SlideShare a Scribd company logo
1 of 19
La Bioinformatica nelle prospettive della Bioeconomy
BIOSPACE REVOLUTION

‘Omics (Genomics and Beyond) Analytics & Modeling

Gaetano Scioscia
IBM Italia, Bari

BiP-Day 2013

Bari, 5 dicembre 2013

© 2013 IBM Corporation
La Bioinformatica nelle prospettive della Bioeconomy

Recent Reports in Bioeconomy: Biospace Revolution address
Societal Grand Challenges

“Biotechnology offers
technological solutions for
many of the health and
resource-based challenges
facing the world.”

© 2013 IBM Corporation

“The bioeconomy has emerged as
an Obama Administration priority
because of its tremendous potential
for growth as well as the many
other societal benefits it offers.”

“The mature, sustainable
Bioeconomy will help deliver
global food security, improve
nutrition and health, create smart
bio-based products and biofuels,
and help agriculture, forestry,
aquaculture and other ecosystems
to adapt to climate change.” 2
2
La Bioinformatica nelle prospettive della Bioeconomy

Disruptive technologies: Advances
that will transform life, business,
and the global economy
May 2013

Next-generation genomics marries advances in the science of
sequencing and modifying genetic material with the latest big
data analytics capabilities. Today, a human genome can be
sequenced in a few hours and for a few thousand dollars, a task
that took 13 years and $2.7 billion to accomplish during the
Human Genome Project. … The next step is synthetic biology
—the ability to precisely customize organisms by “writing” DNA.
These advances in the power and availability of genetic science
could have profound impact on medicine, agriculture, and even
the production of high-value substances such as biofuels—as
well as speed up the process of drug discovery.

Insights for Industry Experts
• “Through all the ‘omics revolutions, essentially
turned biology into an Information Science”
• “We have massive amounts of information at the
top in the cloud, with users at the bottom in
different industries. The biggest barrier to any
real use is the lack of standardization and
connectability”
 Steve Burrill; July 8, 2013
 CEO,
 Burrill and Company
http://www.burrillandco.com/team-138G_Steven__Burrill.html

Range of sized potential
economic impacts
Low

• “In terms of industry investment, Healthcare,
Chemical, Food are hot targets; Fuel less so;
Electronics not interesting”

High

Estimated
potential
economic
impact of
technologies
in 2025

• “Huge value emerging in microbiome”

700B-1.6T (US$)
Next Generation Genomics

© 2013 IBM Corporation

Fast, low-cost gene
sequencing advanced big
data analytics, and synthetic
biology (“writing” DNA)

 Jonathan Fleming; July 11, 2013
 Managing General Partner,
 Oxford Bioscience
http://www.oxbio.com/team.html

3
3
La Bioinformatica nelle prospettive della Bioeconomy

Biospace market is growing rapidly to a $11B in 2016
at a CAGR of 46%
The global value of the synthetic biology market* reached $1.1 billion in
2010. It is expected to reach $1.6 billion in 2011 and it will further grow
to $10.8 billion by 2016, increasing at a compound annual growth rate
(CAGR) of 45.8.%.

Source: BCC Research, Nov 2011

60

$49B

50
40
30
20
10
0
2010

2011

2012

2013

2014

2015

2016

2017

2018

2019

2020

Bioinformatics market is $3.2 billion in 2012 and is forecasted to
grow to nearly $7.5 billion by 2017 with 20.3% CAGR. At this pace,
the market reaches at $13B in 2020.

Source: BCC Research, Mar 2013

*industries outside of Healthcare
© 2013 IBM Corporation

4
4
La Bioinformatica nelle prospettive della Bioeconomy

Large companies across several industries have recently been
investing in Biospace
BP to Invest $500 Million on Biofuels at a Research Center
In one of the largest research grants by an oil company, BP is
planning to spend $500 million over the next 10 years to finance
major work on biofuels to find "longer-term commercial
alternatives to oil and gas."

Amyris rises on Sanofi malaria drug news
Amyris uses genetically modified microorganisms — mainly yeast —
to make products for a variety of markets including specialty
chemicals, fuels and fragrances. The company licensed its technology
to Sanofi in 2008 for use in making synthetic artemisinin. Sanofi
plans to make the medicine available at low cost

Nestlé to expand medical nutrition business
The Swiss-based food giant, Nestlé, has announced a major
initiative it claims will prevent and treat health conditions such as
diabetes, heart disease and obesity.
Nestlé says it will invest around $500 million over the next
decade in the sector. The firm said on Monday that it hopes to
"pioneer a new industry between food and pharma"
© 2013 IBM Corporation

DuPont brings deep pockets to Genencor purchase
In early January, DuPont announced it would acquire Danisco, parent
of Genencor, for $6.3 billion. Genencor represents 35 percent of
Danisco’s total sales.

BASF Plans Production of Butanediol From Renewable
Feedstock Using Genomatica Technology
BASF plans to begin production of 1,4-butanediol based on
renewable feedstock (renewable BDO) using the patented process
of Genomatica, San Diego, California. The one-step fermentation
process is based on sugars as a renewable feedstock.

Microbes that mine
The Sossego mine, which Vale opened in 2004, produced 109,000
tons of copper in 2011. Its tailings pond, where samples of fungi
and bacteria are collected, contains approximately 90 million tons
of 0.07% copper-grade detritus. If this entire mineral content were
recovered, Vale could earn gross receipts of approximately
US$1.4 billion, more than the entire US$1.2 billion the company
invested between 1997 and 2004 to make the mine operational.
5
5
La Bioinformatica nelle prospettive della Bioeconomy

IBM Offering will Enhance the Value of the R&D Process, Through
Insight Discovery and Advanced Modeling and Simulation
- Building upon existing IBM investments in HCLS, Genomic Medicine-Cross Brand
Strategic Initiative

Potential strategic
partners

CLOUD OFFERING

API access to client
R&D environment

Insight extraction;
Reuse of previous
insights;
High value patents
Simulation &
Modeling

GBS lead virtual CRO (Contract Research Organization)

molecular modeling

systems biology

Design
Bio CAD
Analytics
machine learning

synthetic routes discovery

Watson

Aggregation,
Cleansing, Prep

Data
genome
© 2013 IBM Corporation

pathway

‘omics

literature phenotype
6
6
La Bioinformatica nelle prospettive della Bioeconomy

Methodology for modeling biological (‘Omics)
systems leverages techniques from circuit design
Use case: efficient chemical production (such as butanol)
Specification
•Input (abundant chemicals)
•Output (desired chemicals)
•Performance
• Yield
• Throughput
• Stabilities
• Response time
Find Biosynthetic Routes to
meet specification from Big Data.
Input:
Glucose
Output:
Butanol

© 2013 IBM Corporation

Design

Predictive Modeling
Simulation
•Models (Systems Biology)
• ODE
• PDE
• SDE
• Agent Based
•Input Parameters
•Molecular Bioenzyme Models

Select parts/devices for the
candidate biosynthetic routes
using Bio CAD.

Perform a predictive modeling
and simulations to pick
promising candidates for
implementations using HPC.

•Chassis
• E. Coli, Yeast, Algae etc.
•Devices/Bioparts
• Promoters
• Ribosomal Binding Sites
• Genes
• Terminators
•Intracellular Interactions

7
7
La Bioinformatica nelle prospettive della Bioeconomy

Predictive Modeling in Depth

Structure Activity Relationship

Input

Scoring

Activity (μmol/min-mg)

E. Coli Wild Type

35

13

His131Arg

43

240

Trp130His

38

108

His131Arg, Trp130His

All possible pathways are generated and
responsible enzymes are mapped from literature
and pathway databases.

Enzyme

52

780

Each specie can have a different sequence.

