2019 envioClase i bloque ii atomo y particulas 2019 envio
Clase i bloque ii atomo y particulas 2019 envio
 
Bloque i biologia i 2018 envio
Bloque i biologia i 2018 envioBloque i biologia i 2018 envio
Bloque i biologia i 2018 envio
 
Nomenclatura de-alquinos
Nomenclatura de-alquinosNomenclatura de-alquinos
Nomenclatura de-alquinos
 
Nomenclatura de-alquenos
Nomenclatura de-alquenosNomenclatura de-alquenos
Nomenclatura de-alquenos
 
Nomenclatura de-alcanos
Nomenclatura de-alcanosNomenclatura de-alcanos
Nomenclatura de-alcanos
 

Último

herramientas manuales grado cuarto primaria.pptx
herramientas manuales grado cuarto primaria.pptxherramientas manuales grado cuarto primaria.pptx
herramientas manuales grado cuarto primaria.pptxnelsontobontrujillo
 
Instrumento de evaluación___MuralDigital
Instrumento de evaluación___MuralDigitalInstrumento de evaluación___MuralDigital
Instrumento de evaluación___MuralDigitaleliecerespinosa
 
Preelaboración de alimentos. El arroz.pdf
Preelaboración de alimentos. El arroz.pdfPreelaboración de alimentos. El arroz.pdf
Preelaboración de alimentos. El arroz.pdfVictorSanz21
 
Inteligencia Artificial en la Educacion AV5 Ccesa007.pdf
Inteligencia Artificial en la Educacion  AV5  Ccesa007.pdfInteligencia Artificial en la Educacion  AV5  Ccesa007.pdf
Inteligencia Artificial en la Educacion AV5 Ccesa007.pdfDemetrio Ccesa Rayme
 
La ciencia de ganar almas. Vol. 2. Manual de evangelismo | By Pr. Heyssen Cor...
La ciencia de ganar almas. Vol. 2. Manual de evangelismo | By Pr. Heyssen Cor...La ciencia de ganar almas. Vol. 2. Manual de evangelismo | By Pr. Heyssen Cor...
La ciencia de ganar almas. Vol. 2. Manual de evangelismo | By Pr. Heyssen Cor...Heyssen Cordero Maraví
 
Tendencias Tecnologicas de Gartner 2024 Ccesa007.pdf
Tendencias Tecnologicas de Gartner 2024  Ccesa007.pdfTendencias Tecnologicas de Gartner 2024  Ccesa007.pdf
Tendencias Tecnologicas de Gartner 2024 Ccesa007.pdfDemetrio Ccesa Rayme
 
tema 4 al Ándalus 2023 2024 . Tema 4 (I) Al Andalus
tema 4 al Ándalus 2023 2024 . Tema 4 (I) Al Andalustema 4 al Ándalus 2023 2024 . Tema 4 (I) Al Andalus
tema 4 al Ándalus 2023 2024 . Tema 4 (I) Al Andalusjosemariahermoso
 
BUEN INICIO DEL AÑO ESCOLAR 2024 11098.pptx
BUEN INICIO DEL AÑO ESCOLAR 2024 11098.pptxBUEN INICIO DEL AÑO ESCOLAR 2024 11098.pptx
BUEN INICIO DEL AÑO ESCOLAR 2024 11098.pptxDirectivosGanadores
 
La enseñanza de lenguas en la sociedad de la información y del conocimiento. ...
La enseñanza de lenguas en la sociedad de la información y del conocimiento. ...La enseñanza de lenguas en la sociedad de la información y del conocimiento. ...
La enseñanza de lenguas en la sociedad de la información y del conocimiento. ...JavierGMonzn
 
DOCUMENTOS PRESENTACIÓN PARA EXELEARNINGGG
DOCUMENTOS PRESENTACIÓN PARA EXELEARNINGGGDOCUMENTOS PRESENTACIÓN PARA EXELEARNINGGG
DOCUMENTOS PRESENTACIÓN PARA EXELEARNINGGGCarmenTamayoDuran
 
Proceso de matricula articulacioncimm.pdf
Proceso de matricula articulacioncimm.pdfProceso de matricula articulacioncimm.pdf
Proceso de matricula articulacioncimm.pdfJorgecego
 
PROGRAMA DE ESTUDIO 2022 FASE 2 PREESCOLAR.pdf
PROGRAMA DE ESTUDIO 2022 FASE 2 PREESCOLAR.pdfPROGRAMA DE ESTUDIO 2022 FASE 2 PREESCOLAR.pdf
PROGRAMA DE ESTUDIO 2022 FASE 2 PREESCOLAR.pdfLozanogalex
 
