SlideShare una empresa de Scribd logo
1 de 17
Descargar para leer sin conexión
TiReX: Tiled Regular eXpressions
matching architecture
Virtual NGC - Taverne d’Arbia (SI)
July 19, 2020
Filippo Carloni, Davide Conficconi, Alessandro Comodi, Alberto Scolari, Marco Santambrogio
{filippo.carloni, alessandro.comodi} @mail.polimi.it,
{davide.conficconi, alberto.scolari, marco.santambrogio} @polimi.it
2
Context Definition
3
Context Definition
Search Engine
Web PagesUsers
4
Context Definition
Search Engine
Web Pages
Packets Analysis
Accepted
Packets
Rejected
Packets
Entering
PacketsUsers
5
Context Definition
Search Engine
Web Pages
Packets Analysis
Accepted
Packets
Rejected
Packets
Entering
Packets
Genetic Market Research
Patient DNA Personalized MedicineDNA Analysis
Users
6
Context Definition
Regular Expressions
(ACGT|AC)*TT
7
Current Issues
Flexibility
Performance
8
Current Issues
Flexibility
Performance
Possible Solution
9
Related Works
NFA Directly implemented
Fixed architecture relative to one RE
Very fast
Too Space for the NFA for large RE
One character at time for base
implementation
10
Proposed Solution
Customized Instruction Set Architecture (ISA)
Custom processor written in VHDL and implemented on a FPGA
Multi-core architecture
11
Flow of RE
Regular
Expression
Compiler
1 & ACGT
2 JIM offset
3 (
4 |)* AC
5 & TT
ACGTCGGGGCGTGCAAATGCCCCGTGCGATTTGCGTGACGTCGGGGCGTGCAAATGCCCC
GTGCGATTTGCGTGACGTCGGGGCGTGCAAATGCCCCGTGCGATTTGCGTGACGTCGGGG
CGTGCAAATGCCCCGTGCGATTTGCGTGCGTGCGATTTGCGTGACGTCGGGGCGTGCAAA
CGTGCGATTTGCGTGACGTCGGGGCGTGCAAAGCTCGATCGATCGATCGA.
Data
Instruction
Set
Match results
12
The Compiler
Regular Expression Compiler
1 & ACGT
2 JIM
offset
3 (
4 |)* AC
5 & TT
Instruction Set
(ACGT|AC)*TT
1. Lexical Analyzer
2. Code Transformation
3. Code Optimization
13
Single Core
Architecture
14
Board Test 1 Test 2 Test 3
Flex
Intel i7, 2.80 GHz
Exec. Time [µs] 271 121 263
Speedup 1X 1X 1X
Grep (Xeon)
Exec. Time [µs] 205 108.11 336.73
Speedup 1.32X 1.11X 0.78X
PYNQ-Z1
8-core, 70.5 MHz
Exec. Time [µs] 7.2 8.21 30.3
Speedup 37.63X 14.73X 8.67X
VC707
16-core, 130.1 MHz
Exec. Time [µs] 2.07 4.54 3.36
Speedup 130.9X 26.65X 78.27X
VU9P (AWS)
16-core, 202.7 MHz
Exec.Time [µs] 1.03 0.75 2.96
Speedup 263.11X 161.33X 88.85X
Performance Analysis
Latency Dataset
Baseline
15
Summary
Fast
Flexible (Customized ISA)
Cross-Platform Design
Strength Points
Multi-core possibility
16
Summary
Fast
Flexible (Customized ISA)
Cross-Platform Design
Strength Points
Multi-core possibility
Cover more types of regular
expression
Fix corner case bugs
Work in progress ...
Nondeterministic version
17
Thank you
Questions?
Contacts
Filippo Carloni, Davide Conficconi, Alessandro Comodi, Alberto Scolari, Marco Santambrogio
{filippo.carloni, alessandro.comodi} @mail.polimi.it,
{davide.conficconi, alberto.scolari, marco.santambrogio} @polimi.it

