Se ha denunciado esta presentación.
Utilizamos tu perfil de LinkedIn y tus datos de actividad para personalizar los anuncios y mostrarte publicidad más relevante. Puedes cambiar tus preferencias de publicidad en cualquier momento.

SISTEMA ENDOCRINO

Fisiologia básica del sistema endocrino

SISTEMA ENDOCRINO

  1. 1. Sistema Endocrino
  2. 2. ENDOCRINOLOGIA Rama de la medicina encargada del estudio de la función normal, la anatomía y los desórdenes producidos por alteraciones de las glándulas endocrinas, que son aquellas que vierten su producto a la circulación sanguínea (denominados hormonas, en 1905).
  3. 3. HORMONA Son sustancias secretadas por células especializadas, localizadas en glándulas de secreción interna o glándulas endocrinas (carentes de conductos), o también por células epiteliales e intersticiales con el fin de afectar la función de otras células.
  4. 4. Mecanismos de Acción Hormonal <ul><li>Ciertas celulas secretoras liberan agentes químicos (hormonas) con el proposito de mediar respuestas biologicas en Celulas blanco distantes </li></ul><ul><li>Orígen químico de las Hormonas </li></ul><ul><ul><li>Aminoacidos sencillos (catecolaminas) </li></ul></ul><ul><ul><li>Cadenas de aminoacidos (hormonas péptidicas del hipotalamo) </li></ul></ul><ul><ul><li>Colesterol (Esteroides) </li></ul></ul>
  5. 5. Mecanismos de Acción Hormonal <ul><li>Hormonas controlan e integran una gran variedad de funciones corporales. </li></ul><ul><li>En general, el control hormonal regula las funciones metabolicas del cuerpo, los tipos de efectos que ocurren dentro de la celula y determinan el caracter de la celula misma. </li></ul><ul><li>El sistema endocrino trabaja en conjunto con el sistema nervioso para regular: el metabolismo, el agua y equilibrio de sales, presión sanguínea, respúesta al estres, y la reproducción sexual. </li></ul>
  6. 6. Formas de Comunicación Hormonal <ul><li>1. Endocrina = las hormonas son secretedas a la sangre para regular la función de células blanco distantes </li></ul><ul><li>2. Paracrina = células endócrinas secretan en el espacio extracelular circundante. Las células blanco son vecinas </li></ul><ul><li>3. Neuroendocrina = Directamente a la sangre (norepinefrina), y en el espacio intersticial del cerebro (Vasopresina) </li></ul>
  7. 7. TRANSCRIPCION DE GENES ESTIMULO / RESPUESTA CELULAR Objetivo
  8. 8. RESPUESTA RECEPTOR LIGANDO ESQUEMA GENERAL DE UN SISTEMA DE SEÑALIZACIÓN CELULAR Juan Carlos Munévar N
  9. 9. <ul><li>Sintesís de la molécula señal. </li></ul><ul><li>Liberación de la molécula señal </li></ul><ul><li>Transporte de la señal a la célula blanco </li></ul><ul><li>Deteccción de la señal por una proteína receptora especifica. </li></ul><ul><li>Cambio en el metabolismo celular, en la función, o desarrollo desencadenado por el complejo señal – receptor. </li></ul><ul><li>Remoción de la señal, lo cual termina usualmente la respuesta celular </li></ul>ETAPAS DE LA COMUNICACIÓN CELULAR POR SEÑALES EXTRACELULARES Juan Carlos Munévar N
  10. 10. <ul><li>BIOQUIMICO. </li></ul><ul><li>FACTOR SOLUBLE. </li></ul><ul><li>INTERACCION CELULA - CELULA </li></ul><ul><li>INTERACCION CELULA - M.E.C. </li></ul>Estímulos Juan Carlos Munévar N
  11. 11. MECANISMO DE ACCION DE LA INSULINA
  12. 12. HIDROFÍLICAS: se unen a receptores de superficie. HIDROFÓBA: tienen como ligandos Receptores intracelulares.