Enzyme E1.2

E. Coli
Yeast
…

CCAAAGCTTGGGCCTTTTCGTGA
CCAAACCAATGGCCTTTTCTTGA

Chemical 2
Enzyme E2.6
Enzyme E2.3

Optimize known
enzymes

Chemical 3
Enzyme E3.4

Chemical 6

Chemical 4
Enzyme E4.5

Chemical 5
Enzyme E5.7

No Enzyme or
Pathway Known

Perform de novo design using
Molecular Dynamic and QM/MM
hybrid methods

Output
© 2013 IBM Corporation

8
8
La Bioinformatica nelle prospettive della Bioeconomy

Food/Nutrition – Client Feedback
Michael Brown, Director, BioSciences & Sweeteness and
Taste Research, Global R&D, Coca-Cola
-R&D annual spend $60-100M
- Interested in getting the computational insights, as it pertain to their
personalized nutrition strategy
- Consumer analytics in our stack may be very good added value
- Strong relationship with IBM and IBM Research

Harold Schmitz, Chief Scientific Officer, Mars
- Strong research and innovation pipeline in 3-5 years with profound impact,
some occurring already, in plant genomics for food products, and in petcare
and petfood products.
- Genomics research is a critical input to overall R&D of food products, for
example in the chocolate business, role of genomics is inextricably linked to
sustainable production of cocoa. In 3-5 years the supply chain will
increasingly be based on genomics. In 5-10 years it will mostly be genomics
based. Its impact is to large part of our chocolate business, in $Billions. not
give out such numbers.
- Mars already spends several $10Ms, with a positive slope for next 3-5 years.
- Partnerships are essential to compete with major food companies - Nestle,
Unilever. Serious partnerships with academic, govt labs, and few key
industrial research partners (e.g. IBM).
© 2013 IBM Corporation

Danone ® probiotic
yogurt for digestive
health and immune
system (Activia ®),
bone health (Densia ®)
and heart health
(Danacol ®).

Kellogg's®
Smart Start®
Strong Heart
Antioxidants
cereal

9

9
La Bioinformatica nelle prospettive della Bioeconomy

Functional Processed Foods – A prototype use case
Client problem: Processed foods often have a negative impact on human health by adversely
altering the bacterial content of our intestinal tracts
Solution: Engineer foods with prebiotics to promote human health by promoting a healthy gut microbiome
IBM play: IT platform for modeling and simulating effects of food additives on gut microbial communities
Industry Differentiation: Systems biology domain experience, computational technology leadership
Processed food

Food engineering
(additives, prebiotics,
probiotics, fibers)

Simulate effect on
intestinal microbial
community

© 2013 IBM Corporation

Poor health

Obesity, diabetes, cardiovascular
disease, inflammatory bowel
disease, cancer, allergies,
osteoporosis

Client side
Analyze
food
chemistry

Design
product

Upload chemical
composition and
food assay results

API

Testing & iterative improvements
Measure substances of
interests: carcinogens,
cholesterol, vitamins, amino
acids, SCFA*

Data prep,
cleansing, and
aggregation

Systems
biology model
of gut
microbiology

Improved health

SCFA: Short Chain Fatty Acid

Test effect
on gut
microbes
Visual data analytics
Design
recommendations

Data analytics
and
visualization
(microbial
ratios, etc.)
Simulate food
effect on
microbial
content

10
10
La Bioinformatica nelle prospettive della Bioeconomy

Energy/Biofuels
•Bioethanol and more
advanced biofuels such as
current infrastructure
compatible
butanol/isobutanol are
expected to grow rapidly.
•Oil Majors are investing
with synthetic biology
companies.
•36 Billion gallons in 2022
and 60 Billion gallons in
2030 (Obama: US objectives)
Specification
•Input: CO2
•Output Butanol
•Performance
• Low Cost
• High Throughput
• Continuous Process
• Minimum
Waste/Byproducts
© 2013 IBM Corporation

Design
•Chassis: Cyanobacteria
•Devices:
• Promoter Selection
• Optimized Codon
• Optimized Amino Acids

Predictive Modeling
•Models (Systems Biology) to
evaluate to find candidates for
implementation and measurements.
•Optimize enzymes through
structural biology modeling.

11
11
La Bioinformatica nelle prospettive della Bioeconomy

Chemical Industry
•Currently over $7B worth of
chemicals are produced
biosynthetically and over $100B
in 2020 with CAGR 30%.
•10% of chemicals will be
produced in biorefineries in 2020
(World Economic Forum) and
25% will be by 2025 (US DOE
target)
•Not just bulk chemicals,
functional chemicals (enzymes,
drugs, tire rubber, polymer,
fragrance, OEL, OPV) will be
produced.
Specification
•Input: Glucose
•Output : Anti-Tuberculosis drug
•Performance
• Low Cost
• High product quality
• High yield

© 2013 IBM Corporation

Source: P. Nieuwenhuizen and D.
Lyon, J of Commercial Biotech., 2011

Design
•Chassis: E. Coli
•Devices:
• Promoter Selection
• Optimized Codon
• Optimized Amino Acids

Predictive Modeling
•Models (Systems Biology) to
evaluate to find candidates for
implementation and measurements.
•Optimize enzymes through
structural biology modeling.

12
12
La Bioinformatica nelle prospettive della Bioeconomy

© 2013 IBM Corporation

13
13
La Bioinformatica nelle prospettive della Bioeconomy

Backup

© 2013 IBM Corporation

14
14
La Bioinformatica nelle prospettive della Bioeconomy

World Economic Forum: Top 10 Emerging Technologies 2012
1. Informatics for adding value to information
The quantity of information now available to individuals and organizations is unprecedented in human history, and the rate of information generation continues to grow exponentially.
Yet, the sheer volume of information is in danger of creating more noise than value, and as a result limiting its effective use. Innovations in how information is organized, mined and
processed hold the key to filtering out the noise and using the growing wealth of global information to address emerging challenges.

2. Synthetic biology and metabolic engineering
The natural world is a testament to the vast potential inherent in the genetic code at the core of all living organisms. Rapid advances in synthetic biology and metabolic engineering are
allowing biologists and engineers to tap into this potential in unprecedented ways, enabling the development of new biological processes and organisms that are designed to serve
specific purposes – whether converting biomass to chemicals, fuels and materials, producing new therapeutic drugs or protecting the body against harm.

3. Green Revolution 2.0 – technologies for increased food and biomass
Artificial fertilizers are one of the main achievements of modern chemistry, enabling unprecedented increases in crop production yield. Yet, the growing global demand for healthy and
nutritious food is threatening to outstrip energy, water and land resources. By integrating advances across the biological and physical sciences, the new green revolution holds the
promise of further increasing crop production yields, minimizing environmental impact, reducing energy and water dependence, and decreasing the carbon footprint.

4. Nanoscale design of materials
The increasing demand on natural resources requires unprecedented gains in efficiency. Nanostructured materials with tailored properties, designed and engineered at the molecular
scale, are already showing novel and unique features that will usher in the next clean energy revolution, reduce our dependence on depleting natural resources, and increase atomefficiency manufacturing and processing.

5. Systems biology and computational modelling/simulation of chemical and biological systems
For improved healthcare and bio-based manufacturing, it is essential to understand how biology and chemistry work together. Systems biology and computational modelling and
simulation are playing increasingly important roles in designing therapeutics, materials and processes that are highly efficient in achieving their design goals, while minimally impacting
on human health and the environment.

6. Utilization of carbon dioxide as a resource
Carbon is at the heart of all life on earth. Yet, managing carbon dioxide releases is one of the greatest social, political and economic challenges of our time. An emerging innovative
approach to carbon dioxide management involves transforming it from a liability to a resource. Novel catalysts, based on nanostructured materials, can potentially transform carbon
dioxide to high value hydrocarbons and other carbon-containing molecules, which could be used as new building blocks for the chemical industry as cleaner and more sustainable
alternatives to petrochemicals.

7. Wireless power
Society is deeply reliant on electrically powered devices. Yet, a significant limitation in their continued development and utility is the need to be attached to the electricity grid by wire –
either permanently or through frequent battery recharging. Emerging approaches to wireless power transmission will free electrical devices from having to be physically plugged in, and
are poised to have as significant an impact on personal electronics as Wi-Fi had on Internet use.

8. High energy density power systems
Better batteries are essential if the next generation of clean energy technologies are to be realized. A number of emerging technologies are coming together to lay the foundation for
advanced electrical energy storage and use, including the development of nanostructured electrodes, solid electrolysis and rapid-power delivery from novel supercapacitors based on
carbon-based nanomaterials. These technologies will provide the energy density and power needed to supercharge the next generation of clean energy technologies.

9. Personalized medicine, nutrition and disease prevention
As the global population exceeds 7 billion people – all hoping for a long and healthy life – conventional approaches to ensuring good health are becoming less and less tenable, spurred
on by growing demands, dwindling resources and increasing costs. Advances in areas such as genomics, proteomics and metabolomics are now opening up the possibility of tailoring
medicine, nutrition and disease prevention to the individual. Together with emerging technologies like synthetic biology and nanotechnology, they are laying the foundation for a
revolution in healthcare and well-being that will be less resource intensive and more targeted to individual needs.