Más contenido relacionado

Similar a TiReX: Tiled Regular eXpressionsmatching architecture

tezos_hands-on-training.pdf
tezos_hands-on-training.pdftezos_hands-on-training.pdf
tezos_hands-on-training.pdfNeven6
 
Encode x Tezos Hack: Hands-on dApp Training
Encode x Tezos Hack: Hands-on dApp Training Encode x Tezos Hack: Hands-on dApp Training
Encode x Tezos Hack: Hands-on dApp Training KlaraOrban
 
Michael_Kogan_portfolio
Michael_Kogan_portfolioMichael_Kogan_portfolio
Michael_Kogan_portfolioMichael Kogan
 
Michael_Kogan_portfolio
Michael_Kogan_portfolioMichael_Kogan_portfolio
Michael_Kogan_portfolioMichael Kogan
 
DReAMS: High Performance Reconfigurable Computing at NECSTLab
DReAMS: High Performance Reconfigurable Computing at NECSTLabDReAMS: High Performance Reconfigurable Computing at NECSTLab
DReAMS: High Performance Reconfigurable Computing at NECSTLabNECST Lab @ Politecnico di Milano
 
Saving Human Lives with the IoT
Saving Human Lives with the IoTSaving Human Lives with the IoT
Saving Human Lives with the IoTDat Tran
 
Modeling self-adaptative IoT architectures
Modeling self-adaptative IoT architecturesModeling self-adaptative IoT architectures
Modeling self-adaptative IoT architecturesIván Alfonso
 
Database Research at TU Berlin DIMA and DFKI IAM - USA Excursion Slides 2019
Database Research at TU Berlin DIMA and DFKI IAM - USA Excursion Slides 2019Database Research at TU Berlin DIMA and DFKI IAM - USA Excursion Slides 2019
Database Research at TU Berlin DIMA and DFKI IAM - USA Excursion Slides 2019Jonas Traub
 
Horizontal Requirement Engineering in Integration of Multiple IoT Use Cases o...
Horizontal Requirement Engineering in Integration of Multiple IoT Use Cases o...Horizontal Requirement Engineering in Integration of Multiple IoT Use Cases o...
Horizontal Requirement Engineering in Integration of Multiple IoT Use Cases o...Toshihiko Yamakami
 
OpenShift Kubernetes Native Infrastructure for 5GC and Telco Edge Cloud
OpenShift  Kubernetes Native Infrastructure for 5GC and Telco Edge Cloud OpenShift  Kubernetes Native Infrastructure for 5GC and Telco Edge Cloud
OpenShift Kubernetes Native Infrastructure for 5GC and Telco Edge Cloud Hidetsugu Sugiyama
 
Transforming deep into transformers – a computer vision approach
Transforming deep into transformers – a computer vision approachTransforming deep into transformers – a computer vision approach
Transforming deep into transformers – a computer vision approachFerdin Joe John Joseph PhD
 
DRACO - Domain specific Reconfigurable Architecture Computer Organization
DRACO - Domain specific Reconfigurable Architecture Computer OrganizationDRACO - Domain specific Reconfigurable Architecture Computer Organization
DRACO - Domain specific Reconfigurable Architecture Computer OrganizationNECST Lab @ Politecnico di Milano
 
40 Powers of 10 - Simulating the Universe with the DiRAC HPC Facility
40 Powers of 10 - Simulating the Universe with the DiRAC HPC Facility40 Powers of 10 - Simulating the Universe with the DiRAC HPC Facility
40 Powers of 10 - Simulating the Universe with the DiRAC HPC Facilityinside-BigData.com
 
Container Networking Meetup March 31 2016
Container Networking Meetup March 31 2016Container Networking Meetup March 31 2016
Container Networking Meetup March 31 2016Andrew Randall
 
Introduction of IPv6NET in Tridentcom 2014
Introduction of IPv6NET in Tridentcom 2014Introduction of IPv6NET in Tridentcom 2014
Introduction of IPv6NET in Tridentcom 2014Marius Georgescu
 