  13. 13. HORMONAS. <ul><li>Receptores Intracelulares. </li></ul><ul><li>Hormonas Lipofílicas. </li></ul><ul><li>Receptores Membranales. </li></ul><ul><li>Hormonas Lipofílicas / Hidrófilicas </li></ul><ul><li>Esteroides. </li></ul><ul><li>Tiroxina. </li></ul><ul><li>Acido retinóico. </li></ul><ul><li>Colecalciferol. </li></ul><ul><li>Prostaglandinas (Lipofílicas) </li></ul><ul><li>Hormonas peptidicas (Hidrófilas). </li></ul><ul><li>Moléculas cargadas (Hidrófilas). </li></ul>Juan Carlos Munévar N
  14. 14. SINTESIS, LIBERACION Y DEGRADACION DE HORMONAS.
  15. 15. MOLECULA CAPAZ DE LIGAR ESPECIFICAMENTE AL ESTIMULO EXTRACELULAR GENERANDO UNA RESPUESTA EN LA CELULA DIANA. Receptores celulares Juan Carlos Munévar N <ul><li>MEMBRANALES </li></ul><ul><li>INTRACELULARES </li></ul>
  16. 16.
  17. 17.
  18. 18. SEÑALIZACION INTERCELULAR INTRACRINA. AUTOCRINA. PARACRINA. ENDOCRINA . SINAPTICA. SEÑALIZACION INTERCELULAR INTRACRINA. AUTOCRINA. PARACRINA. COMBINATORIA SINAPTICA. Juan Carlos Munévar N
  19. 19.
  20. 20. Juan Carlos Munévar N MECANISMO . INTRACRINA. AUTOCRINA . PARACRINA . SINAPTICA. SEÑAL. Factores de crecimiento Neurotransmisor HORMONA. Quemoquinas . ENDOCRINA. Neurotransmisor
  21. 21. <ul><li>Acoplados a </li></ul><ul><li>Proteínas G. </li></ul><ul><li>Canales Iónicos </li></ul>Membranales <ul><li>Tirosin - quinasa </li></ul><ul><li>Actividad Enzimática </li></ul><ul><li>Intrínseca. </li></ul>Juan Carlos Munévar N Receptores celulares Intracelulares . <ul><li>Hormonas </li></ul><ul><li>Lipofílicas. </li></ul>
  22. 22.
  23. 23. LAS PROTEINAS G
  24. 24. Función en la transducción de señales de proteínas conservadas
  25. 25. Función en la transducción de señales de proteínas conservadas
  26. 26. Función en la transducción de señales de proteínas conservadas
  27. 27. MOLECULAS DE SEÑALIZACION INTRACELULAR Nucleótidos cíclicos o productos de hidrólisis lipídica sintetizados por ciclasas o fosfolipasas asociadas a la membrana. Juan Carlos Munévar N Segundos mensajeros
  28. 28. SEGUNDOS MENSAJEROS. Juan Carlos Munévar N 3’5’ cGMP 1,2 DAG 3’ 5’ cAMP IP 3 Ca 2 Fosfolípidos de inositol
  29. 29. Juan Carlos Munévar N FOSFOLIPÍDOS DE INOSITOL. 4 Formas enzimáticas  ,  ,  ,  Fosfolipasa C Fosfatidilinositol 4,5 bisfosfato. 1,2 DAG IP 3
  30. 30. FOSFOLIPASA D. Fosfatidilcolina 1,2 DAG Fosfolipasa D <ul><li>Rc (Proteínas G) </li></ul><ul><li> Ca 2  citosólico </li></ul><ul><li>Agonistas de PKC </li></ul><ul><li>Proteínas G. </li></ul>Fosfolipasa D Juan Carlos Munévar N
  31. 31. ADENILATO CICLASA. Juan Carlos Munévar N Complejo Ligando / Rc Proteína G s Adenil ciclasa ATP c AMP
  32. 32. Juan Carlos Munévar N ADENILATO CICLASA. Complejo Ligando / Rc Proteína G s Adenil ciclasa c AMP Proteína Quinasa A PDE AMP
  33. 33. PROTEINAS CINASAS. <ul><li>Proteínas Blanco: </li></ul><ul><li>Factores de Transcripción. </li></ul><ul><li>Enzimas. </li></ul><ul><li>Proteínas de Transporte </li></ul>1. Proteínas Tirosina quinasas. 2. Proteínas Ser / Tre quinasas. 1. Conformación. 2. Función. <ul><li>Proteína Quinasa A </li></ul><ul><li>Proteína Quinasa C </li></ul><ul><li>Proteínas Quinasas Ca 2 / </li></ul><ul><li>Calmodulina. </li></ul>Juan Carlos Munévar N
  34. 34. PROTEINAS FOSFATASAS. <ul><li>Fosfatasas Ser / Tre: </li></ul><ul><li>Fosfatasa 1 </li></ul><ul><li>Fosfatasa 2B </li></ul><ul><li>Fosfatasa 2A </li></ul><ul><li>Fosfatasa 2C </li></ul><ul><li>Sustratos : </li></ul><ul><li>P.K C </li></ul><ul><li>PK A (reguladora ) </li></ul><ul><li>P.K C </li></ul><ul><li>Inhibidor 1. </li></ul>Desfosforilan residuos Ser / Tre o Tir de Quinasas activas Juan Carlos Munévar N