Plan de Busqueda.pdf...............................
Plan de Busqueda.pdf...............................Plan de Busqueda.pdf...............................
Plan de Busqueda.pdf...............................alexlasso65
 
UNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQ
UNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQUNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQ
UNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQJAVIERMAURICIOCORREA1
 
Información a las familias aula matinal.pdf
Información a las familias aula matinal.pdfInformación a las familias aula matinal.pdf
Información a las familias aula matinal.pdfAlfaresbilingual
 
Circular105_14 Secretaria General CEIP.pdf
Circular105_14 Secretaria General CEIP.pdfCircular105_14 Secretaria General CEIP.pdf
Circular105_14 Secretaria General CEIP.pdfgabitachica
 
UNIDAD 1 EA1 2 SEMESTRE VIRTUAL TICS UQ
UNIDAD 1 EA1  2 SEMESTRE VIRTUAL TICS UQUNIDAD 1 EA1  2 SEMESTRE VIRTUAL TICS UQ
UNIDAD 1 EA1 2 SEMESTRE VIRTUAL TICS UQJAVIERMAURICIOCORREA1
 
La carrera diplomática. Graduados y graduadas de la Universidad Católica de ...
La carrera diplomática. Graduados y graduadas de la Universidad Católica de ...La carrera diplomática. Graduados y graduadas de la Universidad Católica de ...
La carrera diplomática. Graduados y graduadas de la Universidad Católica de ...EDUCCUniversidadCatl
 
Tema 3.- ASPECTOS ETICOS Y SOCIALES EN LOS SISTEMAS DE INFORMACION.pdf
Tema 3.- ASPECTOS ETICOS Y SOCIALES EN LOS SISTEMAS DE INFORMACION.pdfTema 3.- ASPECTOS ETICOS Y SOCIALES EN LOS SISTEMAS DE INFORMACION.pdf
Tema 3.- ASPECTOS ETICOS Y SOCIALES EN LOS SISTEMAS DE INFORMACION.pdfDaniel Ángel Corral de la Mata, Ph.D.
 
c2.hu2.p3.p7.Participación en la comunidad.pptx
c2.hu2.p3.p7.Participación en la comunidad.pptxc2.hu2.p3.p7.Participación en la comunidad.pptx
c2.hu2.p3.p7.Participación en la comunidad.pptxMartín Ramírez
 

Último (20)

herramientas manuales grado cuarto primaria.pptx
herramientas manuales grado cuarto primaria.pptxherramientas manuales grado cuarto primaria.pptx
herramientas manuales grado cuarto primaria.pptx
 
Instrumento de evaluación___MuralDigital
Instrumento de evaluación___MuralDigitalInstrumento de evaluación___MuralDigital
Instrumento de evaluación___MuralDigital
 
Preelaboración de alimentos. El arroz.pdf
Preelaboración de alimentos. El arroz.pdfPreelaboración de alimentos. El arroz.pdf
Preelaboración de alimentos. El arroz.pdf
 
Inteligencia Artificial en la Educacion AV5 Ccesa007.pdf
Inteligencia Artificial en la Educacion  AV5  Ccesa007.pdfInteligencia Artificial en la Educacion  AV5  Ccesa007.pdf
Inteligencia Artificial en la Educacion AV5 Ccesa007.pdf
 
La ciencia de ganar almas. Vol. 2. Manual de evangelismo | By Pr. Heyssen Cor...
La ciencia de ganar almas. Vol. 2. Manual de evangelismo | By Pr. Heyssen Cor...La ciencia de ganar almas. Vol. 2. Manual de evangelismo | By Pr. Heyssen Cor...
La ciencia de ganar almas. Vol. 2. Manual de evangelismo | By Pr. Heyssen Cor...
 
