Examen 2 do corte

2.010 visualizaciones

Publicado el

Este es el material orientado en clase, esta a su dispocisión para que lo revisen para el examén del segundo corte académico

Publicado en: Educación
0 comentarios
0 recomendaciones
Estadísticas
Notas
  • Sé el primero en comentar

  • Sé el primero en recomendar esto

Sin descargas
Visualizaciones
Visualizaciones totales
2.010
En SlideShare
0
De insertados
0
Número de insertados
24
Acciones
Compartido
0
Descargas
49
Comentarios
0
Recomendaciones
0
Insertados 0
No insertados

No hay notas en la diapositiva.
  • Xeroderma pigmentosa:alteracion de la pigemtacion y piel apergaminada.. Desarrollo de cancer de piel con alta frecuencia. Hasta ahora identificados 8 genes implicados en la repacion de los dimeros de pirimidinas.
  • quiescencia o dormancia son procesos reversibles. Modo de muerte celular activo en el que la célula ejecuta un programa de defunción siguiendo unos pasos característicos . Es sinónimo de : muerte celular fisiológica y muerte celular por suicidio . Existen otros procesos de muerte programada atípica distintos de la apoptosis . Sentido biologico muerte celular higienica.
  • La apoptosis disminuida puede provocar patologías de acumulación celular, mientras que su exceso se implica en otras de carácter degenerativo o de disminución celular. Las primeras incluyen a las Neoplasias , las Enfermedades autoinmunes y aquellas enfermedades infecciosas provocadas por patógenos que inhiben la apoptosis de las células que infectan. Las segundas incluyen : El daño hepático provocado por la respuesta inmune a los virus de la hepatitis. La deplección linfocitaria inducida por agentes infecciosos como el virus de la inmunodeficiencia humana y el Tripanosoma cruzi. Las enfermedades neurodegenerativas como la de Alzheimer, Parkinson, esclerosis lateral amiotrófica, retinitis pigmentosa y la atrofia muscular espinal. También se han relacionado con aumento de la apoptosis diversas enfermedades hematológicas como el síndrome mielodisplásico y la anemia aplásica , ciertas inmunodeficiencias primarias , el daño tisular secundario a isquemia , además de otras procesos degenerativos del sistema músculo-esquelético como la osteoporosis y la artrosis .
  • Biologia celular la cadena Procesos biológicos asociados a la apoptosis Cambios en la morfología celular. Estructura y función de transporte de la membrana plasmática. Función de orgánulos celulares Degradación del DNA
  • tema 25
  • tema 25 http://nobelprize.org/medicine/laureates/1958/index.html ¿Hay recombinaci ón (sexo) en bacterias? Figure: 09-03. Genetic Recombination of Two Auxotrophs Genetic recombination of two auxotrophic strains producing prototrophs. Neither auxotroph grows on minimal medium, but prototrophs do, suggesting that genetic recombination has occurred.
  • tema 25 La conjugaci ón requiere contacto entre las bacterias Figure: 09-04. Davis Experiment When strain A and B auxotrophs are grown in a common medium but separated by a filter, as in this Davis U-tube apparatus, no genetic recombination occurs and no prototrophs are produced.
  • tema 25 No es un proceso sexual convencional: dos gametos (n) formen un cigoto (2n) Conjugaci ó n: transferencia unidireccional orientada Hayes: mata un tipo celular antes de la mezcla. Si el receptor esta vivo, hay recombinantes!
  • tema 25 Conjugaci ó n: transferencia unidireccional orientada
  • tema 25
  • tema 25 a) pareja espec í fica; b) pareja efectiva
  • tema 25
  • tema 25 Unos 100 genes Transferencia (unos 22 genes): formación de los pili, origen de transferencia, corte del DNA, regulación del proceso
  • tema 25
  • tema 25
  • tema 25 Cromosoma se establece como una estructura lineal y circular!