  35. 35. <ul><li>Proceso de señalización: </li></ul><ul><li>Síntesis y liberación del Estímulo </li></ul><ul><li>Reconocimiento del Estímulo por el Receptor. </li></ul><ul><li>Difusión de la señal a través del plasmalema. </li></ul><ul><li>Transmisión y amplificación de la señal (2dos mensajeros) </li></ul><ul><li>Llegada de la señal al organelo diana (Respuesta celular) </li></ul><ul><li>Inactivación o degradación de la señal (Cese de la respuesta) </li></ul>Juan Carlos Munévar N Conclusiones
  36. 36. Juan Carlos Munévar N Papel de la transducción de señales en la regulación de la expresión de genes
  37. 37.
  38. 38.
  39. 39. Factor de Transcripción activado por: Citocinas Factores de crecimiento Esteres de forbol Lipopolisacáridos TNF Ácido Okadaico
  40. 40. Factor de Transcripción con dominios que reconocen motivos específicos de ADN. NFkB se transloque al núcleo Motivo  B en el ADN Secuencias promotoras / enhancers La disociación del complejo p50 / p65 / IkB : NF- B k I  B Inactivado por PKC / PKA Fosforilación / Desfosforilación 5’-GGGPuNNPiPiCC-3’
  41. 41. Genes con motivo  B <ul><li>IL-6 </li></ul><ul><li>GM-CSF </li></ul><ul><li>Interferón  </li></ul><ul><li>Regula: </li></ul><ul><li>Expresión de citocinas </li></ul><ul><li>Proliferación celular </li></ul><ul><li>Diferenciación celular </li></ul><ul><li>Respuesta inflamatoria </li></ul><ul><li>Respuesta inmune </li></ul>Linfocitos T y B Actividad antiviral / antiproliferativa Activación de neutrófilos, macrófagos Sensible a estímulos que señalan un proceso infeccioso NF- B k
  42. 42. La transcripción de genes activados por el AMPc está regulada por FACTORES DE TRANSCRIPCION que se unen al elemento de respuesta CRE en el ADN. CRE: AMPc response element. Juan Carlos Munévar N CREB Expresión génica
  43. 43. GENES CON MOTIVO C.R.E. 1. Enzimas metabolismo intermedio 2. Péptidos Bioactivos. 3. Fibronectina plasmática. 4. Proto oncogen c-fos 1. Tiroxina hidroxilasa 2. Somatostatina Juan Carlos Munévar N
  44. 44. MOTIVO C.R.E. Motivos octaméricos Secuencia CONSENSUS: 5’-TGACGTCA - 3’ Elementos de respuesta al AMPc del ADN CREB : CRE BINDING PROTEINS . Factores de transcripción de genes que poseen el motivo C.R.E. Localización: 1. Núcleo celular. 2. Fosforilados por PKA Juan Carlos Munévar N
  45. 45. MECANISMO DE ACCION. 1. La P.K. A fosforila las proteínas CREB. 2. Factores de Transcripción se une a C.R.E. 3. TRANSCRIPCION DE GEN ESPECIFICO > [cAMP]° inducen la translocación de la subunidad catalítica P.K. A Juan Carlos Munévar N
  46. 46. EXPRESION DE GENES. Los factores de transcripción C.R.E.B pueden ser fosforilados por: 1. P.K.A (Células mesenquimatosas.) 2. Quinasas I y II Ca2/Calmodulina (Neuronas.) Transcripción de genes distintos. Juan Carlos Munévar N
  47. 47. Juan Carlos Munévar N FACTOR MOTIVO INFORMACION C-Myc / Max CACGTG C-Myc: oncogen retroviral, se asocia con Max. c-Fos / c-Jun TGAC/GTC/AA Oncogenes retrovirales Factor AP-1 CREB TGACGC/7C/AG/A Une a CRE, familia de al menos 10 factores, dímeros con c-Jun C-ErbA; (TR: Receptor de la hormona Tiroidea) G/CA/CGGAA/TGT/C Oncogen retroviral, miembro de la superfamilia de receptores hormonales esteroides/tiroides C-Ets G/CA/CGGAA/TGT7C Oncogen retroviral predominante en células B y T GATA T/AGATA Familia de factores específicos de líneas eritroides C-Myb T/CAACG/TG Oncogen retroviral, factor especifico de células hematopoyéticas NFkB & c-Rel GGGAA/CTNT/CCC c-Rel: Oncogen retroviral, predominan en células B y T RAR ACGTCATGACCT Une elementos RARES, así como sitios c-Jun / c-Fos SRF (Serum response factor) GGATGTTCCATATTAGGACATCT Presente en genes inducibles por factores de crecimiento presentes en suero ISGF3 (Interferon  stimulated gene factor 3) A/GGAAAA/GNGAAACT Activación por proteínas quinasa. El motivo ISRE presente en genes de respuesta antiviral y antitumoral
