2. Marqueurs Virologiques Stratégie diagnostique & suivi virologique Marqueurs indirects Anticorps anti-VHC totaux Marqueurs directs Ag de capside (AgC) ARN VHC Génotype VHC Profil de résistance
3.
4. Antigène de Capside : un Marqueur de la Réplication Bouvier-Alias et al., Hepatology 2002, 36(1): 211-218. Stratégie diagnostique & suivi virologique r = 0.92; p < 0.0001
5.
6. Trousse Architect : Monitoring des Cinétiques Virales RVR (G1b) SVR (G1b) Relapser (G1b) NR (G1a) Ross et al., J Clin Microbiol 2010, 48(4): 1161-8. Stratégie diagnostique & suivi virologique Core Ag RNA
7.
8. Tests Virologiques Moléculaires Stratégie diagnostique & suivi virologique Tests quantitatifs Seuil de détection ≥ qualitatifs Quelle quantité est présente ? Tests qualitatifs Très sensibles ( 50 IU/mL) Est-ce que le VHC est présent ? Détermination du Génotype Quel est le génotype du virus ? Détection de la résistance Quel type de VHC est présent ?
9. Tests Virologiques Moléculaires Stratégie diagnostique & suivi virologique Est-ce que le VHC est présent et en quelle quantité ? Tests Qualitatifs-Quantitatifs Détermination du Génotype Quel est le génotype du virus ? Détection de la résistance Quel type de VHC est présent ?
16. 80 90 100 110 120 130 140 150 160 170 180 |.........|.........|.........|.........|.........|.........|.........|.........|.........|.........| F_7157 (4a): TAGCCATGGCGTTAGTATGAGTGTTGT G CAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGT A CACCGGAATCGCCGG Patient 1 (4h): ...........................A.....................................A...................T............... Patient 2 (4l): ...........................A.....................................A...................T............... 190 200 210 220 230 240 250 260 270 .........|.........|...... - ...|.........| .........|.........|.........|.........| .........|........ F_7157 (4a): GATGACCGGGTCCTTTCTTGGA T T A A - CCCGCTCAATGCCCGGAAATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCC Patient 1 (4h): ......................A.T.A.......................................................................... Patient 2 (4l): .......................C..-.......................................................C.......T.......... 280 290 300 310 320 330 340 |.........|.........|.........|.........|.........|.........|. F_7157 (4a): TTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCACC Patient 1 (4h): ............................................................. Patient 2 (4l): ............................................................. Chevaliez et al., 2008; Hepatology, 49(4): 1397-1398. Stratégie diagnostique & suivi virologique Absence de Détection de l’ARN Viral de patients Fortement Virémiques Infectés par un Génotype 4 (Log 10 IU/mL) CAP/CTM96 m 2000 SP / m 2000 RT Versant 3.0 Patient 1 (4h) <1.08 5.4 5.0 Patient 2 (4l) <1.08 6.0 5.7
17. Quantification de Transcrits d’ARN Sauvages ou Mutés en Position 145 et/ou 165 Chevaliez et al., Hepatology, 2009, 50(5): 1681. *Target not detected Stratégie diagnostique & suivi virologique 5.95±0.25 5.88±0.20 6.00±0.11 6.05±0.10 m 2000 6.60±0.18 <1.08* Double mutant (G145 A and A165 T ) 6.30±0.02 4.28±0.35 Single mutant (G145 and A165 T ) 6.69±0.02 4.02±0.13 Single mutant (G145 A and A165) 6.43±0.01 5.73±0.13 Wild-type (G145 and A165) Versant 3.0 CTM bDNA assay Real-time PCR assays Measured HCV RNA levels (Log 10 IU/mL) HCV 5’NC sequence
18. Stratégie diagnostique & suivi virologique Quantification ARN du VHC ( m 2000, Abbott) Chevaliez et al., J Clin Microbiol, 2009 ,47(6):1726-32 . r = 0.972; p < 0.0001 HCV RNA level in m 2000 SP / m 2000 RT (Log 10 IU/mL) HCV RNA level in Versant HCV 3.0 Assay bDNA (Log 10 IU/mL) 8 7 6 5 4 3 8 7 6 5 4 3 Genotype 1 (n=55) Genotype 2 (n=21) Genotype 3 (n=29) Genotype 4 (n=24) Genotype 5 (n=9) Genotype 6 (n=3)
19. Stratégie diagnostique & suivi virologique Quantification ARN du VHC (kPCR, Siemens) David Sherman., Molecular Symposium, September 2007 (source: Siemens Medical Solutions Diagnostics). 132 clinical samples
20.