  • Examen 2 do corte

    1. 1. SECUENCIACIÓN IT´S A LITLE BITE COMPLICATED TO SEQUENCE ME 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    2. 2. 5’ 3’ ||||||||||||||| 3’ <ul><li>T écnica de Sanger para secuenciar el DNA: </li></ul><ul><ul><li>el DNA se denatura: hebras simples </li></ul></ul><ul><ul><li>el partidor se hibrida a la hebra molde </li></ul></ul><ul><ul><li>el DNA es sintetizado usando DNA polimerasa </li></ul></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    3. 3. Las Cadenas Polinucleotídicas crecen por Adición de nucleótidos al Extremo 3´ OH FUNDAMENTO 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    4. 4. Dideoxy Sequencing Fred Sanger - 1977 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    5. 5. 5’ 3’ ||||||||||||||| ddATP DNA dNTPs ddTTP DNA dNTPs ddGTP DNA dNTPs ddCTP DNA dNTPs A T C A T G T C A T C A A G T C T A G C A C T A T A G T A T A G T A C A T A G T A C A G T A T A G T A C A G T A G T T C A T A G T A C A G T A G T T C A G A <ul><li>Todos los posibles productos </li></ul><ul><li>de la reacción </li></ul><ul><li>conteniendo ddATP </li></ul><ul><li>cada fragmento </li></ul><ul><li>termina en ddA </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    6. 6. SECUENCIACION DEL DNA METODO ENZIMATICO 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    7. 7. 5’ 3’ ||||||||||||||| A T C A T G T C A T C A A G T C T A G C A C A T G C TAGTACAGTAGTTCAGATCGTG fragmentos largos fragmentos cortos 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    8. 8. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    9. 9. graphics taken from Cold Spring Harbor Laboratory web site: darwin.cshl.org/shockan.html migración 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    10. 10. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    11. 11. González,2007 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    12. 12. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    13. 13. SORPRESA No. 1 S ó lo 2% del genoma son genes. Gen 1 Gen 2 98% del genoma 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    14. 14. Somos casi idénticos (2% de diferencia) a los chimpancés. SORPRESA No. 2 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    15. 15. Hay sólo 0,1% de variación genética entre todos los seres humanos. SORPRESA No. 3 Pero 0,1% de 3.000.000.000 bases = 3.000.000 bases 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    16. 16. La propiedad mas importante del DNA es su secuencia de nucleótidos. La secuenciación es la determinación del orden de los nucleótidos. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    17. 17. Secuenciación por el método de Maxam-Gilbert <ul><li>Esta basada en la modificación química del dna y posterior escisión de bases específicas.   </li></ul><ul><li>Ventaja: </li></ul><ul><li>       El dna que se usa directamente (no requieres ser clonado) </li></ul><ul><li>Desventajas: </li></ul><ul><li>ha quedado en desuso por su complejidad. </li></ul><ul><li>Los reactivos de este método no se pueden adaptar para usarse en un kit biológico </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    18. 18. <ul><li>El método requiere el marcaje radiactivo en el extremo 5´ y la purificación del fragmento que se requiere secuenciar. </li></ul><ul><li>De esta manera las longitudes de los fragmentos corresponden a posiciones en la secuencia donde esta esa base </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    19. 19. Métodos de terminación de la cadena (sanger) <ul><li>Es el método más usado para la secuenciación es el conocido como técnica de terminación de cadena de Sanger , la cual se ha perfeccionado conociéndose actualmente como la técnica del didesoxi . </li></ul><ul><li>Se denomina así por ser necesario los didesoxirribonucleótidos (figura 1), que han perdido su grupo alcohol OH del carbono 3'. En la figura 2 vemos un nucleótido normal con el grupo alcohol en el carbono 3'. </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    20. 20. <ul><li>Como &quot;molde&quot; se utiliza una de las cadenas del fragmento de ADN que se va a secuenciar </li></ul><ul><li>Como &quot;cebador&quot; para iniciar la síntesis, se necesita un corto oligonucleótido complementario del extremo de la cadena </li></ul><ul><li>desoxinucleótidos de las cuatro bases: dAMP, dTMP, dGMP, dCMP . </li></ul><ul><li>didesoxinucleótidos de una base en cada una de las cuatro reacciones de secuenciación. </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    21. 21. <ul><li>Al añadir la ADN-polimerasa, comienza la polimerización en el cebador, pero cesa el incorporarse un didesoxinucleótido porque la ausencia de un hidroxilo 3’ impide el agregado del próximo nucleotido. </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    22. 22. <ul><li>Deben prepararse cuatro reacciones de secueciación, cada una con un didesoxi distinto . Los fragmentos resultantes se separan por tamaño mediante electroforesis, se autorradiografían, y la sucesión de bandas de cada una de las cuatro reacciones, comparándolas entre sí,dan la secuencia del ADN </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    23. 23.                                                                                     29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    24. 24. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    25. 25. DNA SEQUENCING..VIDEOS DE BIOMOLDNA Sequencing Animation.rm ANIMATION 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    26. 26. Secuenciación por terminador fluorescente <ul><li>La secuenciación se puede llevar a cabo en una sola reacción. </li></ul><ul><li>Se marcan los cuatro didesoxinucleótidos con colorantes fluorescente. </li></ul><ul><li>Éstos terminan la cadena dando fluorescencias a diferentes longitudes de onda. </li></ul><ul><li>Los fragmentos de ADN de menor tamaño que ya han sido detectados se dejan escapar del gel permitiendo aumentar el número de nucleótidos que se pueden determinar. </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    27. 