Data Plane Evolution: Towards Openness and Flexibility
Data Plane Evolution: Towards Openness and FlexibilityData Plane Evolution: Towards Openness and Flexibility
Data Plane Evolution: Towards Openness and FlexibilityAPNIC
 

Similar a TiReX: Tiled Regular eXpressionsmatching architecture (20)

tezos_hands-on-training.pdf
tezos_hands-on-training.pdftezos_hands-on-training.pdf
tezos_hands-on-training.pdf
 
Encode x Tezos Hack: Hands-on dApp Training
Encode x Tezos Hack: Hands-on dApp Training Encode x Tezos Hack: Hands-on dApp Training
Encode x Tezos Hack: Hands-on dApp Training
 
Michael_Kogan_portfolio
Michael_Kogan_portfolioMichael_Kogan_portfolio
Michael_Kogan_portfolio
 
Michael_Kogan_portfolio
Michael_Kogan_portfolioMichael_Kogan_portfolio
Michael_Kogan_portfolio
 
Richard - 6G Symposium.pdf
Richard - 6G Symposium.pdfRichard - 6G Symposium.pdf
Richard - 6G Symposium.pdf
 
DReAMS: High Performance Reconfigurable Computing at NECSTLab
DReAMS: High Performance Reconfigurable Computing at NECSTLabDReAMS: High Performance Reconfigurable Computing at NECSTLab
DReAMS: High Performance Reconfigurable Computing at NECSTLab
 
High Performance Reconfigurable Computing at NECSTLab
High Performance Reconfigurable Computing at NECSTLabHigh Performance Reconfigurable Computing at NECSTLab
High Performance Reconfigurable Computing at NECSTLab
 
Saving Human Lives with the IoT
Saving Human Lives with the IoTSaving Human Lives with the IoT
Saving Human Lives with the IoT
 
Modeling self-adaptative IoT architectures
Modeling self-adaptative IoT architecturesModeling self-adaptative IoT architectures
Modeling self-adaptative IoT architectures
 
Database Research at TU Berlin DIMA and DFKI IAM - USA Excursion Slides 2019
Database Research at TU Berlin DIMA and DFKI IAM - USA Excursion Slides 2019Database Research at TU Berlin DIMA and DFKI IAM - USA Excursion Slides 2019
Database Research at TU Berlin DIMA and DFKI IAM - USA Excursion Slides 2019
 
Horizontal Requirement Engineering in Integration of Multiple IoT Use Cases o...
Horizontal Requirement Engineering in Integration of Multiple IoT Use Cases o...Horizontal Requirement Engineering in Integration of Multiple IoT Use Cases o...
Horizontal Requirement Engineering in Integration of Multiple IoT Use Cases o...
 
OpenShift Kubernetes Native Infrastructure for 5GC and Telco Edge Cloud
OpenShift  Kubernetes Native Infrastructure for 5GC and Telco Edge Cloud OpenShift  Kubernetes Native Infrastructure for 5GC and Telco Edge Cloud
OpenShift Kubernetes Native Infrastructure for 5GC and Telco Edge Cloud
 
Transforming deep into transformers – a computer vision approach
Transforming deep into transformers – a computer vision approachTransforming deep into transformers – a computer vision approach
Transforming deep into transformers – a computer vision approach
 
DRACO - Domain specific Reconfigurable Architecture Computer Organization
DRACO - Domain specific Reconfigurable Architecture Computer OrganizationDRACO - Domain specific Reconfigurable Architecture Computer Organization
DRACO - Domain specific Reconfigurable Architecture Computer Organization
 
40 Powers of 10 - Simulating the Universe with the DiRAC HPC Facility
40 Powers of 10 - Simulating the Universe with the DiRAC HPC Facility40 Powers of 10 - Simulating the Universe with the DiRAC HPC Facility
40 Powers of 10 - Simulating the Universe with the DiRAC HPC Facility
 