10. Enhanced education technology
New approaches are needed to meet the challenge of educating a growing young population and providing the skills that are essential to the knowledge economy. This is especially the
case in today’s rapidly evolving and hyperconnected globalized society. Personalized IT-based approaches to education are emerging that allow learner-centred education, critical
thinking development and creativity. Rapid developments in social media, open courseware and ubiquitous access to the Internet are facilitating outside classroom and continuous
education.
© 2013 IBM Corporation
15
15
La Bioinformatica nelle prospettive della Bioeconomy

Computer will accelerate Biospace Revolution
 Search space is enormous!
 Data
– Literature (unstructured)
– Genomic Data
• Millions of species on Earth
• Each specie has 1000s of gene
– Omics Data
• Mass-spec data
• Protein structure data (PDB etc.)
• Transcriptome data
• Pathway data (KEGG etc.)
– Chemical Data
• Almost infinite # of chemical compounds (only 10 M is known)
 Insight Discovery
– Biosynthetic Routes
– Effects of external stimulus
 Modeling/Simulation
– Multiple devices to design
– Order of devices matters
– Each device consists of promoter, RBS, gene
– Gene can be optimized
– Bioenzyme modeling and optimization through structural biology and computational chemistry

© 2013 IBM Corporation

16
16
La Bioinformatica nelle prospettive della Bioeconomy

Example: Biosynthetic Pathways of Isobutanol
Enzyme

Glucose
Acetate synthase

•Each enzyme can have variations
between species. The sequence and
structure information can be carried
out to further optimization of activity.
•An alternative pathway might exist to
shortcut reactions. Either find such an
enzyme from known species or de
Novo design of enzyme is carried out.

Pyruvate

Acetyl-CoA
KARI

S-Acetolactate
Novel Enzymes

Acetohydroxy acid dehydratase

2,3-dihydroxy
isovalerate
Acetohydroxy acid dehydratase

Butyryl-CoA
Isobutyryl-CoA mutase

Isobutyryl-CoA
Acylating aldehide dehydrogenase

2-ketoisovalerate
Valine
dehydrogenase
Branched chain keto
acid dehydrogenase

Branched chain keto
Acid decarboxylase

Valine
Valine decarboxylase

Isobutylamine
Omega transaminase

Isobutylaldehyde
Branched chain alcohol dehydrogenase

Isobutanol
© 2013 IBM Corporation

17
17
La Bioinformatica nelle prospettive della Bioeconomy

Solution Overview:
Application

Healthcare

•Personalized/Preventive/Preem
ptive Healthcare
•Early detection and better
Cancer Survival
•Programmed Cell Therapy
•Accelerated drug discovery

Agriculture and Food

•Improve food production
efficiency
•Expand arable land
•Food safety
•Artificial meat

Analytics

•Biofuel productions and
process innovations.
•Clean water, soil, and air by
bacteria and insects
•Recovery heavy metal,
precious metal and rare earth
•carbon sequestration

Biology Multimodal Big Data Analytics
Cognitive Computing
Statistical Analysis

•Watson
•Automatic Insight Discovery

Energy and Environment

Chemical, Pharmaceutical
and Consumer Products

•Green Chemistry
•High functional products
•Inexpensive manufacturing

in silico Design and Predictive Modeling
Systems Biology
Molecular Model

•QTL analysis
•Similarity
•Machine Learning

•Pathway Analysis
•Disease Modeling
•In-vitro Human/Animal Model

•Protein Modeling
•Compound Modeling
•Membrane
•Nucleic Acid Modeling
•Tissue

Data

Sequence Data

•DNA/Genome
•RNA
•Microbiome
•Immuno profile
•Epigenome

Technology Layer

$1000 Genome

© 2013 IBM Corporation

Other Omics

•Metabolomics
•Proteomics
•Gene Expression

Image

•Body Scan
•Brain scan
•Cell Image
•Virus
•Molecules

Sense and Interact with Biological Objects
Nanotechnology

•Microarray
•Non-invasive biosensor/MEMS
•Cell Machine Interface
•Micro-/Nanofluidics
•DDS (Drug Delivery System)
•Nanoscaffold/tissue engineering
•Advanced Microscopy

Sensor Data

•Virus/bacteria
•Toxic chemical
compounds
•vital

Text

•Literature
•Web
•Medical Records

Imaging Technology

•CT
•MRI/fMRI
•STED, STORM/PALM, SIM
•Confocal Microscopy
•Mass Spectrometr
•Crystallography
•Hi-C

18
La Bioinformatica nelle prospettive della Bioeconomy

Paradigm Shift in Industry (New Industry Revolution)
US DOE set goal of at least 25% of renewable source for industrial
products in 2025 (25x25) and 30% of biofuel in 2030 (30x30).
Drivers of Biospace Revolution
Synthetic Biology

Before 1970

2000

Bioinformatics

Oil Parity Expected
circa 2020

coal

coal

Oil
Coalchemical
© 2013 IBM Corporation

Oil
Green
Chemical

Petrochemical

2030
coal

Oil

Green
Chemical

Nanotechnology

20-30%
Green Chemical
Petrochemical & Green Chemical
19

More Related Content

Similar to IBM Italia, Bari – La Bioinformatica nelle prospettive della Bioeconomy

Dyadic C1 Family Office Opportunity
Dyadic C1 Family Office OpportunityDyadic C1 Family Office Opportunity
Dyadic C1 Family Office OpportunityDyadic
 
09 CeoMeeting- Keynote
09 CeoMeeting- Keynote09 CeoMeeting- Keynote
09 CeoMeeting- KeynoteMLSCF
 
Bill Gates Reveals The 10 Breakthrough Technologies That Will Change The Worl...
Bill Gates Reveals The 10 Breakthrough Technologies That Will Change The Worl...Bill Gates Reveals The 10 Breakthrough Technologies That Will Change The Worl...
Bill Gates Reveals The 10 Breakthrough Technologies That Will Change The Worl...Bernard Marr
 
The value of strategic partnerships to build technological leadership - Chris...
The value of strategic partnerships to build technological leadership - Chris...The value of strategic partnerships to build technological leadership - Chris...
The value of strategic partnerships to build technological leadership - Chris...Novamont Spa
 
Ibm research 5in5_2019
Ibm research 5in5_2019Ibm research 5in5_2019
Ibm research 5in5_2019Pietro Leo
 
The Business Of Biotech - Opportunities For Indian Biosimilars : Kapil Khande...
The Business Of Biotech - Opportunities For Indian Biosimilars : Kapil Khande...The Business Of Biotech - Opportunities For Indian Biosimilars : Kapil Khande...
The Business Of Biotech - Opportunities For Indian Biosimilars : Kapil Khande...Kapil Khandelwal (KK)
 
Quaker Oats- Market Plan
Quaker Oats- Market PlanQuaker Oats- Market Plan
Quaker Oats- Market PlanJane Gozenpud
 
Paradigm Change in Biomanufacturing
Paradigm Change in Biomanufacturing Paradigm Change in Biomanufacturing
Paradigm Change in Biomanufacturing PnuVax
 
AI, Automation and Appetites: How Technology Will Feed the Future
AI, Automation and Appetites: How Technology Will Feed the FutureAI, Automation and Appetites: How Technology Will Feed the Future
AI, Automation and Appetites: How Technology Will Feed the FutureCognizant
 
The State of ILRI
The State of ILRIThe State of ILRI
The State of ILRIILRI
 
IgY Exec Summary Jan 7 '16
IgY Exec Summary Jan 7 '16IgY Exec Summary Jan 7 '16
IgY Exec Summary Jan 7 '16David Fyhrie
 
applied strategic biosimilars success
applied strategic biosimilars successapplied strategic biosimilars success
applied strategic biosimilars successRichard Littlewood
 
applied strategic biosimilars success
applied strategic biosimilars successapplied strategic biosimilars success
applied strategic biosimilars successRichard Littlewood
 
Biopharma's search for sustainable growth
Biopharma's search for sustainable growthBiopharma's search for sustainable growth
Biopharma's search for sustainable growthaccenture
 
Era of Artificial Intelligence Lecture 3 Pietro Leo
Era of Artificial Intelligence Lecture 3 Pietro LeoEra of Artificial Intelligence Lecture 3 Pietro Leo
Era of Artificial Intelligence Lecture 3 Pietro LeoPietro Leo
 
Most emerging biotech companies to watch.pdf
Most emerging biotech companies to watch.pdfMost emerging biotech companies to watch.pdf
Most emerging biotech companies to watch.pdfInsightsSuccess4
 
Biobanking Market by Product Type, Distribution Channel, End User 2023-2028
Biobanking Market by Product Type, Distribution Channel, End User 2023-2028Biobanking Market by Product Type, Distribution Channel, End User 2023-2028
Biobanking Market by Product Type, Distribution Channel, End User 2023-2028IMARC Group
 

Similar to IBM Italia, Bari – La Bioinformatica nelle prospettive della Bioeconomy (20)

Dyadic C1 Family Office Opportunity
Dyadic C1 Family Office OpportunityDyadic C1 Family Office Opportunity
Dyadic C1 Family Office Opportunity
 
09 CeoMeeting- Keynote
09 CeoMeeting- Keynote09 CeoMeeting- Keynote
09 CeoMeeting- Keynote
 
Bill Gates Reveals The 10 Breakthrough Technologies That Will Change The Worl...
Bill Gates Reveals The 10 Breakthrough Technologies That Will Change The Worl...Bill Gates Reveals The 10 Breakthrough Technologies That Will Change The Worl...
Bill Gates Reveals The 10 Breakthrough Technologies That Will Change The Worl...
 