27. <ul><li>CYCLE SEQUENCING </li></ul><ul><li>3 µl de ddH2O </li></ul><ul><li>2 µl buffer 5x </li></ul><ul><li>1 µl de cada cebador </li></ul><ul><li>1 µl Big Dye </li></ul><ul><li>3 µl de ADNmt (gelasa) </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    28. 28. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    29. 29. Automatización y preparación de las muestras <ul><li>Más de 384 muestras marcadas por fluoresciencia de una sola vez y 24 ciclos de secuenciación al día. </li></ul><ul><li>Preparar por separado las reacciones de secuenciación mediante una termocicladora, lavado y resuspensión en una solución buffer antes de pasar las muestras al secuenciador. </li></ul><ul><li>Limitaciones: alturas y formas de picos desiguales en los registros del cromatograma producto de los terminadores fluorescentes. </li></ul><ul><li>Solución: introducción de nuevos sistemas enzimáticos de polimerasas de ADN y colorantes que minimizan la variabilidad de la incorporación.. </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    30. 30. Tutorial sequencing 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    31. 31. <ul><li>TUTORIAL CON SECUENCIADOR </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    32. 32. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    33. 33. TECNOLOGíA DE MICROARRAYS DE cDNAS CHIPs de DNA <ul><li>Permite analizar cientos o miles de genes diferentes </li></ul><ul><li>en un solo experimento. </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    34. 34. Tipos de arrays <ul><li>Microarrays de cDNAs: </li></ul><ul><li>DNAs (cDNA o productos de PCR 0,6-2,4 Kb) son inmovilizados en una superficie solida (nylon o vidrio). </li></ul><ul><li>Contienen cientos-miles de sondas. </li></ul><ul><li>Baja densidad de las sondas inmovilizadas. </li></ul><ul><li>La muestra a hibridar es marcada con radioactividad. </li></ul><ul><li>Microarrays de oligonucleotidos: </li></ul><ul><li>Oligonucleotidos (20-80 pb) son sintetizados sobre una matriz de vidrio o plástico. </li></ul><ul><li>Contienen 40.000-60.000 sondas. </li></ul><ul><li>Alta densidad de sondas inmovilizadas (10 7 copias/punto de siembra). </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    35. 35. Confección del array 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    36. 36. Confección de arrays MICROARRAYS Siembra 0,25-1 nL/spot generando spots de 100-150  m de diametro. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    37. 37. Confección de arrays 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    38. 38. Figure 3: Atomic force microscopy of DNA on a microarray. This is a micrograph of a portion of a hybridization probe from a yeast microarray, taken after the array was subjected to hybridization. The DNA is clearly deposited at a sufficient density to allow many kinds of strand–to–strand interactions. The width of the picture represents a scanned distance of 2 m. Image kindly provided by J. DeRisi (Stanford) and E. Carr (Hewlett–Packard). Confección de arrays 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    39. 39. Robot sembrador Siembra 7 nL/spot generando spots de 400-800  m de diametro. Confección de arrays Macroarrays 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010 Colección de genes blanco: DNA’s o Productos de PCR Membrana de nylon
    40. 40. Hibridación en microarrays Cy5 Cy3 Cy5 = 633 nm Cy3 = 532 nm Expresión de 1 > 2 2 1 Expresión de 1 = 2 Expresión de 1 < 2 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    41. 41. Microarray de levadura 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    42. 42. El nivel de expresión de cada gen es representado por la intensidad de la señal asociada a un color: Rojo (Cy5) = > expresión en la muestra experimental Verde (Cy3) = < expresión en la muestra experimental Por convención el RNA de referencia es marcado con Cy3 . 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    43. 43. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    44. 44. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    45. 45. HIBRIDACIÓN DEL DNA <ul><li>La hibridación o renaturalización de ácidos nucleicos ( ADN ó ARN ) es un proceso por el cuál se combinan dos cadenas de ácidos nucleicos antiparalelas y con secuencia de bases complementarias, en una única molécula de doble cadena, que toma la estructura de doble hélice, donde las bases nitrogenadas quedan ocultas en el interior </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    46. 46. ¿Cómo se mantienen unidas las dos hebras? <ul><li>Puentes de hidrógeno entre las bases. </li></ul><ul><li>Interacciones hidrofóbicas entre las bases adyacentes de una misma hebra. </li></ul><ul><li>Interacciones de Van der Waals </li></ul>HIBRIDACION DE ACIDOS NUCLEICOS 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    47. 47. FACTORES QUE AFECTAN LA ESTABILIDAD DE LA HIBRIDACION ENTRE ACIDOS NUCLEICOS <ul><li>Número de pares GC v/s pares AT </li></ul><ul><li>Grado de complementariedad </li></ul><ul><li>Largo de las hebras </li></ul><ul><li>Concentración de sal en la solución </li></ul><ul><li>Temperatura </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    48. 48. <ul><li>Número de pares GC v/s pares AT </li></ul><ul><ul><li>Mayor número de enlaces de H entre la hebras  mayor estabilidad de los híbridos. </li></ul></ul><ul><ul><ul><li>3 enlaces de H entre G y C </li></ul></ul></ul><ul><ul><ul><li>2 enlaces de H entre A y T </li></ul></ul></ul>FACTORES QUE AFECTAN LA ESTABILIDAD DE LA HIBRIDACION ENTRE ACIDOS NUCLEICOS 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    49. 