Tendencias Tecnologicas de Gartner 2024 Ccesa007.pdf
Tendencias Tecnologicas de Gartner 2024  Ccesa007.pdfTendencias Tecnologicas de Gartner 2024  Ccesa007.pdf
Tendencias Tecnologicas de Gartner 2024 Ccesa007.pdf
 
tema 4 al Ándalus 2023 2024 . Tema 4 (I) Al Andalus
tema 4 al Ándalus 2023 2024 . Tema 4 (I) Al Andalustema 4 al Ándalus 2023 2024 . Tema 4 (I) Al Andalus
tema 4 al Ándalus 2023 2024 . Tema 4 (I) Al Andalus
 
BUEN INICIO DEL AÑO ESCOLAR 2024 11098.pptx
BUEN INICIO DEL AÑO ESCOLAR 2024 11098.pptxBUEN INICIO DEL AÑO ESCOLAR 2024 11098.pptx
BUEN INICIO DEL AÑO ESCOLAR 2024 11098.pptx
 
La enseñanza de lenguas en la sociedad de la información y del conocimiento. ...
La enseñanza de lenguas en la sociedad de la información y del conocimiento. ...La enseñanza de lenguas en la sociedad de la información y del conocimiento. ...
La enseñanza de lenguas en la sociedad de la información y del conocimiento. ...
 
DOCUMENTOS PRESENTACIÓN PARA EXELEARNINGGG
DOCUMENTOS PRESENTACIÓN PARA EXELEARNINGGGDOCUMENTOS PRESENTACIÓN PARA EXELEARNINGGG
DOCUMENTOS PRESENTACIÓN PARA EXELEARNINGGG
 
Proceso de matricula articulacioncimm.pdf
Proceso de matricula articulacioncimm.pdfProceso de matricula articulacioncimm.pdf
Proceso de matricula articulacioncimm.pdf
 
PROGRAMA DE ESTUDIO 2022 FASE 2 PREESCOLAR.pdf
PROGRAMA DE ESTUDIO 2022 FASE 2 PREESCOLAR.pdfPROGRAMA DE ESTUDIO 2022 FASE 2 PREESCOLAR.pdf
PROGRAMA DE ESTUDIO 2022 FASE 2 PREESCOLAR.pdf
 
Plan de Busqueda.pdf...............................
Plan de Busqueda.pdf...............................Plan de Busqueda.pdf...............................
Plan de Busqueda.pdf...............................
 
UNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQ
UNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQUNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQ
UNIDAD 1 EA 2 TICS VIRTUAL 2 SEMESTRE UQ
 
Información a las familias aula matinal.pdf
Información a las familias aula matinal.pdfInformación a las familias aula matinal.pdf
Información a las familias aula matinal.pdf
 
Circular105_14 Secretaria General CEIP.pdf
Circular105_14 Secretaria General CEIP.pdfCircular105_14 Secretaria General CEIP.pdf
Circular105_14 Secretaria General CEIP.pdf
 
UNIDAD 1 EA1 2 SEMESTRE VIRTUAL TICS UQ
UNIDAD 1 EA1  2 SEMESTRE VIRTUAL TICS UQUNIDAD 1 EA1  2 SEMESTRE VIRTUAL TICS UQ
UNIDAD 1 EA1 2 SEMESTRE VIRTUAL TICS UQ
 
La carrera diplomática. Graduados y graduadas de la Universidad Católica de ...
La carrera diplomática. Graduados y graduadas de la Universidad Católica de ...La carrera diplomática. Graduados y graduadas de la Universidad Católica de ...
La carrera diplomática. Graduados y graduadas de la Universidad Católica de ...
 
Tema 3.- ASPECTOS ETICOS Y SOCIALES EN LOS SISTEMAS DE INFORMACION.pdf
Tema 3.- ASPECTOS ETICOS Y SOCIALES EN LOS SISTEMAS DE INFORMACION.pdfTema 3.- ASPECTOS ETICOS Y SOCIALES EN LOS SISTEMAS DE INFORMACION.pdf
Tema 3.- ASPECTOS ETICOS Y SOCIALES EN LOS SISTEMAS DE INFORMACION.pdf
 
c2.hu2.p3.p7.Participación en la comunidad.pptx
c2.hu2.p3.p7.Participación en la comunidad.pptxc2.hu2.p3.p7.Participación en la comunidad.pptx
c2.hu2.p3.p7.Participación en la comunidad.pptx
 

