Se ha denunciado esta presentación.
Utilizamos tu perfil de LinkedIn y tus datos de actividad para personalizar los anuncios y mostrarte publicidad más relevante. Puedes cambiar tus preferencias de publicidad en cualquier momento.

Plc report

  • Sé el primero en comentar

Plc report

  1. 1. A PRESENTATION ON ROCKWELL AUTOMATION & PLC By:- ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER 1
  2. 2. WORKED IN AREA WWWOOORRRKKKEEEDDD IIINNN AAARRREEEAAA OOOOFFFF AAAAUUUUTTTTOOOOMMMMAAAATTTTIIIIOOOONNNN UUUUSSSSIIIINNNNGGGG PPPPPPPPLLLLLLLLCCCCCCCC PPPPPPPPLLLLLLLLCCCCCCCC AAAAAAAALLLLLLLLLLLLLLLLEEEEEEEENNNNNNNN BBBBBBBBRRRRRRRRAAAAAAAADDDDDDDDLLLLLLLLEEEEEEEEYYYYYYYY RRRRRRRRSSSSSSSS LLLLLLLLooooooooggggggggiiiiiiiixxxxxxxx55555555000000000000000000000000 Some companies are:- ALLEN BRADLEY MITSHUBISHI SIEMENS 2 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  3. 3. HHHHHHHHiiiiiiiissssssssttttttttoooooooorrrrrrrryyyyyyyy AAAAAAAAnnnnnnnndddddddd OOOOOOOOrrrrrrrriiiiiiiiggggggggiiiiiiiinnnnnnnn •Rockwell Automation was initially founded in 1903 by Lynde Bradley & Stanton Allen. •February 20, 1985 Rockwell Automation purchased Allen-Bradley. •Developed to replace relays in the late 1960s. ••PLC began in the 1970s, and has become the most common choice for manufacturing controls. •Costs dropped and became popular by 1980s. • Now used in many industrial designs. 3 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  4. 4. COMPONENTS CCCCCCCOOOOOOOMMMMMMMPPPPPPPOOOOOOONNNNNNNEEEEEEENNNNNNNTTTTTTTSSSSSSS OOOOOOOOFFFFFFFF AAAAAAAAUUUUUUUUTTTTTTTTOOOOOOOOMMMMMMMMAAAAAAAATTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN PPPPPPPPLLLLLLLLCCCCCCCC VVVVVVVVFFFFFFFFDDDDDDDD SSSSSSSSCCCCCCCCAAAAAAAADDDDDDDDAAAAAAAA HHHHHHHHMMMMMMMMIIIIIIII 4 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  5. 5. WHY AUTOMATION ???? REDUCES MAN POWER DECREASES ERRORS INCREASES PRODUCTIVITY 5 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  6. 6. WHY ONLY PLC ??? Cost effective. High speed. Better memory option. Greater input output controlling capability. Reliability is greater. Trouble shooting is easier. Less POWER CONSUMPTION 6 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  7. 7. Programmable Logic Controller PLC 7 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  8. 8. IIIIIIIINNNNNNNNTTTTTTTTRRRRRRRROOOOOOOODDDDDDDDUUUUUUUUCCCCCCCCTTTTTTTTIIIIIIIIOOOOOOOONNNNNNNN PPPPPPPPllllllllcccccccc iiiiiiiissssssss uuuuuuuusssssssseeeeeeeedddddddd ffffffffoooooooorrrrrrrr eeeeeeeelllllllleeeeeeeeccccccccttttttttrrrrrrrroooooooommmmmmmmeeeeeeeecccccccchhhhhhhhaaaaaaaannnnnnnniiiiiiiiccccccccaaaaaaaallllllll pppppppprrrrrrrroooooooocccccccceeeeeeeesssssssssssssssseeeeeeeessssssss SSSSSSSSuuuuuuuucccccccchhhhhhhh aaaaaaaassssssss Control of machinery on factory assembly lines. Control of sequencing, timing, arithmetic data manipulation and counting capabilities. Control of lighting fixtures. 8 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  9. 9. CCCCCCCCoooooooommmmmmmmppppppppoooooooonnnnnnnneeeeeeeennnnnnnnttttttttssssssss 1. Controller. . 2. Input system. 3. Output system. 4. Programming system. 5. Communication network. ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER 9
  10. 10. WWWWWWWWoooooooorrrrrrrrkkkkkkkkiiiiiiiinnnnnnnngggggggg Sense the input Process the logic Programmable controller Inputs Outputs Gives the output Machine or Process 10 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  11. 11. MMMMMMMMOOOOOOOODDDDDDDDEEEEEEEESSSSSSSS PPPPPPPPRRRRRRRROOOOOOOOGGGGGGGGRRRRRRRRAAAAAAAAMMMMMMMMMMMMMMMMEEEEEEEE RRRRRRRREEEEEEEEMMMMMMMMOOOOOOOOTTTTTTTTEEEEEEEE RRRRRRRRUUUUUUUUNNNNNNNN 11 PROGRAM :- Logic can be edited but cannot be executed. REMOTE: - Logic can be executed but cannot be edited. RUN:- Logic can be changed as well as executed. ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  12. 12. AAAAAAAApppppppppppppppplllllllliiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn 12 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  13. 13. EEEEEEEExxxxxxxxaaaaaaaammmmmmmmpppppppplllllllleeeeeeeessssssss Example 1:-- traffic light Operation condition:- 1. There are two lights only red and green. 2. If green is on then red will be off, and other three red will be on. 3. Every green light should be on only for 5 seconds. 13 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  14. 14. 14 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  15. 15. 15 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  16. 16. Example2 :-- Conveyor Overload Operation condition:- 1. When sensor 1 is on,counter1 counts the items passing through sensor 1 2. When sensor 2 is on,counter2 counts the items passing through sensor 2 3. If the number of items is more than 10,the alarm will blink which will indicate that the conveyer is overloaded 16 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  17. 17. Sw.1 Sw.2 Sw.3 Output 0 0 0 0 0 0 1 1 0 1 0 1 0 1 1 0 1 0 0 1 1 0 1 0 LOGIC Sw.1 +Sw.2+ Sw.3+ Sw.1Sw.2Sw.3 1 1 0 0 1 1 1 1 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER 17
  18. 18. 18 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  19. 19. • SCADA refers to “Supervisory Control and Data Acquisition”. • These are real time industrial process control systems used to centrally monitor and control remote or local industrial equipment such as motors, valves, pumps, relays, etc. • Worked on Factory Talk View SE Programming software. 19 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  20. 20. 1.Device Net 2.Control Net 33..EEtthheerr NNeett 20 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  21. 21. To learn ladder logic programming for Control Logix . To understand and implement the working of a Zinc Purification Plant using PLC-SCADA. 21 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  22. 22. Examples related to INDUSTRIES EXAMPLE 1:- FAULT DURING PROCESS OPERATION CONDITION:- 1. ALARM blinks when there is ffaauulltt iiss pprreesseenntt.. 2. If ACKNOWLDGE button is pressed, alarm only glows. 3. If RESET button is pressed and fault is cleared then alarm off. 22 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  23. 23. 23 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  24. 24. EXAMPLE 2:- Motor starts for a fixed period OPERATION CONDITION:- 1. When START button is pressed Motor 1(M) starts after 5 sec, it will remain ssttaarrtt ffoorr 2200 sseecc.. 2. Motor 2(c) starts after 25 sec, after pressing the button. 3. C remain starts for 5 minutes. 24 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  25. 25. 25 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER
  26. 26. THANK YYOOUU 26 ANIL MAURYA ELECTRICAL & ELECTRONICS ENGINEER

×