49. <ul><li>Grado de complementariedad </li></ul><ul><ul><li>Menor complementariedad de bases, </li></ul></ul><ul><ul><li>  menos enlaces de H formados </li></ul></ul><ul><ul><li>  menor estabilidad </li></ul></ul>FACTORES QUE AFECTAN LA ESTABILIDAD DE LA HIBRIDACION ENTRE ACIDOS NUCLEICOS 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    50. 50. <ul><li>Largo de las hebras </li></ul><ul><ul><li>Mayor largo de las hebras (cDNAs) >200pb </li></ul></ul><ul><ul><li>  más enlaces de H </li></ul></ul><ul><ul><li>  mayor estabilidad del híbrido. </li></ul></ul><ul><ul><li>Menor largo de las hebras (oligos) <50pb </li></ul></ul><ul><ul><li>  Mayor especificidad </li></ul></ul><ul><ul><li>  Menor probalidad de hibridación cruzada </li></ul></ul>FACTORES QUE AFECTAN LA ESTABILIDAD DE LA HIBRIDACION ENTRE ACIDOS NUCLEICOS 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    51. 51. <ul><li>Concentración de sal en la solución </li></ul><ul><li> [sal]   estabilidad del híbrido </li></ul><ul><ul><li>Cationes monovalentes (Na + ) o divalentes (Mg ++ ) </li></ul></ul><ul><ul><li>Las cargas negativas de los grupos fosfato se repelen unas a otras. </li></ul></ul><ul><ul><li>Los iones positivos en solución reducen la repulsión electrostática entre las hebras. </li></ul></ul>FACTORES QUE AFECTAN LA ESTABILIDAD DE LA HIBRIDACION ENTRE ACIDOS NUCLEICOS 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    52. 52. <ul><li>Temperatura </li></ul><ul><ul><li>Mayor Tº  aumenta la energía cinética de las hebras y desestabiliza la estructura de los ácidos nucleicos. </li></ul></ul><ul><ul><li>  las hebras se separan. </li></ul></ul>FACTORES QUE AFECTAN LA ESTABILIDAD DE LA HIBRIDACION ENTRE ACIDOS NUCLEICOS 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    53. 53. <ul><li>pH </li></ul><ul><ul><li> [OH - ] </li></ul></ul><ul><ul><ul><li>ionización de los grupos fosfatos favoreciendo la repulsión electrostática entre las hebras. </li></ul></ul></ul><ul><li>Concentración de formamida </li></ul><ul><ul><li>Probablemente forma enlaces de H con los ácidos nucleicos. </li></ul></ul><ul><ul><li>Desestabiliza la formación de híbridos </li></ul></ul>FACTORES QUE AFECTAN LA ESTABILIDAD DE LA HIBRIDACION ENTRE ACIDOS NUCLEICOS 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    54. 54. El efecto combinado de estos factores puede ser expresado en una ecuación para el calculo de la Tm <ul><li>¿Qué es la Tm? </li></ul><ul><li>Tm = temperatura de melting o de separación de las hebras. </li></ul><ul><li>La T m es una medida de la estabilidad de los híbridos definida como la temperatura a la cual 50% de los híbridos se encuentran formados y 50% permanecen disociados. </li></ul>50% 5’ - - - - - - - - - - -3’ 3’ - - - - - - - - - - 5’ 50% 5’ - - - - - - - - - - 3’ 3’ - - - - - - - - - - -5’ 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    55. 55. El efecto combinado de estos factores puede ser expresado en una ecuación para el calculo de la Tm Tm = 81,5 ºC + 16,6log[Na] + 41(%G+C) - 0,63(%formamida) - (500/L) Tm = 79,8 ºC + 18,5log[Na] + 58,4(%G+C) + 11,8(%G+C) 2 - 0,5(%formamida) - (820/L) Para DNA:DNA Para DNA:RNA Para oligonucleotidos en 1 M Na+ Tm ( o C) = 4 (G+C) + 2 (A+T) IMPORTANTE 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    56. 56. <ul><li>Tabla 2. Cebadores usados en este trabajo para amplificar y secuenciar la región mitocondrial ND2-WANCY. </li></ul><ul><li>  </li></ul><ul><li>  </li></ul><ul><li>  </li></ul><ul><li>Cebador mitocondrial (Lab name) Secuencia nucleotidica (5´-> 3´) (Tm) </li></ul><ul><li>  </li></ul><ul><li>L4437 (METF.6)+ AAGCTTTCGGGCCCATACC 56° C </li></ul><ul><li>H5934 (COIr.1)+ AGRGTGCCAATGTCTTTGTGRTT 60° C </li></ul><ul><li>H4980 (ND2r.G1) ATTTTTCGAATTTGTGTTTGATT 66° C </li></ul><ul><li>L5002 (ND2f.U2) ATTTTTCGGGTCTGAGTTTGATT 62° C </li></ul><ul><li>H5575 (ALAr.2) CGCAAGTCTTACAGAAAC 52° C </li></ul><ul><li>ASN* CGCGTTTAGCTGTTAACTAA 56° C </li></ul><ul><li>TRPF-J AGACCAARARCCTTCAAAGC 52° C </li></ul><ul><li>C-TRP** CTGAGGGCTTTGAAGGCCC 62° C </li></ul><ul><li>T-MET** AAGCTATCGGGCCCATACCC 64° C </li></ul><ul><li>  </li></ul><ul><li>  </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    57. 57. <ul><li>Concepto en revisión continua </li></ul>ESPECIE BACTERIANA <ul><li>Actualmente el criterio es POLIFÁSICO (combinación de características fenotípicas y genómicas) </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010 <ul><li>Definición metodológica estándar : </li></ul><ul><ul><li>- % de hibridación ADN 1 -ADN 2 > 70% </li></ul></ul><ul><ul><li>- ΔTm < 5ºC (estabilidad térmica del híbrido ADN 1 -ADN 2 ) </li></ul></ul>
    58. 58. T m : punto medio del perfil de desnaturalización térmica de ADN-ADN o de ADN-ARN Aumento de absorbancia del ADN a 260nm por desnaturalizacion 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010 Longitud de onda (nm) ADN simple hebra ADN doble hebra Absorbancia 220 260 300 Abs. relativa 260 nm 80 90 100 temperatura (ºC) T m = 86ºC ADN doble hebra ADN simple hebra desnaturalización