Bloque iii replicacion sintesis de proteinas envio

  • 4. • Compuestos de CHONP • Son macromoléculas formadas por subunidades llamadas nucleótidos. • (monómeros de los ácidos nucleicos)
  • 6. Bases Nitrogenadas Purinas y Pirimidinas Anillo Purina (2 fusionados) : A-G Anillo Pirimidina: C,T y U
  • 11. Nucleósidos y Nucleótidos BASE NUCLEOSIDO ABREV. Adenina Adenosina A Guanina Guanosina G Citosina Citidina C Uracilo Uridina U Timina Timidina T Nucleósido = Base + Pentosa Nucleótido = Base + Pentosa + Gpo fostato
  • 12. Nucleótidos ejs: AMP adenosinmonofosfato UDP uridindifosfato ATP adenosintrifosfato*
  • 13. Funciones: – Almacenamiento de la información biológica. – Actúan como transportadores de E química. – Se combinan con otros grupos. – Se utilizan como moléculas de señalización específica en la célula.
  • 14. • Investiga las fórmulas de los nucleótidos completos: grupo fosfato, azúcar y bases nitrogenadas. • Recorta 4 planillas de cada juego de nucleótidos (4 de ARN y 4 ADN), uno de cada color elije 4 colores
  • 16. El principio de la genética moderna.
  • 31. ¿El material genético es ADN o una proteína?
  • 32. Experimento de Griffith (1920) Trató de obtener una vacuna para proteger a la gente contra la bacteria Streptococcus pneumoniae, que produce la neumonía. No tuvo éxito, pero descubrió el fenómeno de la transformación. Griffith descubrió dos variedades de Streptococcus, una con cápsula y otra desnuda. Propuso la hipótesis que la cápsula afecta la capacidad de las bacterias para causar la enfermedad y experimentó con ratones de la siguiente manera:
  • 34. 1. Inyectó bacterias encapsuladas vivas. Resultado: Los ratones contrajeron neumonía y murieron. La sangre conteníabacterias encapsuladas. 2. Inyectó bacterias desnudas vivas. Resultado: Permanecieron saludables. No se encontraron Streptococcus en la sangre. 3. Inyectó bacterias encapsuladas muertas. Resultado: Los ratones no tuvieron neumonía y carecían de bacterias vivas. 4. Inyectó una mezcla de bacterias encapsuladas muertas y bacterias desnudas vivas. Resultado: Tuvieron neumonía y estaban infestados de bacterias encapsuladas vivas que crecieron
  • 35. ¿Qué significaban los experimentos? • Una hipótesis era que las bacterias vivas habían adquiridomoléculas de información genética provenientes de las bacterias muertas. – Las moléculas codificaban las instrucciones para formar cápsulas; por lo tanto, transformaban a las bacterias desnudas en bacterias encapsuladas.
  • 36. ¿La molécula de la transformación era el ADN?
  • 38. • Avery, MacLeod y McCarty de la Universidad Rockefeller en 1944 aislaron ADN de bacterias encapsuladas, las mezclaron con bacterias desnudas vivas y produjeron bacterias encapsuladas vivas. • Para demostrar que la transformación la ocasionaba el ADN, y no pequeñas cantidades de proteínas que contaminan al ADN, trataron diferentes muestras con enzimas que destruyen proteínas. • Dichas enzimas no afectaron la capacidad de transformación de las muestras de ADN; por otro lado, al tratar muestras con enzimas que destruyen el ADN, se impidió la transformación.
  • 39. CONCLUSIÓN El ADN es la molécula que contiene la información genética
  • 47. 1952: L. Paulíng y R. Corey proponen las estructuras de hélice y la hoja plegada para proteínas.
  • 50. J. Watson y F. Crick ADN, La molécula de la vida • 25 de abril de 1953 se publica en la revista Nature • Descubrimiento más importante del siglo XX “Estructura de la molécula de ADN” Reconocimiento de la comunidad científica a través del Premio Nobel en Fisiología o Medicina.
  • 51. Utilizando los datos de: Maurice Wilkins y Rosalind Franklin Estudiantes de investigaciónen el laboratorio de Henry Cavendish en la Universidadde Cambridge
  • 52. • Watson y Crick consiguieronpor métodos no muy limpios • La fotografía de difracción de rayos X del ADN obtenida por Rosalind Franklin
  • 53. Watson, a la derecha, y Crick pasean por la Universidad de Cambridge en esta imagen tomada en el año 1950
  • 54. • Comenzaron el 30 de enero de 1953 la construcciónde modelo molecular • Concluyó el 7 de marzo de 1953
  • 55. Lab rats ... James Watson, above left, and Francis Crick weren't going to let Rosalind Franklin get in the way of scientific glory. Photo-illustration: Harry Afentoglou