The value of strategic partnerships to build technological leadership - Chris...
The value of strategic partnerships to build technological leadership - Chris...The value of strategic partnerships to build technological leadership - Chris...
The value of strategic partnerships to build technological leadership - Chris...
 
Ibm research 5in5_2019
Ibm research 5in5_2019Ibm research 5in5_2019
Ibm research 5in5_2019
 
Biosimilars white paper asia pac 311012
Biosimilars white paper asia pac 311012Biosimilars white paper asia pac 311012
Biosimilars white paper asia pac 311012
 
The Business Of Biotech - Opportunities For Indian Biosimilars : Kapil Khande...
The Business Of Biotech - Opportunities For Indian Biosimilars : Kapil Khande...The Business Of Biotech - Opportunities For Indian Biosimilars : Kapil Khande...
The Business Of Biotech - Opportunities For Indian Biosimilars : Kapil Khande...
 
Quaker Oats- Market Plan
Quaker Oats- Market PlanQuaker Oats- Market Plan
Quaker Oats- Market Plan
 
Millipore biooutsource
Millipore biooutsourceMillipore biooutsource
Millipore biooutsource
 
Paradigm Change in Biomanufacturing
Paradigm Change in Biomanufacturing Paradigm Change in Biomanufacturing
Paradigm Change in Biomanufacturing
 
AI, Automation and Appetites: How Technology Will Feed the Future
AI, Automation and Appetites: How Technology Will Feed the FutureAI, Automation and Appetites: How Technology Will Feed the Future
AI, Automation and Appetites: How Technology Will Feed the Future
 
The State of ILRI
The State of ILRIThe State of ILRI
The State of ILRI
 
IgY Exec Summary Jan 7 '16
IgY Exec Summary Jan 7 '16IgY Exec Summary Jan 7 '16
IgY Exec Summary Jan 7 '16
 
applied strategic biosimilars success
applied strategic biosimilars successapplied strategic biosimilars success
applied strategic biosimilars success
 
applied strategic biosimilars success
applied strategic biosimilars successapplied strategic biosimilars success
applied strategic biosimilars success
 
Biopharma's search for sustainable growth
Biopharma's search for sustainable growthBiopharma's search for sustainable growth
Biopharma's search for sustainable growth
 
Era of Artificial Intelligence Lecture 3 Pietro Leo
Era of Artificial Intelligence Lecture 3 Pietro LeoEra of Artificial Intelligence Lecture 3 Pietro Leo
Era of Artificial Intelligence Lecture 3 Pietro Leo
 
Most emerging biotech companies to watch.pdf
Most emerging biotech companies to watch.pdfMost emerging biotech companies to watch.pdf
Most emerging biotech companies to watch.pdf
 
Biobanking Market by Product Type, Distribution Channel, End User 2023-2028
Biobanking Market by Product Type, Distribution Channel, End User 2023-2028Biobanking Market by Product Type, Distribution Channel, End User 2023-2028
Biobanking Market by Product Type, Distribution Channel, End User 2023-2028
 
Biologics This Decade
Biologics This DecadeBiologics This Decade
Biologics This Decade
 

More from eventi-ITBbari

BiPday 2014 -- Vicario Saverio
BiPday 2014 -- Vicario SaverioBiPday 2014 -- Vicario Saverio
BiPday 2014 -- Vicario Saverioeventi-ITBbari
 
BiPday 2014 -- Tulipano Angelica
BiPday 2014 -- Tulipano AngelicaBiPday 2014 -- Tulipano Angelica
BiPday 2014 -- Tulipano Angelicaeventi-ITBbari
 
BiPday 2014 -- Pesole Graziano
BiPday 2014 -- Pesole GrazianoBiPday 2014 -- Pesole Graziano
BiPday 2014 -- Pesole Grazianoeventi-ITBbari
 
BiPday 2014 -- Santorsola Mariangela
BiPday 2014 -- Santorsola MariangelaBiPday 2014 -- Santorsola Mariangela
BiPday 2014 -- Santorsola Mariangelaeventi-ITBbari
 
BiPday 2014 -- Notarangelo Pasquale
BiPday 2014 -- Notarangelo PasqualeBiPday 2014 -- Notarangelo Pasquale
BiPday 2014 -- Notarangelo Pasqualeeventi-ITBbari
 
BiPday 2014 -- Donvito Giacinto
BiPday 2014 -- Donvito GiacintoBiPday 2014 -- Donvito Giacinto
BiPday 2014 -- Donvito Giacintoeventi-ITBbari
 
BiPday 2014 -- De Molfetta Rita
BiPday 2014 -- De Molfetta RitaBiPday 2014 -- De Molfetta Rita
BiPday 2014 -- De Molfetta Ritaeventi-ITBbari
 
BiPday 2014 -- Ceci Michelangelo
BiPday 2014 -- Ceci MichelangeloBiPday 2014 -- Ceci Michelangelo
BiPday 2014 -- Ceci Michelangeloeventi-ITBbari
 
BiPday 2014 -- Clima Rosanna
BiPday 2014 -- Clima RosannaBiPday 2014 -- Clima Rosanna
BiPday 2014 -- Clima Rosannaeventi-ITBbari
 
BiPday 2014 --Creanza Teresa
BiPday 2014 --Creanza TeresaBiPday 2014 --Creanza Teresa
BiPday 2014 --Creanza Teresaeventi-ITBbari
 
Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...
Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...
Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...eventi-ITBbari
 
Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...
Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...
Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...eventi-ITBbari
 
Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...
Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...
Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...eventi-ITBbari
 
Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...
Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...
Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...eventi-ITBbari
 
Nicola Ancona – Dall’Intelligenza Artificiale alla Systems Medicine
Nicola Ancona – Dall’Intelligenza Artificiale alla Systems MedicineNicola Ancona – Dall’Intelligenza Artificiale alla Systems Medicine
Nicola Ancona – Dall’Intelligenza Artificiale alla Systems Medicineeventi-ITBbari
 
Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...
Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...
Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...eventi-ITBbari
 
Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...
Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...
Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...eventi-ITBbari
 
Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...
Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...
Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...eventi-ITBbari
 
Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...
Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...
Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...eventi-ITBbari
 
Piero Larizza – “La Robotica nella Bioinformatica”
Piero Larizza – “La Robotica nella Bioinformatica”Piero Larizza – “La Robotica nella Bioinformatica”
Piero Larizza – “La Robotica nella Bioinformatica”eventi-ITBbari
 

More from eventi-ITBbari (20)

BiPday 2014 -- Vicario Saverio
BiPday 2014 -- Vicario SaverioBiPday 2014 -- Vicario Saverio
BiPday 2014 -- Vicario Saverio
 
BiPday 2014 -- Tulipano Angelica
BiPday 2014 -- Tulipano AngelicaBiPday 2014 -- Tulipano Angelica
BiPday 2014 -- Tulipano Angelica
 
BiPday 2014 -- Pesole Graziano
BiPday 2014 -- Pesole GrazianoBiPday 2014 -- Pesole Graziano
BiPday 2014 -- Pesole Graziano
 
BiPday 2014 -- Santorsola Mariangela
BiPday 2014 -- Santorsola MariangelaBiPday 2014 -- Santorsola Mariangela
BiPday 2014 -- Santorsola Mariangela
 
BiPday 2014 -- Notarangelo Pasquale
BiPday 2014 -- Notarangelo PasqualeBiPday 2014 -- Notarangelo Pasquale
BiPday 2014 -- Notarangelo Pasquale
 
BiPday 2014 -- Donvito Giacinto
BiPday 2014 -- Donvito GiacintoBiPday 2014 -- Donvito Giacinto
BiPday 2014 -- Donvito Giacinto
 
BiPday 2014 -- De Molfetta Rita
BiPday 2014 -- De Molfetta RitaBiPday 2014 -- De Molfetta Rita
BiPday 2014 -- De Molfetta Rita
 
BiPday 2014 -- Ceci Michelangelo
BiPday 2014 -- Ceci MichelangeloBiPday 2014 -- Ceci Michelangelo
BiPday 2014 -- Ceci Michelangelo
 
BiPday 2014 -- Clima Rosanna
BiPday 2014 -- Clima RosannaBiPday 2014 -- Clima Rosanna
BiPday 2014 -- Clima Rosanna
 
BiPday 2014 --Creanza Teresa
BiPday 2014 --Creanza TeresaBiPday 2014 --Creanza Teresa
BiPday 2014 --Creanza Teresa
 
Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...
Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...
Exprivia – Incorporazione ed utilizzo di dati genomici nella cartella clinica...
 
Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...
Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...
Maria A. Diroma – MEWAs: sviluppo di un sistema bioinformatico per studi di a...
 
Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...
Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...
Massimo Carella – Analisi delle varianti genomiche da metodiche high-throughp...
 
Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...
Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...
Ernesto Picardi – Bioinformatica e genomica comparata: nuove strategie sperim...
 
Nicola Ancona – Dall’Intelligenza Artificiale alla Systems Medicine
Nicola Ancona – Dall’Intelligenza Artificiale alla Systems MedicineNicola Ancona – Dall’Intelligenza Artificiale alla Systems Medicine
Nicola Ancona – Dall’Intelligenza Artificiale alla Systems Medicine
 
Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...
Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...
Maria Svelto – il Distretto H-BIO Puglia: sfide ed opportunità per la Bioinfo...
 
Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...
Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...
Elvira Tarsitano – Bioinformatica e scienze omiche, il ruolo della formazione...
 
Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...
Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...
Pasquale Saldarelli – La piattaforma genomica di sequenziamento massivo della...
 
Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...
Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...
Domenico Catalano – Bioinformatica applicata a dati di genomica e trascrittom...
 
Piero Larizza – “La Robotica nella Bioinformatica”
Piero Larizza – “La Robotica nella Bioinformatica”Piero Larizza – “La Robotica nella Bioinformatica”
Piero Larizza – “La Robotica nella Bioinformatica”
 

Recently uploaded

Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room DeliveryCall 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room DeliveryJyoti singh
 
Kolkata Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Kolka...
Kolkata Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Kolka...Kolkata Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Kolka...
Kolkata Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Kolka...Sheetaleventcompany
 
ANATOMY AND PHYSIOLOGY OF RESPIRATORY SYSTEM.pptx
ANATOMY AND PHYSIOLOGY OF RESPIRATORY SYSTEM.pptxANATOMY AND PHYSIOLOGY OF RESPIRATORY SYSTEM.pptx
ANATOMY AND PHYSIOLOGY OF RESPIRATORY SYSTEM.pptxSwetaba Besh
 
Call Girls Kathua Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kathua Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Kathua Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kathua Just Call 8250077686 Top Class Call Girl Service AvailableDipal Arora
 
💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...
💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...
💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...Sheetaleventcompany
 
Call Girls in Lucknow Just Call 👉👉8630512678 Top Class Call Girl Service Avai...
Call Girls in Lucknow Just Call 👉👉8630512678 Top Class Call Girl Service Avai...Call Girls in Lucknow Just Call 👉👉8630512678 Top Class Call Girl Service Avai...
Call Girls in Lucknow Just Call 👉👉8630512678 Top Class Call Girl Service Avai...soniyagrag336
 
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...gragneelam30
 
Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...
Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...
Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...Sheetaleventcompany
 
Call Girl In Indore 📞9235973566📞 Just📲 Call Inaaya Indore Call Girls Service ...
Call Girl In Indore 📞9235973566📞 Just📲 Call Inaaya Indore Call Girls Service ...Call Girl In Indore 📞9235973566📞 Just📲 Call Inaaya Indore Call Girls Service ...
Call Girl In Indore 📞9235973566📞 Just📲 Call Inaaya Indore Call Girls Service ...Sheetaleventcompany
 
Circulatory Shock, types and stages, compensatory mechanisms
Circulatory Shock, types and stages, compensatory mechanismsCirculatory Shock, types and stages, compensatory mechanisms
Circulatory Shock, types and stages, compensatory mechanismsMedicoseAcademics
 
Kolkata Call Girls Shobhabazar 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Gir...
Kolkata Call Girls Shobhabazar  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Gir...Kolkata Call Girls Shobhabazar  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Gir...
Kolkata Call Girls Shobhabazar 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Gir...Namrata Singh
 
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...Sheetaleventcompany
 
Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...
Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...
Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...Dipal Arora
 
❤️Amritsar Escorts Service☎️9815674956☎️ Call Girl service in Amritsar☎️ Amri...
❤️Amritsar Escorts Service☎️9815674956☎️ Call Girl service in Amritsar☎️ Amri...❤️Amritsar Escorts Service☎️9815674956☎️ Call Girl service in Amritsar☎️ Amri...
❤️Amritsar Escorts Service☎️9815674956☎️ Call Girl service in Amritsar☎️ Amri...Sheetaleventcompany
 
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...rajnisinghkjn
 
(RIYA)🎄Airhostess Call Girl Jaipur Call Now 8445551418 Premium Collection Of ...
(RIYA)🎄Airhostess Call Girl Jaipur Call Now 8445551418 Premium Collection Of ...(RIYA)🎄Airhostess Call Girl Jaipur Call Now 8445551418 Premium Collection Of ...
(RIYA)🎄Airhostess Call Girl Jaipur Call Now 8445551418 Premium Collection Of ...TanyaAhuja34
 
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service AvailableCall Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Availableperfect solution
 
💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...
💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...
💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...gragneelam30
 
Low Cost Call Girls Bangalore {9179660964} ❤️VVIP NISHA Call Girls in Bangalo...
Low Cost Call Girls Bangalore {9179660964} ❤️VVIP NISHA Call Girls in Bangalo...Low Cost Call Girls Bangalore {9179660964} ❤️VVIP NISHA Call Girls in Bangalo...
Low Cost Call Girls Bangalore {9179660964} ❤️VVIP NISHA Call Girls in Bangalo...Sheetaleventcompany
 
Chennai ❣️ Call Girl 6378878445 Call Girls in Chennai Escort service book now
Chennai ❣️ Call Girl 6378878445 Call Girls in Chennai Escort service book nowChennai ❣️ Call Girl 6378878445 Call Girls in Chennai Escort service book now
Chennai ❣️ Call Girl 6378878445 Call Girls in Chennai Escort service book nowtanudubay92
 

Recently uploaded (20)

Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room DeliveryCall 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
Call 8250092165 Patna Call Girls ₹4.5k Cash Payment With Room Delivery
 
Kolkata Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Kolka...
Kolkata Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Kolka...Kolkata Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Kolka...
Kolkata Call Girls Service ❤️🍑 9xx000xx09 👄🫦 Independent Escort Service Kolka...
 
ANATOMY AND PHYSIOLOGY OF RESPIRATORY SYSTEM.pptx
ANATOMY AND PHYSIOLOGY OF RESPIRATORY SYSTEM.pptxANATOMY AND PHYSIOLOGY OF RESPIRATORY SYSTEM.pptx
ANATOMY AND PHYSIOLOGY OF RESPIRATORY SYSTEM.pptx
 
Call Girls Kathua Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kathua Just Call 8250077686 Top Class Call Girl Service AvailableCall Girls Kathua Just Call 8250077686 Top Class Call Girl Service Available
Call Girls Kathua Just Call 8250077686 Top Class Call Girl Service Available
 
💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...
💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...
💚Chandigarh Call Girls Service 💯Piya 📲🔝8868886958🔝Call Girls In Chandigarh No...
 
Call Girls in Lucknow Just Call 👉👉8630512678 Top Class Call Girl Service Avai...
Call Girls in Lucknow Just Call 👉👉8630512678 Top Class Call Girl Service Avai...Call Girls in Lucknow Just Call 👉👉8630512678 Top Class Call Girl Service Avai...
Call Girls in Lucknow Just Call 👉👉8630512678 Top Class Call Girl Service Avai...
 