21. Génotypes du VHC Simmonds et al. Hepatology 2005. Stratégie diagnostique & suivi virologique
22. Répartition des Génotypes Stratégie diagnostique & suivi virologique Adapted from Fang J., et al. J. Clin Liver Dis., 1997. 1a,
27. Profils de Résistance du BMS-70052, in vitro Fridell et al. Antimicrob Agents Chemother. 2010; 54(9): 3641-50 Stratégie diagnostique & suivi virologique Substitution amino acidique EC50 fold-change Niveau de Replication (%) Génotype 1b L31 F /V 5-23 146±44 P32L 17 18±6 Y93H/N 19-28 20 ±7 Génotype 1a M28T 683 31±23 Q30E/H/R 1 450-24 933 130±56 L31 M /V 350-3 350 117±29 P32L 233 18±5 Y93 C /H/N 1 850-47 017 18±11
28. Profils de Résistance du Telaprevir (PROVE-2 trial), in vivo Génotype 1b Génotype 1a Chevaliez et al. International HIV&HEPATITIS VIRUS Drug Resistance Workshop and Curative Strategies 2010 . Stratégie diagnostique & suivi virologique Pt-1 Pt-2 Pt-3 Pt-4 Pt-5 Pt-6 R26K V36L/M V36A V36A T42S A40T A40T T54S T54S T54A Y56F T91A R155K R155K R155K /E R155T/A G174S
29. Détermination du Sous-Type par une Méthode de Référence* *HCV genotype determination by means of phylogenetic analysis of a portion of the gene encoding the NS5B region was used as the reference method Chevaliez et al., PLoS One 2009, 4(12): e820. Stratégie diagnostique & suivi virologique
30. Détermination du Sous-Type Chevaliez et al., PLoS One 2009, 4(12): e820. 1 st Generation of Line Probe Assay (LiPA 1.0) 2 nd Generation of Line Probe Assay (LiPA 2.0) RealTi m e HCV Genotype II Sequence Analysis of the 5’NCR GT 1a (n=237) GT 1b (n=263) 77.6% (n=184) 90.5% (n=238) 70.5% (n=167) 91.3% (n=240) 97.5% (n=231) 96.2% (n=253) 93.2% (n=220) 88.6% (n=233) Stratégie diagnostique & suivi virologique
31.
32. rs12979860 En amont du géne de l’IL28B, codant l’IFN- 3 Ge et al., Nature 2009; 461: 399-401. IL28B “Single Nucleotide Polymorphism” (SNP) Stratégie diagnostique & suivi virologique
33. Réponse virologique soutenue (%) Thompson et al., Gastroenterology 2010; 139(1): 120-129. RVS à la Bithérapie Standard en Fonction du Génotype IL28B Stratégie diagnostique & suivi virologique Caucasians (n=1171) African-Americans (n=300) Hispanics (n=116) Combined (n=1587) 51% 37% 12 49% 14 37% 48% 29% 22%
34.
35.
36.
37.
38. Dose de Ribavirine Stratégie diagnostique & suivi virologique Ribavirine 0,8 g/j Ribavirin 1,0 – 1,2 g/j Hadziyannis et al., Ann Intern Med 2004;140: 346-355. Proportion de patients avec RVS (%)
39. Durée de Traitement Stratégie diagnostique & suivi virologique Hadziyannis et al., Ann Intern Med 2004;140: 346-355. 24 semaines 48 semaines Proportion de patients avec RVS (%)
40.
