Se ha denunciado esta presentación.
Utilizamos tu perfil de LinkedIn y tus datos de actividad para personalizar los anuncios y mostrarte publicidad más relevante. Puedes cambiar tus preferencias de publicidad en cualquier momento.

Nucleótidos y ácidos nucleicos

22.944 visualizaciones

Publicado el

Publicado en: Educación

Nucleótidos y ácidos nucleicos

  1. 1. Unidad 5 Nucleótidos y ácidos nucleicos 1. 2. 3. 4. 5. 6. 7. Nucleósidos y nucleótidos Nucleótidos de interés biológico Polinucleótidos. Ácidos nucleicos Estructura del ARN Estructura del ADN Variaciones en la estructura del ADN La cromatina I.E.S. Los Boliches Biología 2º Bachillerato
  2. 2. *Nucleósidos: son el resultado de la unión de una base nitrogenada con la ribosa o con la desoxirribosa mediante un enlace β-N-glucosídico. Este enlace se establece entre el N-9 de las púricas o el N-1 de las pirimidínicas y el C-1' de la pentosa (indicamos 1', 2', etc. en lugar de 1, 2, etc. para evitar confusión con la numeración de los átomos de la base). *Nucleótidos: son ésteres fosforilados de los nucleósidos, por lo que a veces se les denomina nucleósidos-fosfato. Podría producirse el éster con los hidroxilos 2', 3' y 5' de los ribonucleótidos o con los 3' y 5' de los desoxirribonucleótidos. Sin embargo los 2' fosfato y los 3' fosfato son escasos. La presencia de fosfato confiere carácter ácido a la molécula de los nucleótidos. Ejemplos
  3. 3. Ejemplo de ribonucleótido trifosfatado: H+ La presencia de fosfato confiere carácter ácido a la molécula de los nucleótidos H+ H+
  4. 4. Fosfatos de adenosina (adenosín fosfatos) Intervienen en las reacciones metabólicas en que se libera o consume energía, ya que los enlaces entre fosfatos de los nucleótidos acumulan energía química que puede transferirse a otras sustancias cuando dichos enlaces se hidrolizan: ATP + H2O ADP + H2O ADP + Pi + Energía AMP + Pi + Energía De igual manera, la energía desprendida en muchas reacciones químicas y procesos fisiológicos puede aprovecharse para sintetizar las formas energéticas de los adenosín-fosfatos: AMP + Pi + Energía ADP + Pi + Energía ADP + H2O ATP + H2O El ATP es denominado a menudo “la moneda energética de la célula”
  5. 5. El AMP cíclico (AMPc) Denominado “segundo mensajero” en la recepción de señales por parte de la célula. El grupo fosfato forma enlaces éster con los carbonos 5´ y 3´ de la ribosa
  6. 6. oxidado Nicotinamida NAD AMP reducido oxidado reducido
  7. 7. Coenzimas derivadas de nucleótidos Coenzima A (CoA) Derivado del ADP con ácido pantoténico (vit. B5) y b-aminoetanotiol Interviene en la activación de los ácidos orgánicos (ác. grasos…) para su metabolismo La CoA se enlaza con ácidos orgánicos mediante la formación de enlaces tio-éster: R-CO-SCoA Flavín nucleótidos (FMN, FAD) Piridín nucleótidos (NAD, NADP) Coenzima A
  8. 8. 3.- Polinucleótidos. Ácidos nucleicos Polinucleótido = polímero de nucleótidos unidos por enlaces fosfodiéster Estructura de un polirribonucleótido
  9. 9. 3.- Polinucleótidos. Ácidos nucleicos Polinucleótido = polímero de nucleótidos unidos por enlaces fosfodiéster Estructura de un polirribonucleótido
  10. 10. 3.- Polinucleótidos. Ácidos nucleicos Polinucleótido = polímero de nucleótidos unidos por enlaces fosfodiéster El grupo fosfato de un nucleótido (que estaba unido al C 5´ de la pentosa), se une también por un enlace éster al C 3´ del nucleótido siguiente. Lateralmente quedan las bases nitrogenadas Estructura de un polirribonucleótido Cadena en la que alternan las pentosas y los Pi