  48. 48. Sistema Endocrino <ul><li>Las Hormonas y Glándulas del sistema endócrino con funciones puramente endócrinas incluyen: </li></ul><ul><li>La pituitaria (hipofisis) </li></ul><ul><li>La pineal </li></ul><ul><li>La tiroides </li></ul><ul><li>La paratiroides </li></ul><ul><li>Las adrenales </li></ul><ul><li>El páncreas </li></ul>
  49. 49. Hipotalamo y Pituitaria <ul><li>La Pituitaria tiene conexiones directas neurales y sanguíneas con el hipotálamo </li></ul><ul><li>El Hipotálamo envia factores liberadores a la pituitaria anterior </li></ul><ul><li>El hipotálamo estimula a la pituitaria posterior por via neural </li></ul>
  50. 50. Hipotálamo <ul><li>El Hipotálamo puede fabricar y liberar hormonas de sus axones terminales hacia la circulación. </li></ul><ul><li>controla la función pituitaria en forma importante e indirectamente influencía a otras glándulas del sistema endócrino. </li></ul><ul><li>ejerce control directo sobre la pituitaria anterior y posterior. </li></ul><ul><li>Controla la actividad de la pituitaria por dos vías: una vía neural y una via venosa portal. </li></ul>
  51. 51. Hipotálamo <ul><li>La via Neural se extiende del hipotálamo al lóbulo piituitario posterior, en donde se almacenan y se secretan las hormonas. </li></ul><ul><li>Las vías venosas Portales que conectan el hipotálamo con el lóbulo anterior de la pituitaria, llevando hormonas liberadoras e inhibidoras </li></ul>
  52. 52. La Glándula Pituitaria <ul><li>La glándula Pituitaria localizada en la base del craneo en la silla turca del hueso esfenoides. </li></ul><ul><li>Unida con el hipotalamo por el tallo pituitario (tracto neurohipofisiario) y consiste de la pituitaria anterior y la´pituitaria posterior </li></ul>
  53. 53. Glándula Pituitaria Anterior (adenohipofisis) <ul><li>Llamada la glándula maestra , porque su lóbulo anterior tiene control directo sobre la secreción de: </li></ul><ul><li>ADH – Hormona antidiurética (vasopresina) </li></ul><ul><li>ACTH – hormona adrenocorticotrofica </li></ul><ul><li>TTH – Hormona tirotrofica </li></ul><ul><li>GH – Hormona del crecimiento </li></ul><ul><li>FSH – Hormona foliculo estimulante </li></ul><ul><li>LH – Hormona luteinizante </li></ul>
  54. 54. Pituitaria Posterior <ul><li>Almacena y secreta hormonas fabricadas en el hipotálamo y contiene muchas fibras nerviosas. </li></ul><ul><li>La ADH (Hormona Antidiuretica/Vasopresina), que controla la velocidad de excreción de agua hacia la orina </li></ul><ul><li>Regula la reabsorción de Na + y K + en los riñones influenciando el volúmen y la presión sanguínea </li></ul><ul><li>La Oxitocina, que entre otras funciones ayuda en la secreción de la leche. </li></ul>
  55. 55. Glándulas Adrenales <ul><li>Las Glándulas Adrenergicas tienen una corteza externa y una porción interna medular. </li></ul><ul><li>La corteza adrenal y la medula son factores importantes en la respuesta al estres. </li></ul>
  56. 56. Glándulas Adrenales <ul><li>ACTH – Hormona Adrenocorticotrofica que estimula a la corteza adrenal liberando 3 tipos de hormonas: Glucocorticoides, Mineralo corticoides, Steroides </li></ul><ul><li>La corteza es responsable de secretar los mineralocorticoides (Hormonas esteroides que regulan el equilibrio líquido y de minerales) </li></ul><ul><li>Los glucocorticoides (hormonas esteroides responsables de controlar el metabolismo de glucosa) </li></ul><ul><li>Los andrógenos (hormonas sexuales). </li></ul>