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...
Call Girls Bangalore - 450+ Call Girl Cash Payment 💯Call Us 🔝 6378878445 🔝 💃 ...
 
Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...
Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...
Premium Call Girls Nagpur {9xx000xx09} ❤️VVIP POOJA Call Girls in Nagpur Maha...
 
Call Girl In Indore 📞9235973566📞 Just📲 Call Inaaya Indore Call Girls Service ...
Call Girl In Indore 📞9235973566📞 Just📲 Call Inaaya Indore Call Girls Service ...Call Girl In Indore 📞9235973566📞 Just📲 Call Inaaya Indore Call Girls Service ...
Call Girl In Indore 📞9235973566📞 Just📲 Call Inaaya Indore Call Girls Service ...
 
Circulatory Shock, types and stages, compensatory mechanisms
Circulatory Shock, types and stages, compensatory mechanismsCirculatory Shock, types and stages, compensatory mechanisms
Circulatory Shock, types and stages, compensatory mechanisms
 
Kolkata Call Girls Shobhabazar 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Gir...
Kolkata Call Girls Shobhabazar  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Gir...Kolkata Call Girls Shobhabazar  💯Call Us 🔝 8005736733 🔝 💃  Top Class Call Gir...
Kolkata Call Girls Shobhabazar 💯Call Us 🔝 8005736733 🔝 💃 Top Class Call Gir...
 
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...
❤️Chandigarh Escorts Service☎️9814379184☎️ Call Girl service in Chandigarh☎️ ...
 
Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...
Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...
Bhawanipatna Call Girls 📞9332606886 Call Girls in Bhawanipatna Escorts servic...
 
❤️Amritsar Escorts Service☎️9815674956☎️ Call Girl service in Amritsar☎️ Amri...
❤️Amritsar Escorts Service☎️9815674956☎️ Call Girl service in Amritsar☎️ Amri...❤️Amritsar Escorts Service☎️9815674956☎️ Call Girl service in Amritsar☎️ Amri...
❤️Amritsar Escorts Service☎️9815674956☎️ Call Girl service in Amritsar☎️ Amri...
 
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...
👉 Chennai Sexy Aunty’s WhatsApp Number 👉📞 7427069034 👉📞 Just📲 Call Ruhi Colle...
 
(RIYA)🎄Airhostess Call Girl Jaipur Call Now 8445551418 Premium Collection Of ...
(RIYA)🎄Airhostess Call Girl Jaipur Call Now 8445551418 Premium Collection Of ...(RIYA)🎄Airhostess Call Girl Jaipur Call Now 8445551418 Premium Collection Of ...
(RIYA)🎄Airhostess Call Girl Jaipur Call Now 8445551418 Premium Collection Of ...
 
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service AvailableCall Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
Call Girls Rishikesh Just Call 9667172968 Top Class Call Girl Service Available
 
💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...
💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...
💰Call Girl In Bangalore☎️63788-78445💰 Call Girl service in Bangalore☎️Bangalo...
 
Low Cost Call Girls Bangalore {9179660964} ❤️VVIP NISHA Call Girls in Bangalo...
Low Cost Call Girls Bangalore {9179660964} ❤️VVIP NISHA Call Girls in Bangalo...Low Cost Call Girls Bangalore {9179660964} ❤️VVIP NISHA Call Girls in Bangalo...
Low Cost Call Girls Bangalore {9179660964} ❤️VVIP NISHA Call Girls in Bangalo...
 
Chennai ❣️ Call Girl 6378878445 Call Girls in Chennai Escort service book now
Chennai ❣️ Call Girl 6378878445 Call Girls in Chennai Escort service book nowChennai ❣️ Call Girl 6378878445 Call Girls in Chennai Escort service book now
Chennai ❣️ Call Girl 6378878445 Call Girls in Chennai Escort service book now
 