  • 56. Durante 50 años, la historia de la ciencia ha sostenido que los descubridores de la doble hélice del ADN fueron Crick y Watson. En los últimos años, las investigaciones han sacado a la luz la labor de Rosalind Franklin, sin cuyas radiografías sus colegas no hubieran llegado tan rápido a la meta. Hoy se puede decir que si éstos son los «padres» del hallazgo de la estructura helicoidal de la molécula, Franklin merece ser considerada la «madre». Rosalind Franklin
  • 58. • El ADN de los cromosomas se compone de dos cadenas enrolladas una a la otra en una doble hélice. • Los azúcares y fosfatos que unen un nucleótido al siguiente forman el esqueleto en cada lado de la doble hélice. • En tanto que las bases de cada cadena se aparean en el centro de la hélice.
  • 59. Solo pares específicos de bases, llamados pares de bases complementarias, se pueden unir en la hélice mediante enlaces de hidrógeno: adenina con timina y guanina con citosina.
  • 60. ADN 50 AÑOS DEL DESCUBRIMIENTO DE SU ESTRUCTURA
  • 65. Las bases A-T y G-C se emparejan a través de ptes de H:
  • 66. • El emparejamiento de las bases produce 2 polinucleótidos complementarios, que corren antiparalelos entre sí; esto es: • 5´- 3´ y la otra • 3´- 5´. T A G C A T C G Complementaria Las 2 son complementarias, c/cadena puede servir como templado p/construir la otra cadena. Duplicación
  • 67. REPLICACIÓN DEL ADN La clave de la constancia
  • 68. La replicación del ADN • Es el proceso mediante el cual la molécula de ADN hace copias de sí misma (y, por tanto del cromosoma). • En el núcleo hay muchos nucleótidos libres que son los bloques de construcción del nuevo ADN .
  • 69. Duplicación del DNA Replicación del DNA • Una cadena es complementaria de la otra • Se abren al romperse puentes de Hidrogeno (por calor), permitiendo que se forme una nueva cadena complementaria de nucleótidos y otros materiales presentes en la célula, bajo la DNA POLIMERASA x el mecanismo de APAREAMIENTO COMPLEMENTARIO DE BASES. • Por lo tanto, cadenas originales dirigen secuencia (orden) de las nuevas, la nueva es copia de la original. Proceso SEMICONSERVATIVO.
  • 70. La replicación del ADN produce una copia de sí mismo por medio de enzimas que además de ser muy exactas poseen un sistema de reparación de errores. El mecanismo de replicación es esencialmente el mismo en todas las células. Es un proceso semiconservativo porque cada uno de los dos ADN hijos tiene una cadena del ADN anterior. Replicación del DNA
  • 71. 1957, Meselson y Stahl, demuestran el proceso semiconservativo del ADN
  • 76. Proceso durante el cual la información genética contenida en el ADN es copiado a partir de una cadena parental de ADN
  • 77. REPLICACIÓN DEL ADN. La REPLICACIÓN es el COPIADO fiel y exacto de una molécula de ADN a partir de una molécula de ADN parental. La ADN polimerasa cataliza la Replicación. Se lleva a cabo en el núcleo de la célula
  • 81. CEMH CURSO DE PREPARACIÓN 2016 81
  • 84. CEMH CURSO DE PREPARACIÓN 2016 84
  • 86. CEMH CURSO DE PREPARACIÓN 2016 86
  • 87. CEMH CURSO DE PREPARACIÓN 2016 87
  • 89. RESULTADO: COPIA IDENTICA CEMH CURSO DE PREPARACIÓN 2016 89
  • 91. La replicación del ADN en el ser humano se realiza a una velocidad de 50 nucleótidos por segundo
  • 98. RNA Estructura y Función • Constitución: Gpo P + Ribosa + Bases Nitrogenada • (A-U y G-C) • Ribonucleótidos • Una sola cadena • 3 tipos: – RNAm p/sín de prot. – RNAr ribosoma – RNAt 80 dif´s.
  • 101. Código Genético: contenido en el ADN Alfabeto de 4 letras, palabras de 3 letras Los constituyen 64 codones (3 bases) para los 20 aminoácidos, tres llamados de terminación y uno de iniciación.
  • 102. Código Genético: Alfabeto de 4 letras, palabras de 3 letras • Doble hélice DNA: contiene la información necesaria para su duplicación. Necesita un código para la transferencia de genes en características, que ordenan el desarrollo, crecimiento y mantenimiento de los seres vivos.