    59. 59. Ensayo de reasociación de ADN-ADN para cepas a y b 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    60. 60. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    61. 61. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    62. 62. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    63. 63. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    64. 64. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    65. 65. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    66. 66. Experimento Meselson y Stahl DUPLICACIÓN DEL ADN 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    67. 67. Experimento Meselson y Stahl DUPLICACIÓN DEL ADN 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    68. 68. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    69. 69. Hebra molde Hebra líder Hebra retardada EL ADN es la molécula que permite perpetuar la vida: REPLICACIÓN DEL ADN 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    70. 70. Replicación <ul><li>Las ADN polimerasas requieren como sustrato la punta 3’ hidroxilo libre de una base apareada para catalizar la unión de otro nucleótido. </li></ul><ul><li>El OH libre se une al 5’  -fosfórico del deoxinucleósido 5’ trifosfato, liberándose un pirofosfato inorgánico </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    71. 71. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    72. 72. ADN polimerasas, ligasas…. <ul><li>ADN polimerasas de alta fidelidad dirigidas por ADN : dos de ellas replican los cromosomas, específica para la hebra retardada porque tiene una subunidad primasa, líder y elongación de la hebra retardada, otras dos reparan el ADN y una de ellas replica y repara el ADN mitocondrial. </li></ul><ul><li> tienen actividad 3’ - 5’ exonucleasa </li></ul><ul><li>tienen actividad de reparación del ADN de tipo escisión de nucleótidos y de bases. </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    73. 73. Proteinas principales replicación <ul><li>Topoisomerasas: rompen una hebra y la tensión del enrrollamiento de la hélice se relaja </li></ul><ul><li>Helicasas: completan el desenrrollamiento </li></ul><ul><li>ADN polimerasas : complejos agregados de diferentes proteínas. </li></ul><ul><li>Primasas: sintetizan los iniciadores de ARN que se necesitan para iniciar la replicación </li></ul><ul><li>Ligasas: sellan las lagunas dejadas por las ribonucleasas cuando remueven los primers, catalizan la unión fosfodiester entre nucleótidos adyacentes. </li></ul><ul><li>Proteinas de unión a la hebra sencilla del ADN : estabilizan la horquilla de replicación. </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    74. 74. La ADN polimerasa 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    75. 75. Síntesis del primer de ARN por una primasa 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    76. 76. En eucariontes los fragmentos de Okasaki tienen 200 nucleótidos, los primers unos 10. Los iniciadores de ARN se eliminan mediante una ARNasa específica que reconoce dobles hélices híbridas ARN-ADN La laguna es llenada por una polimerasa y la unión finalmente es realizada por una ligasa 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    77. 77. La ligasa acopla la hidrólisis de un ATP para hacer más favorable la reacción de unión entre el fosfato y el hidroxilo libre, liberando al final un AMP. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    78. 78. Efecto de las proteínas de enlace con la hebra sencilla del ADN 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    79. 79. Estructura de las proteinas de enlace a la hebra sencilla Modelo de la proteína humana 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    80. 80. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    81. 81. MECANISMO DE REPLICACIÓN DEL ADN 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    82. 82. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    83. 83. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    84. 84. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    85. 85. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    86. 86. 3’ 3’ 5’ 5’ 3’ 5’ 3’ 5’ 5’ 5’ 3’ 3’ La replicación en un ojo de replicación primer ADN 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    87. 87. A T C G A A C C G T T G C A C C G T T G C A C Síntesis continua de la cadena 5’ -3’ Síntesis continua de la cadena en dirección 5'  3'. La síntesis de esta cadena no plantea ningún problema. Así, una vez separadas ambas cadenas, se sintetiza el primer y la ADN pol. III (una de las enzimas que unen los nucleótidos) va a elongar la cadena en dirección 5'  3'. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010 U A G C T T G G C A A C G T G
    88. 88. A T C G A A C C G T T G C A C C G T T G C Síntesis discontinua de la cadena 3’ -5’ Síntesis discontinua. La cadena complementaria no se va a replicar en sentido 3'  5' sino que se replica discontinuamente en dirección 5'  3'. Primero se sintetiza el primer ( ARN) y posteriormente este se elonga con ADN. El ARN es posteriormente eliminado y los diferentes fragmentos sintetizados, llamados fragmentos de Okazaki , son unidos entre sí. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010 T A G C T U G G C A A C G T G A A C C C G G T
    89. 89. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    90. 90. Tipos de daño al ADN <ul><li>Mecanismos endógenos: </li></ul><ul><li>Pérdida de bases tipo purinas por ruptura espontánea del enlace con el azúcar 5000/día/célula humana </li></ul><ul><li>Deaminación espontánea de citosinas y adeninas produce uracilo e hipoxantina </li></ul><ul><li>Moléculas con oxígenos reactivos atacan los anillos de las bases nitrogenadas </li></ul><ul><li>La ADN polimerasa puede incorporar bases equivocadas en la replicación </li></ul><ul><li>Errores en la replicación o recombinación provocan fracturas en el ADN </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    91. 91. Agentes extracelulares <ul><li>Radiaciones ionizantes : rayos gamma y rayos X causan rupturas en la doble hélice </li></ul><ul><li>Luz UV causa la formación de los dímeros de timina </li></ul><ul><li>Químicos ambientales como agentes alquilantes y otras sust químicas forman aductos con las bases del ADN: hidrocarburos, productos naturales como las aflatoxinas. </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    92. 92. 11_21_2.jpg 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    93. 