Container Networking Meetup March 31 2016
Container Networking Meetup March 31 2016Container Networking Meetup March 31 2016
Container Networking Meetup March 31 2016
 
An Architecture for Implementing Private Local Automation Clouds Built by CPS
An Architecture for Implementing Private Local Automation Clouds Built by CPSAn Architecture for Implementing Private Local Automation Clouds Built by CPS
An Architecture for Implementing Private Local Automation Clouds Built by CPS
 
Introduction of IPv6NET in Tridentcom 2014
Introduction of IPv6NET in Tridentcom 2014Introduction of IPv6NET in Tridentcom 2014
Introduction of IPv6NET in Tridentcom 2014
 
Shantanu's Resume
Shantanu's ResumeShantanu's Resume
Shantanu's Resume
 
Data Plane Evolution: Towards Openness and Flexibility
Data Plane Evolution: Towards Openness and FlexibilityData Plane Evolution: Towards Openness and Flexibility
Data Plane Evolution: Towards Openness and Flexibility
 

Más de NECST Lab @ Politecnico di Milano

Embedding based knowledge graph link prediction for drug repurposing
Embedding based knowledge graph link prediction for drug repurposingEmbedding based knowledge graph link prediction for drug repurposing
Embedding based knowledge graph link prediction for drug repurposingNECST Lab @ Politecnico di Milano
 
PLASTER - PYNQ-based abandoned object detection using a map-reduce approach o...
PLASTER - PYNQ-based abandoned object detection using a map-reduce approach o...PLASTER - PYNQ-based abandoned object detection using a map-reduce approach o...
PLASTER - PYNQ-based abandoned object detection using a map-reduce approach o...NECST Lab @ Politecnico di Milano
 
EMPhASIS - An EMbedded Public Attention Stress Identification System
 EMPhASIS - An EMbedded Public Attention Stress Identification System EMPhASIS - An EMbedded Public Attention Stress Identification System
EMPhASIS - An EMbedded Public Attention Stress Identification SystemNECST Lab @ Politecnico di Milano
 
Maeve - Fast genome analysis leveraging exact string matching
Maeve - Fast genome analysis leveraging exact string matchingMaeve - Fast genome analysis leveraging exact string matching
Maeve - Fast genome analysis leveraging exact string matchingNECST Lab @ Politecnico di Milano
 

Más de NECST Lab @ Politecnico di Milano (20)

Mesticheria Team - WiiReflex
Mesticheria Team - WiiReflexMesticheria Team - WiiReflex
Mesticheria Team - WiiReflex
 
Punto e virgola Team - Stressometro
Punto e virgola Team - StressometroPunto e virgola Team - Stressometro
Punto e virgola Team - Stressometro
 
BitIt Team - Stay.straight
BitIt Team - Stay.straight BitIt Team - Stay.straight
BitIt Team - Stay.straight
 
BabYodini Team - Talking Gloves
BabYodini Team - Talking GlovesBabYodini Team - Talking Gloves
BabYodini Team - Talking Gloves
 
printf("Nome Squadra"); Team - NeoTon
printf("Nome Squadra"); Team - NeoTonprintf("Nome Squadra"); Team - NeoTon
printf("Nome Squadra"); Team - NeoTon
 
BlackBoard Team - Motion Tracking Platform
BlackBoard Team - Motion Tracking PlatformBlackBoard Team - Motion Tracking Platform
BlackBoard Team - Motion Tracking Platform
 
#include<brain.h> Team - HomeBeatHome
#include<brain.h> Team - HomeBeatHome#include<brain.h> Team - HomeBeatHome
#include<brain.h> Team - HomeBeatHome
 
Flipflops Team - Wave U
Flipflops Team - Wave UFlipflops Team - Wave U
Flipflops Team - Wave U
 