  • 103. El código está organizado en tripletes o codones: cada tres nucleótidos (triplete) determinan un aminoácido. El código genético es degenerado: existen más tripletes o codones que aminoácidos, de forma que un determinado aminoácido puede estar codificado por más de un triplete. El código genético es no solapado o sin superposiciones: un nucleótido solamente pertenece a un único triplete. La lectura es "sin comas": el cuadro de lectura de los tripletes se realiza de forma continua "sin comas" o sin que existan espacios en blanco. El código genético nuclear es universal: el mismo triplete en diferentes especies codifica para el mismo aminoácido. La principal excepción a la universalidad es el código genético mitocondrial. Características del Código Genético
  • 106. Estructura de un gen • Niveles de organización de la cromatina: • Las moléculas desnudas de DNA rodean el núcleo de histonas para formar nucleosomas, que representan el nivel más bajo de organización de la cromatina. • Los nucleosomas se organizan en filamentos de 30 nm, que a su vez lo hacen en dominios en forma de asa. • Cuando las células se preparan para la mitosis, las asas se enrollan aún más para formar fibras visibles dentro de los cromosomas mitóticos. N C Euc oma ina Laxa, no dicisión. Cromosomas (DNA muy compactado)
  • 109. Un gen es un segmento de ADN que contiene la información para construir una proteína.
  • 115. Proceso durante el cual la información genética contenida en el ADN es copiado a un ARN de una cadena sencilla llamado ARN mensajero.
  • 116. TRANSCRIPCIÓN DEL ADN. La transcripción es el paso de una secuencia de ADN a una secuencia de ARN. La ARN polimerasa cataliza la transcripción.
  • 118. Se lleva a cabo en el núcleo de la célula
  • 128. Para la lectura del código genético 1. Primero identificas los codones de la cadena de ARN mensajero, dividiendo de tres en tres en forma consecutiva y desde el principio (5’ del ARNm). 2. Ya que identifiques al codón, este tiene tres letras , por ejemplo ATG, la letra A es la letra 1, la T es la letra 2, la G es la letra 3. 3. En el cuadro del código genético se buscan las letras anteriores, la letra 1 se busca a la derecha del cuadro, la letra 2 se busca en la parte superior, y la letra 3 en el lado izquierdo del cuadro. 4. Ya que identifiques el codón en el cuadro, escribe el aminoácido al que se refiere. 5. Y sigues el orden de los demás codones, hasta que encuentres un codón de detención o stop, o hastaque se acabe la cadena.
  • 130. El ARN mensajero sale del núcleo a través de los poros nucleares, una proteína llamada CAP se une al extremo 5´ y al final se le añade una colita de poli A (muchas A), para protegerlo en su salida al citoplasma.
  • 152. Esquemas de replicación y síntesis de proteínas. Ejercicios de complementación de bases, transcripción y traducción Rally
  • 156. “No necesito saberlo todo. Tan sólo necesito saber dónde encontrar lo que me haga falta, cuando lo necesite". (Albert Einstein).
  • 158. En las células procariotas hay 1 lugar de origen de replicaciónque se muestra en la horquillade replicación (replicationfork) y que señala el avance de la copia. La horquilla(fork) indicaque se está haciendola separacióny la replicacióna la vez. El avancees bidireccional,lo que acorta el tiempo. En el sitio en que empieza la replicaciónse organizanlas proteínas en un complejo llamadoreplisma. La replicacióndel ADN en procariotassucede a una velocidadde 500 nucleótidospor segundo.
  • 159. En las células eucariotas el proceso es esencialmenteel mismo pero el ADN es mucho más grADNe y linear. Hay varios orígens de replicacióny es bidireccional.El avance es más lento que en procariotasya que hay más proteínasasociadasal ADN que hay que soltar. La replicacióndel ADN, que ocurre una sola vez en cada genración celular necesita de muchos "ladrillos",enzimasy una gran cantidadde energía en forma de ATP (recuerde que luego de la fase S del ciclo celular, lascélulas pasan a una fase G a fin de, entre otras cosas, recuperar energía para la siguiente fase de la divisióncelular). La replicacióndel ADN en el ser humano se realizaa una velocidadde 50 nucleótidospor segundo. Los nucleótidostienen que ser armados y estar disponiblesen el núcleo conjuntamentecon la energía para unirlos.
  • 162. PCR
  • 164. es, duplicación, transcripción, traducción, formado, contiene, síntesis.
  • 166. Un fragmento de la cadena de ADN que codifica la oxitocina tiene la siguiente secuencia de bases: 3‘ TTAGCAGTATATTTGATTACACGGTAGCCCCAT 5'. Determina la secuencia de bases del trascrito y la proteina