93. Mecanismos de detección y reparación de daños al ADN <ul><li>Sistemas enzimáticos para reconocer, eliminar y reparar daños inducidos al ADN se han descrito y estudiado bien en bacterias </li></ul><ul><li>El estudio de los síndromes hereditarios de predisposición al cáncer ha permitido ampliar el conocimiento en el ser humano </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    94. 94. Agentes genotóxicos y Mecanismos de reparación del DNA 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    95. 95. Sistemas de Reparaci ón del DNA 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    96. 96. PHOTOLYASE <ul><li>Esta enzima falta en todos los mamíferos, incluyendo los humanos, aunque todas las plantas y los demás animales la tienen. Una mejor comprensión de cómo opera la fotoliasa podría conducir al empleo de fármacos que ayuden a reparar el daño causado por la luz UV en el ADN humano. </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    97. 97. <ul><li>la luz visible excita la molécula de fotoliasa e incrementa la energía de sus electrones. </li></ul><ul><li>Esto hace que la enzima inyecte un electrón a la molécula de ADN, en el sitio dañado temporalmente por la luz UV, para repararlo. </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    98. 98. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010 Esto explica porqué los humanos, los ratones, y otros mamíferos son particularmente vulnerables al cáncer causado por la luz UV de los rayos solares, pero los demás miembros del reino animal, incluyendo insectos, peces, aves, anfibios, marsupiales, e incluso bacterias, virus y levaduras, poseen una capacidad mucho mayor de enmendar el daño.
    99. 99. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    100. 100. Reparaci ón de dímeros de pirimidinas mediante fotoreactivación 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    101. 101. Reparaci ón del DNA: remoción de grupos metilo 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    102. 102. Reparaci ón del DNA: bases mal apareadas 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    103. 103. Metilaci ó n del DNA Metilaci ó n del DNA 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    104. 104. Reparaci ón del DNA durante o después de su replicación 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    105. 105. Sistemas de reparaci ón de DNA: NER (Nucleotide Excision Repair) 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    106. 106. Mecanismos de reparaci ón de DNA: BER (Base excision Repair ) 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    107. 107. Enfermedades gen é ticas y sistemas de reparación del DNA Xeroderma pigmentosa <ul><li>Defecto en alguno de los sistemas de reparación de los d í meros de pirimidinas. </li></ul>Cáncer hereditario colorectal no poliposo hMSH2 hMLH1 <ul><li>Homólogos a MutS y MutL de E. coli </li></ul>Reparación de G:T 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    108. 108. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    109. 109. M uerte celular <ul><li>Proceso que por el que la actividad biológica de una célula cesa de modo irreversible. </li></ul><ul><li>Programada </li></ul><ul><li>(apoptosis) </li></ul><ul><li>Accidental </li></ul><ul><li>(necrosis u </li></ul><ul><li>oncosis) </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    110. 110. Autoinmunidad SIDA Cáncer Alzheimer Apoptosis fisiológica Defecto Exceso 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    111. 111. Apoptosis y patología <ul><li>Defecto de apoptosis </li></ul><ul><ul><li>Neoplasia </li></ul></ul><ul><ul><ul><li>linfomas </li></ul></ul></ul><ul><ul><ul><li>B-CLL </li></ul></ul></ul><ul><ul><li>Enfermedad autoinmunne </li></ul></ul><ul><ul><ul><li>LES </li></ul></ul></ul><ul><ul><ul><li>AR </li></ul></ul></ul><ul><ul><li>Infecci ó n citoprotectora y desarrollo de tumores </li></ul></ul><ul><ul><ul><li>EBV </li></ul></ul></ul><ul><li>Exceso de apoptosis </li></ul><ul><ul><li>Infección por HIV </li></ul></ul><ul><ul><li>Daños por respuesta inmune </li></ul></ul><ul><ul><ul><li>Hepatitis virales </li></ul></ul></ul><ul><ul><ul><li>Diabetes mellitus tipo 2 </li></ul></ul></ul><ul><ul><li>E. hematológica </li></ul></ul><ul><ul><ul><li>Anemia aplásica, </li></ul></ul></ul><ul><ul><ul><li>Síndrome mielodisplásicos, </li></ul></ul></ul><ul><ul><li>Inmunodeficiencia </li></ul></ul><ul><ul><ul><li>hipergammaglobulinemia M </li></ul></ul></ul><ul><ul><li>síndromes neurodegenerativos </li></ul></ul><ul><ul><ul><li>Alzheimer </li></ul></ul></ul><ul><ul><ul><li>Parkinson </li></ul></ul></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    112. 112. Diferencias entre apoptosis y necrosis. Apoptosis Necrosis (Oncosis) Programada genéticamente Accidental. Se mantiene Se rompe Disminuye aumenta Se preservan Se desintegran Fragmentación del DNA tardía fragmentos grandes . En cuerpos apoptóticos rodeados por membrana Son reconocidos y fagocitados Los contenidos de los orgánulos se liberan Inducen inflamación local. Membrana. Tamaño celular Orgánulos. Temprana fragmentos oligonucleosomales Fragmentación celular Restos celulares Mecanismo 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    113. 113. Fases de l a apoptosis 1. Decisión 2. Ejecución 4. Degradación y presentación antígenos 3. Fagocitosis Desequilibrio entre factores inductores e inhibidores bcl-2 <bax Temprana: Activación de proteasas y endonucleasas In termedia: Fragmentación DNA Tardia: Emisión de cuerpos apoptóticos Activacion de receptores Detección de fosfatidil Serina (PS) Evita liberación de componentes intracelulares inflamación TGF  29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    114. 114. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    115. 115. conjugación Lederberg y Tatum, 1946 (P. Nobel 1958) 10 8 células 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    116. 116. tubo en U pasa el medio pasan moléculas no pasan células tubo en U no nutrición cruzada no transformación (1944) 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    117. 117. pilus pelo F o pelo sexual conjugación proceso unidireccional (Hayes, 1953) donadora o macho receptora o hembra pelos o fimbrias 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    118. 118. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    119. 119. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    120. 120. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010 pareja específica pareja efectiva