Bug(atta) Team - Little Brother
Bug(atta) Team - Little BrotherBug(atta) Team - Little Brother
Bug(atta) Team - Little Brother
 
#NECSTCamp: come partecipare
#NECSTCamp: come partecipare#NECSTCamp: come partecipare
#NECSTCamp: come partecipare
 
NECSTCamp101@2020.10.1
NECSTCamp101@2020.10.1NECSTCamp101@2020.10.1
NECSTCamp101@2020.10.1
 
NECSTLab101 2020.2021
NECSTLab101 2020.2021NECSTLab101 2020.2021
NECSTLab101 2020.2021
 
TreeHouse, nourish your community
TreeHouse, nourish your communityTreeHouse, nourish your community
TreeHouse, nourish your community
 
Embedding based knowledge graph link prediction for drug repurposing
Embedding based knowledge graph link prediction for drug repurposingEmbedding based knowledge graph link prediction for drug repurposing
Embedding based knowledge graph link prediction for drug repurposing
 
PLASTER - PYNQ-based abandoned object detection using a map-reduce approach o...
PLASTER - PYNQ-based abandoned object detection using a map-reduce approach o...PLASTER - PYNQ-based abandoned object detection using a map-reduce approach o...
PLASTER - PYNQ-based abandoned object detection using a map-reduce approach o...
 
EMPhASIS - An EMbedded Public Attention Stress Identification System
 EMPhASIS - An EMbedded Public Attention Stress Identification System EMPhASIS - An EMbedded Public Attention Stress Identification System
EMPhASIS - An EMbedded Public Attention Stress Identification System
 
Luns - Automatic lungs segmentation through neural network
Luns - Automatic lungs segmentation through neural networkLuns - Automatic lungs segmentation through neural network
Luns - Automatic lungs segmentation through neural network
 
BlastFunction: How to combine Serverless and FPGAs
BlastFunction: How to combine Serverless and FPGAsBlastFunction: How to combine Serverless and FPGAs
BlastFunction: How to combine Serverless and FPGAs
 
Maeve - Fast genome analysis leveraging exact string matching
Maeve - Fast genome analysis leveraging exact string matchingMaeve - Fast genome analysis leveraging exact string matching
Maeve - Fast genome analysis leveraging exact string matching
 
EMoCy - Emotions Monitoring via wearable Computing System
EMoCy - Emotions Monitoring via wearable Computing SystemEMoCy - Emotions Monitoring via wearable Computing System
EMoCy - Emotions Monitoring via wearable Computing System
 

Último

Energy Awareness training ppt for manufacturing process.pptx
Energy Awareness training ppt for manufacturing process.pptxEnergy Awareness training ppt for manufacturing process.pptx
Energy Awareness training ppt for manufacturing process.pptxsiddharthjain2303
 
Input Output Management in Operating System
Input Output Management in Operating SystemInput Output Management in Operating System
Input Output Management in Operating SystemRashmi Bhat
 
Internet of things -Arshdeep Bahga .pptx
Internet of things -Arshdeep Bahga .pptxInternet of things -Arshdeep Bahga .pptx
Internet of things -Arshdeep Bahga .pptxVelmuruganTECE
 
home automation using Arduino by Aditya Prasad
home automation using Arduino by Aditya Prasadhome automation using Arduino by Aditya Prasad
home automation using Arduino by Aditya Prasadaditya806802
 
Why does (not) Kafka need fsync: Eliminating tail latency spikes caused by fsync
Why does (not) Kafka need fsync: Eliminating tail latency spikes caused by fsyncWhy does (not) Kafka need fsync: Eliminating tail latency spikes caused by fsync
Why does (not) Kafka need fsync: Eliminating tail latency spikes caused by fsyncssuser2ae721
 
Industrial Safety Unit-I SAFETY TERMINOLOGIES
Industrial Safety Unit-I SAFETY TERMINOLOGIESIndustrial Safety Unit-I SAFETY TERMINOLOGIES
Industrial Safety Unit-I SAFETY TERMINOLOGIESNarmatha D
 