  11. 11. 3.- Polinucleótidos. Ácidos nucleicos P Extremo 5´ O L A R (No estamos hablando de polaridad eléctrica) I D A D Extremo 3´ 5´- 3´
  12. 12. 3.- Polinucleótidos. Ácidos nucleicos Con ribosa => POLIRRIBONUCLEOTIDOS => ARN ( = RNA ) (varios tipos) Con desoxirribosa => POLIDESOXIRRIBONUCLEÓTIDOS = ADN ( = DNA)
  13. 13. ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Cuando va a copiarse el ADN ocurre esto: 1º se abre la doble cadena: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCG TAAGCGCCGTAATTAGGC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG 2º se van añadiendo nuevas letras, de forma complementaria: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC GTACCTAG ATTCGCGGCATTAATCCG T C T A TAAGCGCCGTAATTAGGC ATACCTAGT TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG La doble cadena se terminará abriendo del todo C CA T
  14. 14. ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Cuando va a copiarse el ADN ocurre esto: 1º se abre la doble cadena: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCG TAAGCGCCGTAATTAGGC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG 2º se van añadiendo nuevas letras, de forma complementaria: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC GTACCTAG ATTCGCGGCATTAATCCG T C T A TAAGCGCCGTAATTAGGC ATACCTAGT TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG La doble cadena se terminará abriendo del todo C CA T
  15. 15. 3º Continúa el proceso de añadir “letras” hasta formarse dos doble cadenas hijas, idénticas a la original: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG En rojo se muestran las nuevas “letras” que se han ido uniendo de la manera “correcta” o complementaria (A con T y C con G). De este modo, cada una de las cadenas originales ha ser vido de MOLDE par a cr ear otr a A veces se producen errores en este proceso, dando lugar a genes alterados, distintos al original. Son las MUTACIONES.
  16. 16. Estos son algunos de los dibujos de la replicación o duplicación del ADN que pueden encontrarse en Internet:
  17. 17. Los genes del ADN son capaces de sacar copias de su información en forma de otra molécula: El ARN (ácido ribonucleico) La letra U (Uracilo) sustituye a la T en el ARN GGCGCCUAAAUUUG Las cadenas de ARN son más cortas que las de ADN y están formadas por una cadena simple (no doble como ocurría con el ADN)
  18. 18. ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG Cuando se tr anscr ibe el A DN a A RN ocur re esto: Gen que va a transcribirse A DN 1º se abre una parte de la doble cadena de ADN: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCGATACCTAGTA TACCTAG TAAGCGCCGTAATTAGGCTATGGATCAT ATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG 2º se copia la información del gen añadiendo letras, de forma complementaria, para formar ARN: ATTCGCGGCATTAATCCGATACCTAGTACCGCGGATTTAAACATGGATC ATTCGCGGCATTAATCCGATACCTAGTAGGCGCCUAAAUUUGTACCTAG TAAGCGCCGTAATTAGGCTATGGATCAT ATGGATC TAAGCGCCGTAATTAGGCTATGGATCATGGCGCCTAAATTTGTACCTAG La doble cadena de ADN NO se terminará abriendo del todo. Sólo se transcribe a ARN la información de algunos genes. Gen trascrito a ARN La letra U (Uracilo) sustituye a la T en el ARN U G A C A RN
  19. 19. Núcleo celular Finalmente, el ARN sale fuera del núcleo. Citoplasma GCG G Este ARN también se llama ARN mensajero, porque lleva un mensaje para fabricar proteínas. UUG AAU CUA C ARN Gracias a los ribosomas, en el citoplasma, la información que lleva el ARN es “leída” por los ribosomas para formar proteínas en el proceso llamado TRADUCCIÓN o SÍNTESIS DE PROTEÍNAS ribosomas