IBM Italia, Bari – La Bioinformatica nelle prospettive della Bioeconomy

  • 1. La Bioinformatica nelle prospettive della Bioeconomy BIOSPACE REVOLUTION ‘Omics (Genomics and Beyond) Analytics & Modeling Gaetano Scioscia IBM Italia, Bari BiP-Day 2013 Bari, 5 dicembre 2013 © 2013 IBM Corporation
  • 2. La Bioinformatica nelle prospettive della Bioeconomy Recent Reports in Bioeconomy: Biospace Revolution address Societal Grand Challenges “Biotechnology offers technological solutions for many of the health and resource-based challenges facing the world.” © 2013 IBM Corporation “The bioeconomy has emerged as an Obama Administration priority because of its tremendous potential for growth as well as the many other societal benefits it offers.” “The mature, sustainable Bioeconomy will help deliver global food security, improve nutrition and health, create smart bio-based products and biofuels, and help agriculture, forestry, aquaculture and other ecosystems to adapt to climate change.” 2 2
  • 3. La Bioinformatica nelle prospettive della Bioeconomy Disruptive technologies: Advances that will transform life, business, and the global economy May 2013 Next-generation genomics marries advances in the science of sequencing and modifying genetic material with the latest big data analytics capabilities. Today, a human genome can be sequenced in a few hours and for a few thousand dollars, a task that took 13 years and $2.7 billion to accomplish during the Human Genome Project. … The next step is synthetic biology —the ability to precisely customize organisms by “writing” DNA. These advances in the power and availability of genetic science could have profound impact on medicine, agriculture, and even the production of high-value substances such as biofuels—as well as speed up the process of drug discovery. Insights for Industry Experts • “Through all the ‘omics revolutions, essentially turned biology into an Information Science” • “We have massive amounts of information at the top in the cloud, with users at the bottom in different industries. The biggest barrier to any real use is the lack of standardization and connectability”  Steve Burrill; July 8, 2013  CEO,  Burrill and Company http://www.burrillandco.com/team-138G_Steven__Burrill.html Range of sized potential economic impacts Low • “In terms of industry investment, Healthcare, Chemical, Food are hot targets; Fuel less so; Electronics not interesting” High Estimated potential economic impact of technologies in 2025 • “Huge value emerging in microbiome” 700B-1.6T (US$) Next Generation Genomics © 2013 IBM Corporation Fast, low-cost gene sequencing advanced big data analytics, and synthetic biology (“writing” DNA)  Jonathan Fleming; July 11, 2013  Managing General Partner,  Oxford Bioscience http://www.oxbio.com/team.html 3 3
  • 4. La Bioinformatica nelle prospettive della Bioeconomy Biospace market is growing rapidly to a $11B in 2016 at a CAGR of 46% The global value of the synthetic biology market* reached $1.1 billion in 2010. It is expected to reach $1.6 billion in 2011 and it will further grow to $10.8 billion by 2016, increasing at a compound annual growth rate (CAGR) of 45.8.%. Source: BCC Research, Nov 2011 60 $49B 50 40 30 20 10 0 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 Bioinformatics market is $3.2 billion in 2012 and is forecasted to grow to nearly $7.5 billion by 2017 with 20.3% CAGR. At this pace, the market reaches at $13B in 2020. Source: BCC Research, Mar 2013 *industries outside of Healthcare © 2013 IBM Corporation 4 4
  • 5. La Bioinformatica nelle prospettive della Bioeconomy Large companies across several industries have recently been investing in Biospace BP to Invest $500 Million on Biofuels at a Research Center In one of the largest research grants by an oil company, BP is planning to spend $500 million over the next 10 years to finance major work on biofuels to find "longer-term commercial alternatives to oil and gas." Amyris rises on Sanofi malaria drug news Amyris uses genetically modified microorganisms — mainly yeast — to make products for a variety of markets including specialty chemicals, fuels and fragrances. The company licensed its technology to Sanofi in 2008 for use in making synthetic artemisinin. Sanofi plans to make the medicine available at low cost Nestlé to expand medical nutrition business The Swiss-based food giant, Nestlé, has announced a major initiative it claims will prevent and treat health conditions such as diabetes, heart disease and obesity. Nestlé says it will invest around $500 million over the next decade in the sector. The firm said on Monday that it hopes to "pioneer a new industry between food and pharma" © 2013 IBM Corporation DuPont brings deep pockets to Genencor purchase In early January, DuPont announced it would acquire Danisco, parent of Genencor, for $6.3 billion. Genencor represents 35 percent of Danisco’s total sales. BASF Plans Production of Butanediol From Renewable Feedstock Using Genomatica Technology BASF plans to begin production of 1,4-butanediol based on renewable feedstock (renewable BDO) using the patented process of Genomatica, San Diego, California. The one-step fermentation process is based on sugars as a renewable feedstock. Microbes that mine The Sossego mine, which Vale opened in 2004, produced 109,000 tons of copper in 2011. Its tailings pond, where samples of fungi and bacteria are collected, contains approximately 90 million tons of 0.07% copper-grade detritus. If this entire mineral content were recovered, Vale could earn gross receipts of approximately US$1.4 billion, more than the entire US$1.2 billion the company invested between 1997 and 2004 to make the mine operational. 5 5
  • 6. La Bioinformatica nelle prospettive della Bioeconomy IBM Offering will Enhance the Value of the R&D Process, Through Insight Discovery and Advanced Modeling and Simulation - Building upon existing IBM investments in HCLS, Genomic Medicine-Cross Brand Strategic Initiative Potential strategic partners CLOUD OFFERING API access to client R&D environment Insight extraction; Reuse of previous insights; High value patents Simulation & Modeling GBS lead virtual CRO (Contract Research Organization) molecular modeling systems biology Design Bio CAD Analytics machine learning synthetic routes discovery Watson Aggregation, Cleansing, Prep Data genome © 2013 IBM Corporation pathway ‘omics literature phenotype 6 6
  • 7. La Bioinformatica nelle prospettive della Bioeconomy Methodology for modeling biological (‘Omics) systems leverages techniques from circuit design Use case: efficient chemical production (such as butanol) Specification •Input (abundant chemicals) •Output (desired chemicals) •Performance • Yield • Throughput • Stabilities • Response time Find Biosynthetic Routes to meet specification from Big Data. Input: Glucose Output: Butanol © 2013 IBM Corporation Design Predictive Modeling Simulation •Models (Systems Biology) • ODE • PDE • SDE • Agent Based •Input Parameters •Molecular Bioenzyme Models Select parts/devices for the candidate biosynthetic routes using Bio CAD. Perform a predictive modeling and simulations to pick promising candidates for implementations using HPC. •Chassis • E. Coli, Yeast, Algae etc. •Devices/Bioparts • Promoters • Ribosomal Binding Sites • Genes • Terminators •Intracellular Interactions 7 7
  • 8. La Bioinformatica nelle prospettive della Bioeconomy Predictive Modeling in Depth Structure Activity Relationship Input Scoring Activity (μmol/min-mg) E. Coli Wild Type 35 13 His131Arg 43 240 Trp130His 38 108 His131Arg, Trp130His All possible pathways are generated and responsible enzymes are mapped from literature and pathway databases. Enzyme 52 780 Each specie can have a different sequence. Enzyme E1.2 E. Coli Yeast … CCAAAGCTTGGGCCTTTTCGTGA CCAAACCAATGGCCTTTTCTTGA Chemical 2 Enzyme E2.6 Enzyme E2.3 Optimize known enzymes Chemical 3 Enzyme E3.4 Chemical 6 Chemical 4 Enzyme E4.5 Chemical 5 Enzyme E5.7 No Enzyme or Pathway Known Perform de novo design using Molecular Dynamic and QM/MM hybrid methods Output © 2013 IBM Corporation 8 8
  • 9. La Bioinformatica nelle prospettive della Bioeconomy Food/Nutrition – Client Feedback Michael Brown, Director, BioSciences & Sweeteness and Taste Research, Global R&D, Coca-Cola -R&D annual spend $60-100M - Interested in getting the computational insights, as it pertain to their personalized nutrition strategy - Consumer analytics in our stack may be very good added value - Strong relationship with IBM and IBM Research Harold Schmitz, Chief Scientific Officer, Mars - Strong research and innovation pipeline in 3-5 years with profound impact, some occurring already, in plant genomics for food products, and in petcare and petfood products. - Genomics research is a critical input to overall R&D of food products, for example in the chocolate business, role of genomics is inextricably linked to sustainable production of cocoa. In 3-5 years the supply chain will increasingly be based on genomics. In 5-10 years it will mostly be genomics based. Its impact is to large part of our chocolate business, in $Billions. not give out such numbers. - Mars already spends several $10Ms, with a positive slope for next 3-5 years. - Partnerships are essential to compete with major food companies - Nestle, Unilever. Serious partnerships with academic, govt labs, and few key industrial research partners (e.g. IBM). © 2013 IBM Corporation Danone ® probiotic yogurt for digestive health and immune system (Activia ®), bone health (Densia ®) and heart health (Danacol ®). Kellogg's® Smart Start® Strong Heart Antioxidants cereal 9 9
  • 10. La Bioinformatica nelle prospettive della Bioeconomy Functional Processed Foods – A prototype use case Client problem: Processed foods often have a negative impact on human health by adversely altering the bacterial content of our intestinal tracts Solution: Engineer foods with prebiotics to promote human health by promoting a healthy gut microbiome IBM play: IT platform for modeling and simulating effects of food additives on gut microbial communities Industry Differentiation: Systems biology domain experience, computational technology leadership Processed food Food engineering (additives, prebiotics, probiotics, fibers) Simulate effect on intestinal microbial community © 2013 IBM Corporation Poor health Obesity, diabetes, cardiovascular disease, inflammatory bowel disease, cancer, allergies, osteoporosis Client side Analyze food chemistry Design product Upload chemical composition and food assay results API Testing & iterative improvements Measure substances of interests: carcinogens, cholesterol, vitamins, amino acids, SCFA* Data prep, cleansing, and aggregation Systems biology model of gut microbiology Improved health SCFA: Short Chain Fatty Acid Test effect on gut microbes Visual data analytics Design recommendations Data analytics and visualization (microbial ratios, etc.) Simulate food effect on microbial content 10 10
  • 11. La Bioinformatica nelle prospettive della Bioeconomy Energy/Biofuels •Bioethanol and more advanced biofuels such as current infrastructure compatible butanol/isobutanol are expected to grow rapidly. •Oil Majors are investing with synthetic biology companies. •36 Billion gallons in 2022 and 60 Billion gallons in 2030 (Obama: US objectives) Specification •Input: CO2 •Output Butanol •Performance • Low Cost • High Throughput • Continuous Process • Minimum Waste/Byproducts © 2013 IBM Corporation Design •Chassis: Cyanobacteria •Devices: • Promoter Selection • Optimized Codon • Optimized Amino Acids Predictive Modeling •Models (Systems Biology) to evaluate to find candidates for implementation and measurements. •Optimize enzymes through structural biology modeling. 11 11