    121. 121. <ul><li>Factor F (Hayes): </li></ul><ul><li>- independiente de marcadores cromosómicos (se pierde y se transfiere en mayor proporción) </li></ul><ul><li>no un gen con dos alelos (aumentan F+ en función del tiempo) </li></ul><ul><li>F es un plásmido: círculo de DNA de doble cadena con replicación independiente del cromosoma </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    122. 122. Factor F factor F o factor de fertilidad 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010 inserción en el cromosoma replicación transferencia
    123. 123. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    124. 124. a mayor tiempo entran marcadores (genes) nuevos 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    125. 125. transferencia secuencial y lineal de genes de Hfr a F- La conjugación es un proceso de transferencia de material genético unidireccional y orientada 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    126. 126. Barbara McClintock 1902-1992 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    127. 127. ELEMENTOS GENÉTICOS TRANSPONIBLE Los elementos genéticos transponibles son segmentos de DNA que tienen la capacidad de moverse desde una localización hasta otra ( ej. genes saltarines). 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    128. 128. Propiedades de los Elementos Genéticos Transponibles Movimiento al azar- Los elementos genéticos transponibles pueden moverse desde cualquier molécula de DNA a cualquier otra molécula de DNA o aún a otro lugar dentro de la misma molécula. El movimiento no es  totalmente al azar; existen sitios preferentes en una molécula de DNA en la cual se insertará el elemento genético transponible. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    129. 129. Incapaz de auto-replicarse – Los elementos genéticos transponibles no existen de manera autónoma (a excepción – algunos genes transponibles en los fagos) y por tanto, para ser replicados deben ser parte de algún otro replicón 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    130. 130. Transposición mediada por recombinación sitio-específica – La transposición requiere poca o ninguna homología entre la localización actual y el nuevo sitio. El evento de transposición está mediado por una transposasa codificada por el elemento genético transponible. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    131. 131. La recombinación que no requiere de homología entre las moléculas recombinantes se denomina de sitio-específico, ilegítima o bien recombinación no-homóloga 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    132. 132. Transposición acompañada por duplicación – En muchas instancias la transposición del elemento genético transponible resulta en la remoción del elemento de su sitio original y su inserción en un nuevo sitio. Sin embargo, en algunos casos el evento de transposición se acompaña de una duplicación del elemento genético transponible. Una copia permanece en el sitio original y la otra se transpone en el nuevo sitio. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    133. 133. Secuencias de Inserción (IS) Las secuencias de inserción son elementos genéticos transponibles que llevan genes desconocidos, con excepción de aquellos que se requieren para la transposición. Nomenclatura – A las secuencias de inserción ( insertion sequences ) se les da la designación IS seguida por un número ( ej : IS1) Las secuencias de inserción son pequeños tramos de DNA que a sus extremos tienen secuencias repetidas que están involucradas en la transposición. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    134. 134. En medio de las secuencias terminales repetidas hay genes involucrados en la transposición y secuencias que pueden controlar la expresión de los genes, pero no presentan otros genes que no sean esenciales. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    135. 135. Importancia Mutación – La introducción de una secuencia de inserción en medio de un gene bacteriano resultará en la inactivación de tal gene. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    136. 136. Inserción de plásmidos en los cromosomas – Los sitios en los cuales los plásmidos se insertan en el cromosoma bacteriano se localizan ya sea en las propias secuencias de inserción o cerca de ellas 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    137. 137. 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    138. 138. Variación de Fase – Los antígenos flagelares son de los principales  antígenos ante los cuales se dirige la respuesta inmune, en nuestro intento de luchar contra la infección bacteriana. En Salmonella existen genes que codifican para dos genes flagelares antigenicamente diferentes. La  expresión de estos genes está regulada por secuencias de inserción. En una orientación, uno de los genes está activo mientras que en la otra orientación el otro gene flagelar estará inactivo. Como resultado Salmonella puede cambiar sus flagelos en respuesta al ataque del sistema inmune. La variación de fase en los antígenos flagelares de Salmonella no es única. También se ha visto que ocurre con otros antígenos de superficie. Además el mecanismo de la variación de fase puede ser diferente en diversas especies de bacterias ( ej. transformación en Neisseria ). 