  20. 20. Ocurre en el citoplasma celular, fuera del núcleo. La información del ARN mensajero es “leída” por los ribosomas para fabricar proteínas. Cada grupo de tres bases (o “letras”) del ARN mensajero determina la unión, a la cadena proteica, de uno de los 20 aminoácidos que existen. GGCGCCUAAAUUUAUGGCACCAUGCCAUG
  21. 21. 4.- Estructura del ARN ARNm: Lineal, largo (masa molecular 105 – 106). Es la copia de un fragmento de ADN con sentido biológico (copia de un gen). Con tripletes=codones ARNr: Más corto, con regiones plegadas y con bases apareadas. Forma, junto con proteínas ribosómicas, la estructura de ribosomas. Hay unos 3 ó 4 tipos. Brazo aceptor Ribosoma (ARNr + Prot.) ARNm con tripletes (codones) ARNt: Pequeño. Estructura en “hoja de trébol” Hay unos 50 tipos de ARNt ARNt Otros ARN: P.ej. Los que forman el material genético de algunos virus.
  22. 22. 5.- Estructura del ADN Rosalind Franklin
  23. 23. 5.- Estructura del ADN -Doble hélice con enrrollamiento a la derecha y plectonémico. -Dos cadenas antiparalelas -Bases n. con anillos perpendiculares al eje (como escalones de una escalera de caracol). -Bases (=> y dos cadenas) unidas por puentes de hidrógeno entre las bases complementarias
  24. 24. 7.- La cromatina -En células eucariotas, visible únicamente en células en interfase o reposo (sin dividirse) [al producirse la mitosis y meiosis se condensa en cromosomas]. -Formado por: ADN + PROTEÍNAS -HISTONAS -NO HISTONAS La existencia de cromatina se explica porque la célula debe resolver dos problemas: -La enorme cantidad-longitud de ADN -La gran cantidad de Pi => elevada acidez y gran acumulación de cargas negativas HISTONAS: -Muy básicas debido a muchos aa Lys y Arg (lisina y arginina) -Hay varios tipos de histonas, todas de p.m. bajo
  25. 25. 7.- La cromatina -En células eucariotas, visible únicamente en células en interfase o reposo (sin dividirse) [al producirse la mitosis y meiosis se condensa en cromosomas]. -Formado por: ADN + PROTEÍNAS -HISTONAS -NO HISTONAS Con número fijo de nucleótidos (146 pares) en torno a cada octámero HISTONAS: -Muy básicas debido a muchos aa Lys y Arg (lisina y arginina) -Hay varios tipos de histonas, todas de p.m. bajo H2A H2B H3 H4
  26. 26. 7.- La cromatina -En células eucariotas, visible únicamente en células en interfase o reposo (sin dividirse) [al producirse la mitosis y meiosis se condensa en cromosomas]. -Formado por: ADN + PROTEÍNAS -HISTONAS -NO HISTONAS “Collar de perlas” “Solenoide” Nuevos plegamientos y arrollamientos consiguen un gran empaquetamiento hasta formar los cromosomas. HISTONAS: -Muy básicas debido a muchos aa Lys y Arg (lisina y arginina) -Hay varios tipos de histonas, todas de p.m. bajo Es importante comprender que este empaquetamiento debe desaparecer para que un gen se exprese. El octámero de histonas debe desmontarse, por lo que se piensa que deben tener, además de una función estructural, una función en la regulación de la expresión génica.
  27. 27. 7.- La cromatina -En células eucariotas, visible únicamente en células en interfase o reposo (sin dividirse) [al producirse la mitosis y meiosis se condensa en cromosomas]. -Formado por: ADN + PROTEÍNAS -HISTONAS -NO HISTONAS Variadas: -Algunas con función estructural, contribuyendo a fijar la forma de filamentos > 30nm y cromosomas. -Otras con actividad en replicación, transcripción y regulación de la expresión génica. -Otras son necesarias para formar estructuras del núcleo (nucléolo, matriz nuclear…).

×