  • 12. La Bioinformatica nelle prospettive della Bioeconomy Chemical Industry •Currently over $7B worth of chemicals are produced biosynthetically and over $100B in 2020 with CAGR 30%. •10% of chemicals will be produced in biorefineries in 2020 (World Economic Forum) and 25% will be by 2025 (US DOE target) •Not just bulk chemicals, functional chemicals (enzymes, drugs, tire rubber, polymer, fragrance, OEL, OPV) will be produced. Specification •Input: Glucose •Output : Anti-Tuberculosis drug •Performance • Low Cost • High product quality • High yield © 2013 IBM Corporation Source: P. Nieuwenhuizen and D. Lyon, J of Commercial Biotech., 2011 Design •Chassis: E. Coli •Devices: • Promoter Selection • Optimized Codon • Optimized Amino Acids Predictive Modeling •Models (Systems Biology) to evaluate to find candidates for implementation and measurements. •Optimize enzymes through structural biology modeling. 12 12
  • 13. La Bioinformatica nelle prospettive della Bioeconomy © 2013 IBM Corporation 13 13
  • 14. La Bioinformatica nelle prospettive della Bioeconomy Backup © 2013 IBM Corporation 14 14
  • 15. La Bioinformatica nelle prospettive della Bioeconomy World Economic Forum: Top 10 Emerging Technologies 2012 1. Informatics for adding value to information The quantity of information now available to individuals and organizations is unprecedented in human history, and the rate of information generation continues to grow exponentially. Yet, the sheer volume of information is in danger of creating more noise than value, and as a result limiting its effective use. Innovations in how information is organized, mined and processed hold the key to filtering out the noise and using the growing wealth of global information to address emerging challenges. 2. Synthetic biology and metabolic engineering The natural world is a testament to the vast potential inherent in the genetic code at the core of all living organisms. Rapid advances in synthetic biology and metabolic engineering are allowing biologists and engineers to tap into this potential in unprecedented ways, enabling the development of new biological processes and organisms that are designed to serve specific purposes – whether converting biomass to chemicals, fuels and materials, producing new therapeutic drugs or protecting the body against harm. 3. Green Revolution 2.0 – technologies for increased food and biomass Artificial fertilizers are one of the main achievements of modern chemistry, enabling unprecedented increases in crop production yield. Yet, the growing global demand for healthy and nutritious food is threatening to outstrip energy, water and land resources. By integrating advances across the biological and physical sciences, the new green revolution holds the promise of further increasing crop production yields, minimizing environmental impact, reducing energy and water dependence, and decreasing the carbon footprint. 4. Nanoscale design of materials The increasing demand on natural resources requires unprecedented gains in efficiency. Nanostructured materials with tailored properties, designed and engineered at the molecular scale, are already showing novel and unique features that will usher in the next clean energy revolution, reduce our dependence on depleting natural resources, and increase atomefficiency manufacturing and processing. 5. Systems biology and computational modelling/simulation of chemical and biological systems For improved healthcare and bio-based manufacturing, it is essential to understand how biology and chemistry work together. Systems biology and computational modelling and simulation are playing increasingly important roles in designing therapeutics, materials and processes that are highly efficient in achieving their design goals, while minimally impacting on human health and the environment. 6. Utilization of carbon dioxide as a resource Carbon is at the heart of all life on earth. Yet, managing carbon dioxide releases is one of the greatest social, political and economic challenges of our time. An emerging innovative approach to carbon dioxide management involves transforming it from a liability to a resource. Novel catalysts, based on nanostructured materials, can potentially transform carbon dioxide to high value hydrocarbons and other carbon-containing molecules, which could be used as new building blocks for the chemical industry as cleaner and more sustainable alternatives to petrochemicals. 7. Wireless power Society is deeply reliant on electrically powered devices. Yet, a significant limitation in their continued development and utility is the need to be attached to the electricity grid by wire – either permanently or through frequent battery recharging. Emerging approaches to wireless power transmission will free electrical devices from having to be physically plugged in, and are poised to have as significant an impact on personal electronics as Wi-Fi had on Internet use. 8. High energy density power systems Better batteries are essential if the next generation of clean energy technologies are to be realized. A number of emerging technologies are coming together to lay the foundation for advanced electrical energy storage and use, including the development of nanostructured electrodes, solid electrolysis and rapid-power delivery from novel supercapacitors based on carbon-based nanomaterials. These technologies will provide the energy density and power needed to supercharge the next generation of clean energy technologies. 9. Personalized medicine, nutrition and disease prevention As the global population exceeds 7 billion people – all hoping for a long and healthy life – conventional approaches to ensuring good health are becoming less and less tenable, spurred on by growing demands, dwindling resources and increasing costs. Advances in areas such as genomics, proteomics and metabolomics are now opening up the possibility of tailoring medicine, nutrition and disease prevention to the individual. Together with emerging technologies like synthetic biology and nanotechnology, they are laying the foundation for a revolution in healthcare and well-being that will be less resource intensive and more targeted to individual needs. 10. Enhanced education technology New approaches are needed to meet the challenge of educating a growing young population and providing the skills that are essential to the knowledge economy. This is especially the case in today’s rapidly evolving and hyperconnected globalized society. Personalized IT-based approaches to education are emerging that allow learner-centred education, critical thinking development and creativity. Rapid developments in social media, open courseware and ubiquitous access to the Internet are facilitating outside classroom and continuous education. © 2013 IBM Corporation 15 15
  • 16. La Bioinformatica nelle prospettive della Bioeconomy Computer will accelerate Biospace Revolution  Search space is enormous!  Data – Literature (unstructured) – Genomic Data • Millions of species on Earth • Each specie has 1000s of gene – Omics Data • Mass-spec data • Protein structure data (PDB etc.) • Transcriptome data • Pathway data (KEGG etc.) – Chemical Data • Almost infinite # of chemical compounds (only 10 M is known)  Insight Discovery – Biosynthetic Routes – Effects of external stimulus  Modeling/Simulation – Multiple devices to design – Order of devices matters – Each device consists of promoter, RBS, gene – Gene can be optimized – Bioenzyme modeling and optimization through structural biology and computational chemistry © 2013 IBM Corporation 16 16
  • 17. La Bioinformatica nelle prospettive della Bioeconomy Example: Biosynthetic Pathways of Isobutanol Enzyme Glucose Acetate synthase •Each enzyme can have variations between species. The sequence and structure information can be carried out to further optimization of activity. •An alternative pathway might exist to shortcut reactions. Either find such an enzyme from known species or de Novo design of enzyme is carried out. Pyruvate Acetyl-CoA KARI S-Acetolactate Novel Enzymes Acetohydroxy acid dehydratase 2,3-dihydroxy isovalerate Acetohydroxy acid dehydratase Butyryl-CoA Isobutyryl-CoA mutase Isobutyryl-CoA Acylating aldehide dehydrogenase 2-ketoisovalerate Valine dehydrogenase Branched chain keto acid dehydrogenase Branched chain keto Acid decarboxylase Valine Valine decarboxylase Isobutylamine Omega transaminase Isobutylaldehyde Branched chain alcohol dehydrogenase Isobutanol © 2013 IBM Corporation 17 17
  • 18. La Bioinformatica nelle prospettive della Bioeconomy Solution Overview: Application Healthcare •Personalized/Preventive/Preem ptive Healthcare •Early detection and better Cancer Survival •Programmed Cell Therapy •Accelerated drug discovery Agriculture and Food •Improve food production efficiency •Expand arable land •Food safety •Artificial meat Analytics •Biofuel productions and process innovations. •Clean water, soil, and air by bacteria and insects •Recovery heavy metal, precious metal and rare earth •carbon sequestration Biology Multimodal Big Data Analytics Cognitive Computing Statistical Analysis •Watson •Automatic Insight Discovery Energy and Environment Chemical, Pharmaceutical and Consumer Products •Green Chemistry •High functional products •Inexpensive manufacturing in silico Design and Predictive Modeling Systems Biology Molecular Model •QTL analysis •Similarity •Machine Learning •Pathway Analysis •Disease Modeling •In-vitro Human/Animal Model •Protein Modeling •Compound Modeling •Membrane •Nucleic Acid Modeling •Tissue Data Sequence Data •DNA/Genome •RNA •Microbiome •Immuno profile •Epigenome Technology Layer $1000 Genome © 2013 IBM Corporation Other Omics •Metabolomics •Proteomics •Gene Expression Image •Body Scan •Brain scan •Cell Image •Virus •Molecules Sense and Interact with Biological Objects Nanotechnology •Microarray •Non-invasive biosensor/MEMS •Cell Machine Interface •Micro-/Nanofluidics •DDS (Drug Delivery System) •Nanoscaffold/tissue engineering •Advanced Microscopy Sensor Data •Virus/bacteria •Toxic chemical compounds •vital Text •Literature •Web •Medical Records Imaging Technology •CT •MRI/fMRI •STED, STORM/PALM, SIM •Confocal Microscopy •Mass Spectrometr •Crystallography •Hi-C 18
  • 19. La Bioinformatica nelle prospettive della Bioeconomy Paradigm Shift in Industry (New Industry Revolution) US DOE set goal of at least 25% of renewable source for industrial products in 2025 (25x25) and 30% of biofuel in 2030 (30x30). Drivers of Biospace Revolution Synthetic Biology Before 1970 2000 Bioinformatics Oil Parity Expected circa 2020 coal coal Oil Coalchemical © 2013 IBM Corporation Oil Green Chemical Petrochemical 2030 coal Oil Green Chemical Nanotechnology 20-30% Green Chemical Petrochemical & Green Chemical 19

Editor's Notes

  1. E. coli: This ultra-high-precision microscopy imaging technique, called Photo-Activated Localization Microscopy (PALM) to map the cellular locations of three proteins central to bacterial chemotaxis (the Tar receptor, CheY, and CheW) with a precision of 15 nm. (D Greenfield et al. PLOS Biology 2009)
  2. Bioinformatics market is $3.2 billion in 2012 and is forecast to grow to nearly $7.5 billion by 2017 with 20% CAGR (BCC Research). At this pace, the market reaches at $13B in 2020.
  3. PE: Polyethylene PHA: Polyhydroxyalkanoates PLA: Polylactic acid OEL: Organic Electroluminescence OPV: Organic Photovoltaics
  4. Picture: IBM 2401 magnetic tape unit