  57. 57. Glándulas Adrenales <ul><li>La médula adrenal se deriva de tejido neural y secreta Epinefrina y Norepinefrina </li></ul><ul><li>La Epinefrina circula y actúa sobre el sistema nervioso simpático </li></ul><ul><li>La Norepinefrina Liberada de las terminales nerviosas simpáticas y de la médula adrenal en pequeñas cantidades </li></ul>
  58. 58. Mineralocorticoides Adrenales <ul><li>ADH - Hormona Antidiuerética </li></ul><ul><li>Regula reabsorción de Na+ y K+ en los riñones </li></ul><ul><li>Regula la retención del agua </li></ul><ul><li>Es también activada via renina - angiotensina </li></ul>
  59. 59. Esteroides Adrenales <ul><li>Testosterona – afecta la masculinización, aumenta la masa corporal. </li></ul><ul><li>Estrogenos - estradiol, estrona, estriol - estimulan desarollo mamario y el patrón de deposito de grasa en la mujer </li></ul>
  60. 60. Hormonas Renales <ul><li>La Renina es una hormona / enzima (liberada por las células yuxtaglomerulares) que inician las reacciones sanguíneas que generan a la angiotensina II para regular la presión sanguínea. </li></ul><ul><li>La Eritropoyetina estimula la formación de glóbulos rojos. </li></ul><ul><li>Activa Vitamin D (estimulada por PTH) para homeostasis del Ca + (absorción) y la densidad ósea </li></ul>
  61. 61. La Glándula Tiroides <ul><li>La función tiroidea es regulada por el hipotálamo y pituitaria mediante retroalimentación </li></ul><ul><li>Las Hormonas producidas son: </li></ul><ul><li>La tiroxina (T4) y triyodotironina (T3), regulan la tasa metabólica del cuerpo y aumentan la síntesis de proteínas </li></ul><ul><li>La calcitonina, ejerce un efecto fisiológico débil sobre le equilibrio del calcio y fosforo. </li></ul><ul><li>TTH – La Hormona Tirotrofica Estimula a la tiroides </li></ul>
  62. 62. Glándulas Paratiroides <ul><li>Las glándulas paratiroides localizadas detras de la tiroides. </li></ul><ul><li>Las Paratiroides son importantes en metabolismo del calcio y del fosforo </li></ul><ul><li>La hormona Paratiroidea es muy importante en la liberación del Ca2 + de los huesos y en su retención por los riñones cuando los niveles plasmáticos son bajos </li></ul>
  63. 63.
  64. 64. Pancreas <ul><li>Una glándula endocrina, que secreta las hormonas insulina y glucagón. Como glándula exocrina, produce enzimas digestivas. </li></ul><ul><li>Secreta insulina, glucagón (regula el azúcar sanguíneo) </li></ul><ul><li>La Somatostatina influencia la absorción de los nutrientes por el tracto Gastro intestinal (GI). </li></ul>
  65. 65. Mecanismos celulares de la acción Hormonal <ul><li>La interacció hormonal con las células blanco inicia con una unión reversible con receptores específicos </li></ul>1. Interaccion con el receptor de membrana (proteina) 2. Interacción con receptores nucleares (esteroides)
  66. 66. Hormonas aminoácidas <ul><li>Se conjugan con sitios receptores en membranas </li></ul><ul><li>La conjugación produce cambios que activan moléculas portadoras que las transportan por la membrana </li></ul><ul><li>El receptor puede activatar mensajeros secundarios </li></ul>
  67. 67. Mensajeros secundarios <ul><li>Los mensajeros secundarios inician una serie de reacciones </li></ul><ul><li>Activa la adenilato ciclaza, genera cAMP a partir del ATP </li></ul><ul><li>El cAMP activa otras proteinas dentro de la célula aumenta la glicogenolisis y la lipolisis </li></ul><ul><li>Abre canales iónicos de Ca2 + , activa a calmodulina </li></ul><ul><li>Hydroliza la fosfolipasa C en inositol trifosfate y diacilglicerol </li></ul>
  68. 68.