Vishratwadi & Ghorpadi Bridge Tender documents
Vishratwadi & Ghorpadi Bridge Tender documentsVishratwadi & Ghorpadi Bridge Tender documents
Vishratwadi & Ghorpadi Bridge Tender documentsSachinPawar510423
 
Introduction to Machine Learning Unit-3 for II MECH
Introduction to Machine Learning Unit-3 for II MECHIntroduction to Machine Learning Unit-3 for II MECH
Introduction to Machine Learning Unit-3 for II MECHC Sai Kiran
 
Past, Present and Future of Generative AI
Past, Present and Future of Generative AIPast, Present and Future of Generative AI
Past, Present and Future of Generative AIabhishek36461
 
National Level Hackathon Participation Certificate.pdf
National Level Hackathon Participation Certificate.pdfNational Level Hackathon Participation Certificate.pdf
National Level Hackathon Participation Certificate.pdfRajuKanojiya4
 
An experimental study in using natural admixture as an alternative for chemic...
An experimental study in using natural admixture as an alternative for chemic...An experimental study in using natural admixture as an alternative for chemic...
An experimental study in using natural admixture as an alternative for chemic...Chandu841456
 
Industrial Safety Unit-IV workplace health and safety.ppt
Industrial Safety Unit-IV workplace health and safety.pptIndustrial Safety Unit-IV workplace health and safety.ppt
Industrial Safety Unit-IV workplace health and safety.pptNarmatha D
 
Introduction-To-Agricultural-Surveillance-Rover.pptx
Introduction-To-Agricultural-Surveillance-Rover.pptxIntroduction-To-Agricultural-Surveillance-Rover.pptx
Introduction-To-Agricultural-Surveillance-Rover.pptxk795866
 
Mine Environment II Lab_MI10448MI__________.pptx
Mine Environment II Lab_MI10448MI__________.pptxMine Environment II Lab_MI10448MI__________.pptx
Mine Environment II Lab_MI10448MI__________.pptxRomil Mishra
 
Virtual memory management in Operating System
Virtual memory management in Operating SystemVirtual memory management in Operating System
Virtual memory management in Operating SystemRashmi Bhat
 
Concrete Mix Design - IS 10262-2019 - .pptx
Concrete Mix Design - IS 10262-2019 - .pptxConcrete Mix Design - IS 10262-2019 - .pptx
Concrete Mix Design - IS 10262-2019 - .pptxKartikeyaDwivedi3
 
The SRE Report 2024 - Great Findings for the teams
The SRE Report 2024 - Great Findings for the teamsThe SRE Report 2024 - Great Findings for the teams
The SRE Report 2024 - Great Findings for the teamsDILIPKUMARMONDAL6
 
Research Methodology for Engineering pdf
Research Methodology for Engineering pdfResearch Methodology for Engineering pdf
Research Methodology for Engineering pdfCaalaaAbdulkerim
 
Arduino_CSE ece ppt for working and principal of arduino.ppt
Arduino_CSE ece ppt for working and principal of arduino.pptArduino_CSE ece ppt for working and principal of arduino.ppt
Arduino_CSE ece ppt for working and principal of arduino.pptSAURABHKUMAR892774
 

Último (20)

Energy Awareness training ppt for manufacturing process.pptx
Energy Awareness training ppt for manufacturing process.pptxEnergy Awareness training ppt for manufacturing process.pptx
Energy Awareness training ppt for manufacturing process.pptx
 
Input Output Management in Operating System
Input Output Management in Operating SystemInput Output Management in Operating System
Input Output Management in Operating System
 
Internet of things -Arshdeep Bahga .pptx
Internet of things -Arshdeep Bahga .pptxInternet of things -Arshdeep Bahga .pptx
Internet of things -Arshdeep Bahga .pptx
 
home automation using Arduino by Aditya Prasad
home automation using Arduino by Aditya Prasadhome automation using Arduino by Aditya Prasad
home automation using Arduino by Aditya Prasad
 