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    139. 139. APLICACIONES EN MEDICINA VETERINARIA 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    140. 140. Peter J. Russell, iGenetics : Copyright © Pearson Education, Inc., publishing as Benjamin Cummings. El elemento más simple (descubierto inicialmente en el operón gal de E. coli ) 800-1350 pb Inverted terminal repeats (IRs) 9–41 pb Elementos IS de procariotas 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    141. 141. Integración del elemento IS 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    142. 142. Integración del elemento IS <ul><li>Transposición replicativa </li></ul><ul><li>Transposicion conservativa (cortar y pegar) </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    143. 143. Transposones de procariotas Transposón compuesto 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    144. 144. Transposones de procariotas Genes resistencia en plásmidos 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    145. 145. Transposones de procariotas Transposón simple 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    146. 146. <ul><li>Tipos </li></ul><ul><li>Clase I: replicación vía RNA intermediario por la retrotranscriptasa, también conocidos como retrotransposones (relacionados con retrovirus) </li></ul><ul><ul><li>LTR </li></ul></ul><ul><ul><li>Sin LTR </li></ul></ul><ul><li>Clase II: replicación vía enzima transposasa por un proceso de corte y empalme </li></ul>Elementos transponibles en eucariotas 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    147. 147. <ul><ul><ul><ul><ul><li>Clase II </li></ul></ul></ul></ul></ul>Clase II: replicación por enzima transposasa, proceso corte y empalme Elementos transponibles en eucariotas: Clase II 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    148. 148. Genoma retrovirus Elementos transponibles en eucariotas: Clase I 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    149. 149. Elementos transponibles en eucariotas: Clase I Retrotrasposón 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010 LTR LTR gag pol (retrotranscriptasa)
    150. 150. Elementos transponibles en eucariotas: Clase I Retrotrasposición 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    151. 151. Retrotrasposón Elementos transponibles en eucariotas 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    152. 152. El genoma dinámico: los elementos transponibles son el principal componente de los genomas grandes de eucariotas 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    153. 153. Elementos Efectos fenotípicos y genotípicos de la transposición Disgénesis híbrida en Drosophila 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    154. 154. <ul><li>Genes de resistencia a Antibióticos en plásmidos </li></ul><ul><li>Secuencias de inserción </li></ul><ul><li>Islas de patogenicidad </li></ul><ul><li>Genes de resistencia a toxinas en plásmidos </li></ul><ul><li>Plásmido Ti de Agrobacterium </li></ul><ul><li>Virus y Viroides </li></ul>HGT: Evolución procariótica OTROS 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    155. 155. Elementos móviles 29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    156. 156. E.coli O157:H7 Ejemplo de una nueva “casi especie” <ul><li>Contiene 20 potenciales genes en elementos móviles adquiridos mediante HGT </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    157. 157. Islas de patogenicidad (PAI) <ul><li>Elementos genéticos móviles (>10Kb) que se integran en el genoma o se mantienen en plásmidos asociados a secuencias de tRNA. </li></ul><ul><li>Presentan secuencias repetitivas flanqueantes o diferente uso de G+C y de codones </li></ul><ul><li>Contienen genes codificantes para diferentes funciones: resistencia a antibióticos, adhesinas, toxinas y otros factores de virulencia. </li></ul><ul><li>Codifican por factores relacionados con la movilidad genética: transposasas, integrasas, genes bacteriófagos y orígenes de replicación </li></ul><ul><li>Contribuyen a introducir cambios rápidos en el potencial de virulencia </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    158. 158. Formación de las PAI <ul><li>Adquisición del gen o genes de virulencia mediante algún mecanismo de HGT </li></ul><ul><li>Integración, probablement mediada por una integrasa o recombinasa </li></ul><ul><li>Inmovilización mediante la inactivación o deleción de los ori </li></ul><ul><li>Expresión de los genes (normalmente la expresión ejerce una selección positiva) </li></ul><ul><li>Escisión completa de la isla y transferencia a otro organismo </li></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    159. 159. Isla Cag de Helicobacter pylori <ul><li>Helicobacter pilory: patógeno gástrico causante de gastritis, úlcera y cáncer </li></ul><ul><li>Cag: </li></ul><ul><ul><li>Transferida mediante HGT </li></ul></ul><ul><ul><li>Diferente contenido en G+C </li></ul></ul><ul><ul><li>27 ORF </li></ul></ul><ul><ul><li>CagA  única proteína efectora </li></ul></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010
    160. 160. Isla Cag de Helicobacter pylori <ul><li>Cag PAI: Forma un sistema de secreción de tipo IV que: </li></ul><ul><ul><li>Induce la expresión de citocinas proinflamatorias como IL-8, que contribuye a la inflamación del estómago </li></ul></ul><ul><ul><li>Cag F: “chaperon like protein” </li></ul></ul><ul><ul><li>17 genes son totalmente necesarios para la translocación de CagA </li></ul></ul><ul><ul><li>14 genes estimulan la síntesis de IL-8 por parte de la célula huesped </li></ul></ul>29/04/10 Dr. Giovanni Gonzalez DMV/BIOMOL/2010

    ×