  69. 69. Hormonas Esteroides <ul><li>Las hormonas esteroides son </li></ul><ul><li>producidas por modificación </li></ul><ul><li>química del colesterol </li></ul><ul><li>Principales hormonas esteroides: </li></ul><ul><li>glucocorticoides (cortisol) </li></ul><ul><li>mineralocorticoides (aldosterona) </li></ul><ul><li>andrógenos (testosterona) </li></ul><ul><li>estrógenos (estradiol) </li></ul><ul><li>Vitamina D metabolitos </li></ul>
  70. 70. Hormonas Esteroides <ul><li>Difunden a la célula e influencian al DNA </li></ul><ul><li>Se conjugan con una proteina asociada al DNA </li></ul><ul><li>Causan que DNA aumente síntesis de aminoacidos específicos </li></ul>
  71. 71. Retroalimentación <ul><li>La liberación de una hormona es usual que suceda por cambios en la concentración de una substancia en los líquidos corporales. </li></ul><ul><li>Cada hormona ejerce un efecto correctivo, eliminando el estimulo, para luego disminuir la secreción de la hormona. </li></ul><ul><li>Este efecto es llamado sistema de control homeostático por retroalimentación negativa para mantener las hormonas en niveles fisiológicos. (si los niveles aumentaran se llamaría retroalimentación positiva) </li></ul>
  72. 72.
  73. 73. Control del azúcar en la sangre <ul><li>La Insulina y glucagon son producidas por grupos celulares en el páncreas (isletas de Langerhans). </li></ul><ul><li>Las células Beta fabrican insulina y las células Alfa fabrican glucagon </li></ul><ul><li>La Insulina es liberada cuando el azúcar en sangre es muy alta. La Insulina ordena a las celulas a usar azúcar. </li></ul><ul><li>El Glucagón es producido cuando el azúcar en la sangre es muy bajo. El Glucagón ordena al hígado a liberar azucar almacenado en su parenquima. </li></ul>
  74. 74.
  75. 75. Insulina <ul><li>La Insulina promueve la entrada de glucosa a las células </li></ul><ul><li>La Insulina afecta enzimas que controla la tasa metabólica de CARBOHYDRATOS, GRASAS, PROTEINAS, y TRANSPORTE DE IONES </li></ul><ul><li>Metabolismo de Carbohidratos </li></ul><ul><ul><li>Estimula utilización de glucosa, su almacenamiento e INHIBE formación de glucosa </li></ul></ul><ul><ul><li>La Insulina actua en HIGADO dependiendo de los niveles de GLUCOSA </li></ul></ul>
  76. 76. Glucagon <ul><li>Secretado en respuesta a: niveles bajos de glucosa en sangre; aumento de nivel de aminoácidos; o estimulation por hormona de crecimiento </li></ul><ul><li>Su función primaria es aumentar los niveles circulantes de glucosa en sangre: convertir glucosa alamacenada (en hígado) en glucosa circulante. </li></ul><ul><li>Promueve formación de glucosa (de grasas y proteinas cuando se necesita mas glucosa que la que puede proveer el hígado) </li></ul>
  77. 77. GH – Hormona del Crecimiento acciones <ul><li>Libera somatomedinas del hígado </li></ul><ul><li>Absorción de aminoacidos por los tejidos </li></ul><ul><li>Síntesis de proteínas nuevas </li></ul><ul><li>-crecimiento de los huesos largos </li></ul><ul><li>Obstruye el efecto de la insulina sobre la absorción de glucosa </li></ul><ul><li>Induce gluconeogenesis </li></ul>

×