41. Réponses au Traitement en Fonction des Cinétiques Virales 0 4 8 12 Semaines Detection cut-off (10-15 IU/mL) -6 -5 -4 -3 -2 -1 0 +1 HCV RNA reduction from baseline (Log 10 IU/mL) SOC Stratégie diagnostique & suivi virologique Diminution ≥ 2 Log
42. Réponse Virologique Précoce : Facteur Prédictif de la RVS EoT RVS Rechute Adapted from Ferenci et al., J Hepatol 2005, 43: 425-433. Diminution >2 Log ou ARN indétectable à S12 Diminution <2 Log à S12 Stratégie diagnostique & suivi virologique
43. Réponses au Traitement en Fonction des Cinétiques Virales 0 4 8 12 Semaines RVR Slow VR RVP SOC 2 Detection cut-off (10-15 IU/mL) -6 -5 -4 -3 -2 -1 0 +1 HCV RNA reduction from baseline (Log 10 IU/mL) Diminution ≥ 2 Log Stratégie diagnostique & suivi virologique
44. Taux de RVS SVR 43/45 38/42 37/44 64/72 33/41 62/83 227/300 234/292 250/355 68/156 77/157 72/203 542/1019 500/1016 667/1035 406/1019 386/1016 423/1035 Semaines avec un ARN du VHC indétectable Week to first undetectable HCV RNA ViraferonPeg 1.5µg/kg/w + RBV 1000-1400 mg/d ViraferonPeg 1.0µg/kg/w + RBV 1000-1400 mg/d PegIFN alpha-2a 180µg/w + RBV 1000-1200 mg/d McHutchinson et al., New Engl J Med 2009, 361(6): 580-593. Stratégie diagnostique & suivi virologique
45. Longer Treatment Duration Genotype 1, Slow virological responders >2 Log drop at week 12, but detectable HCV RNA Berg et al., Gastroenterology 2006, 130: 1086-97. 48 weeks 72 weeks HCV RNA <50 IU/mL HCV RNA >50 IU/mL 34/51 27/35 104/130 90/119 78/179 94/190 17/100 31/106 p =0.040 121/230 121/225 Rate of SVR (%) Stratégie diagnostique & suivi virologique
46. Genotype 1 and 4, Slow virological responders >2 Log drop at week 12, but detectable HCV RNA Ferenci et al., Gastroenterology 2010, 138: 503-512. HCV RNA <50 IU/mL Rate of relapse (%) HCV RNA >50 IU/mL p <0.01 p <0.05 48 weeks 72 weeks 20/35 9/29 16/72 11/81 Longer Treatment Duration Stratégie diagnostique & suivi virologique
47.
48. Shorter Treatment Duration Genotype 2 and 3, Rapid virological responders (<50 IU/mL at week 4) Rate of SVR (%) 16 weeks 24 weeks p <0.001 p <0.001 375/458 368/405 197/243 115/212 181/215 174/193 Diago et al., Hepatology. 2010; 51(6): 1897-903. Stratégie diagnostique & suivi virologique
49. Shorter Treatment Duration Genotype 2 and 3, Rapid virological responders with a low baseline viral load (<400,000 IU/mL) Rate of SVR (%) 16 weeks 24 weeks p =0.20 111/122 95/100 Diago et al., Hepatology. 2010; 51(6): 1897-903. Stratégie diagnostique & suivi virologique
50. HCV genotype HCV-1 (4,5,6) RNA quantification HCV-2,3 SOC 24 weeks Ribavirin (800 mg.d -1 ) SOC 48 weeks Ribavirin (1000-1400 mg.d -1 ) Decrease < 2 Log Decrease 2 Log HCV RNA detectable Stop antiviral treatment Continue Rx until W24 If HCV RNA undetetectable Continue Rx Until W72 Decrease 2 Log HCV RNA undetectable Continue Rx until W48 RNA quantification at W4 HCV RNA undetectable HCV RNA detectable Continue Rx until W24 Consider 16 weeks of therapy 2 1 In patients with a low viral load at baseline (<400,000 IU/mL); 2 In patients with a low viral load at baseline (400,000-600,000 IU/mL) RNA quantification at W4 RNA quantification at W12 HCV RNA undetectable HCV RNA detectable Consider 24 weeks of therapy 1
51.
52. Weeks on therapy T12PR N = 363 T8PR N = 364 PR48 N = 350 36 0 24 12 TVR +PR Follow-up 48 TVR+PR PR PR Follow-up 60 72 8 PR Follow-up no eRVR PR Follow-up PR Follow-up no eRVR *eRVR = undetectable HCV RNA at week 4 and week 12 ADVANCE Trial Telaprevir, Naïve, Genotype 1 Jacobson et al., AASLD 2010, Abstract 211. Stratégie diagnostique & suivi virologique
53. p <0.0001 Proportion of Patients with SVR (%) p <0.0001 SVR Rates Jacobson et al., AASLD 2010, Abstract 211. Stratégie diagnostique & suivi virologique
54. SPRINT-2 Trial Boceprevir, Naïve, Genotype 1 Weeks on therapy 36 0 24 12 48 60 72 *VR = HCV RNA undetectable between weeks 8 and 24 BOC + PR Follow-up PR LI Follow-up 4 Follow-up PR Follow-up no VR BOC+ PR LI VR 28 BOC/RGT N = 368 BOC/PR48 N = 366 PR48 N = 363 Poordad et al., AASLD 2010, Abstract LB-4. Stratégie diagnostique & suivi virologique
55. Poordad et al., AASLD 2010, Abstract LB-4. Taux de RVS How to use molecular techniques to optimize management of chronic heptitis C p <0.0001 Proportion of Patients with SVR (%) p <0.0001