Why does (not) Kafka need fsync: Eliminating tail latency spikes caused by fsync
Why does (not) Kafka need fsync: Eliminating tail latency spikes caused by fsyncWhy does (not) Kafka need fsync: Eliminating tail latency spikes caused by fsync
Why does (not) Kafka need fsync: Eliminating tail latency spikes caused by fsync
 
Industrial Safety Unit-I SAFETY TERMINOLOGIES
Industrial Safety Unit-I SAFETY TERMINOLOGIESIndustrial Safety Unit-I SAFETY TERMINOLOGIES
Industrial Safety Unit-I SAFETY TERMINOLOGIES
 
Vishratwadi & Ghorpadi Bridge Tender documents
Vishratwadi & Ghorpadi Bridge Tender documentsVishratwadi & Ghorpadi Bridge Tender documents
Vishratwadi & Ghorpadi Bridge Tender documents
 
Introduction to Machine Learning Unit-3 for II MECH
Introduction to Machine Learning Unit-3 for II MECHIntroduction to Machine Learning Unit-3 for II MECH
Introduction to Machine Learning Unit-3 for II MECH
 
Past, Present and Future of Generative AI
Past, Present and Future of Generative AIPast, Present and Future of Generative AI
Past, Present and Future of Generative AI
 
National Level Hackathon Participation Certificate.pdf
National Level Hackathon Participation Certificate.pdfNational Level Hackathon Participation Certificate.pdf
National Level Hackathon Participation Certificate.pdf
 
An experimental study in using natural admixture as an alternative for chemic...
An experimental study in using natural admixture as an alternative for chemic...An experimental study in using natural admixture as an alternative for chemic...
An experimental study in using natural admixture as an alternative for chemic...
 
Industrial Safety Unit-IV workplace health and safety.ppt
Industrial Safety Unit-IV workplace health and safety.pptIndustrial Safety Unit-IV workplace health and safety.ppt
Industrial Safety Unit-IV workplace health and safety.ppt
 
POWER SYSTEMS-1 Complete notes examples
POWER SYSTEMS-1 Complete notes  examplesPOWER SYSTEMS-1 Complete notes  examples
POWER SYSTEMS-1 Complete notes examples
 
Introduction-To-Agricultural-Surveillance-Rover.pptx
Introduction-To-Agricultural-Surveillance-Rover.pptxIntroduction-To-Agricultural-Surveillance-Rover.pptx
Introduction-To-Agricultural-Surveillance-Rover.pptx
 
Mine Environment II Lab_MI10448MI__________.pptx
Mine Environment II Lab_MI10448MI__________.pptxMine Environment II Lab_MI10448MI__________.pptx
Mine Environment II Lab_MI10448MI__________.pptx
 
Virtual memory management in Operating System
Virtual memory management in Operating SystemVirtual memory management in Operating System
Virtual memory management in Operating System
 
Concrete Mix Design - IS 10262-2019 - .pptx
Concrete Mix Design - IS 10262-2019 - .pptxConcrete Mix Design - IS 10262-2019 - .pptx
Concrete Mix Design - IS 10262-2019 - .pptx
 
The SRE Report 2024 - Great Findings for the teams
The SRE Report 2024 - Great Findings for the teamsThe SRE Report 2024 - Great Findings for the teams
The SRE Report 2024 - Great Findings for the teams
 
Research Methodology for Engineering pdf
Research Methodology for Engineering pdfResearch Methodology for Engineering pdf
Research Methodology for Engineering pdf
 
Arduino_CSE ece ppt for working and principal of arduino.ppt
Arduino_CSE ece ppt for working and principal of arduino.pptArduino_CSE ece ppt for working and principal of arduino.ppt
Arduino_CSE ece ppt for working and principal of arduino.ppt
 

TiReX: Tiled Regular eXpressionsmatching architecture