Se ha denunciado esta presentación.
Se está descargando tu SlideShare. ×
Anuncio
Anuncio
Anuncio
Anuncio
Anuncio
Anuncio
Anuncio
Anuncio
Anuncio
Anuncio
Anuncio
Anuncio
Próximo SlideShare
Crisper Cas system
Crisper Cas system
Cargando en…3
×

Eche un vistazo a continuación

1 de 75 Anuncio

Más Contenido Relacionado

Presentaciones para usted (20)

Similares a Crispr cas9 (20)

Anuncio

Más reciente (20)

Crispr cas9

  1. 1. A art of genome editing Presented by SARBANI BANIK 05ABT/15 CREDIT SEMINAR-599 CRISPR-CAS9
  2. 2. CONTENTS  GENOME EDITING  HISTORY OF GENOME EDITING  TYPES OF MOLECULAR SCISCCORS  MECHANISM OF GENOME EDITING  CRISPER TIMELINE  DISCOVERY ISSUES  WHAT IS CRISPR CAS9?  KEY COMPONENTS OF CRISPER  NATURAL CRISPR SYSTEM  CRISPR AS A GENOMIC TOOL  GENERAL PROTOCOL  RECENT ADVANCES  CRISPR IN AGRICUTURE  ADVANTAGES  LIMITATIONS  ETHICAL ISSUES  CASE STUDIES  FUTURE PROSPECTS  CONCLUSION  REFERENCES
  3. 3. Genome editing, is a type of genetic engineering in which DNA is inserted, deleted or replaced in the genome of a living organism using engineered nucleases, or "molecular scissors.“ Genome editing was selected by Nature Methods as the 2011 Method of the Year GENOME EDITING
  4. 4.  Evolution of genome editing techniques
  5. 5. Molecular scissorsMega nucleases TALEN (Transcription activator like effector based nucleases Crispr cas9 Zinc finger nucleases(ZFN)
  6. 6. Mechanism of genome editing
  7. 7. CRISPR-CAS9 TECHNOLOGY
  8. 8.  Discovery of crisper technology
  9. 9. Patent war
  10. 10. What is CRISPR-cas9 system? Clustered regularly interspaced short palindromic repeats segments of prokaryotic DNA containing,repetitive base sequences. These play a key role in a bacterial defence system,  form the basis of a genome editing technology known as CRISPR-Cas9 that allows permanent modification of genes within organisms. CRISPRs are found in approximately 40% of sequenced bacterial genomes and 90% of sequenced archaea
  11. 11. . Crispr (cr) RNA + trans-activating (tra) crRNA combined = single guide (sg) RNA
  12. 12. Discovery of CRISPR in bacterial immune system  It was first observed in Escherichia coli by Osaka University researcher Yoshizumi Ishino in 1987. ENEMIES FIGHTING FOR EXISTANCE
  13. 13. Natural defense mechanism High throughput genome engineering technology
  14. 14. General protocol of CRISPR-CAS9
  15. 15. 27
  16. 16. 28  Optimized CRISPR Design (Feng Zhang's Lab at MIT/BROAD, USA)  sgRNA Scorer (George Church's Lab at Harvard, USA)  sgRNA Designer (BROAD Institute)  ChopChop web tool (George Church's Lab at Harvard, USA)  E-CRISP (Michael Boutros' lab at DKFZ, Germany)  CRISPR Finder (Wellcome Trust Sanger Institute, Hinxton, UK)  RepeatMasker (Institute for Systems Biology) to double check and avoid selecting target sites with repeated sequences sgRNA designing tools
  17. 17. RECENT ADVANCES Expanding CRISPR-CAS9 recognition sequence Improving cleavage specificity of the CRISPR-CAS9 system Inducible cas9 expression
  18. 18.  Expanding CRISPR-CAS9 recognition sequence Strategy no 1:- Drive grna expression using a different promoter Stratergy no 2:- remove restrictions in the PAM sequences Stratergy no 3:- by editing the cas 9 sequence
  19. 19. Modification to the cas9 endonuclease Two catalytic domains RUVc & HNH Mutated this catalytic residues Cause single strand nick in case of DSBS Reduce off target activity Specific knock out targets CAS9n Improving cleavage specificity of the CRISPR-CAS9 system
  20. 20.  Cas9 wild-type: The cut site occurs 3 bp 5’ of the PAM sequence  Cas9n (D10a): the single strand nick occurs on the opposite strand AGCTGGGATCAACTATAGCG CGG TCGACCCTAGTTGATATCGC GCC gRNA target sequence PAM AGCTGGGATCAACTATAGCG CGG TCGACCCTAGTTGATATCGC GCC gRNA target sequence PAM
  21. 21. Pacas9 dimerises and become active creating dsb when optical stimulas is present Photo activable cas9 (pacas9) by splitting cas9 into two fragments and fused to photo induicible domain In order to make cas9 active in specific time or specific tissues Inducible or conditional Upon blue light irradiation
  22. 22. Applications…. An effective technique that will allow scientists to adequately edit genes to cure diseases. The case is similar for plant species. Where scientists desire to knock‐out a gene that will result in an increase in a particular nutritional content or in increased drought and/or pest resistance.
  23. 23. Cont…Sickle cell anemia is a great example of a disease in which mutation of a single base mutation (T to A) could be edited by CRISPR and the disease cured  Wang et al. (2014) used both TALEN and CRISPR/Cas9 technologies to target and successfully knock out the genes of the mildew- resistance locus (MLO) in wheat to generate plants resistant to powdery mildew disease. Germline manipulation with CRISPR‐Cas9 system in mice were capable of correcting both the mutant gene and cataract phenotype in offspring initially caused by a one base pair deletion in exon 3 of Crygc (crystallin gamma C) gene.
  24. 24. Cont…  Inhuman intestinal stem cells collected from patients with cystic fibrosis, the culprit defective gene CFTR (cystic fibrosis transmembrane conductance regulator) was rectified by homologous recombination during CRISPR‐Cas9 genome editing while the pluripotency was retained as demonstrated by formations of organ‐like expansions in cell culture
  25. 25.  . HepG2 cells expressing hepatitis B virus (HBV), the introduction of CRISPR‐Cas9 system resulted in both decreased hepatitis B core antigen expression which provides an impetus for further research on the possibility of CRISPR‐Cas9‐mediated hepatitis B prevention
  26. 26. Cont…   . CRISPR‐Cas9 can mutate long terminal repeat (LTR) sequence of HIV‐1 in vitro, resulting in removal of the integrated pro viral DNA from the part of the host cells and a significant drop in virus expression. Likewise, in an effort to confirm that gene editing was at least possible, cells from rice plants were transformed with vectors carrying CRISPR gateway vector targeting CHLOROPHYLLA OXYGENASE 1 (CAO1) gene (Miao et al., 2013
  27. 27.  FUTURE PROSPECTS
  28. 28. CRISPR MOSQUITO
  29. 29. CRISPR MONKEY
  30. 30. Therapeutic applications
  31. 31. crispr in Agriculture  Can be used to create high degree of genetic variability at precise locus in the genome of the crop plants.  Potential tool for multiplexed reverse and forward genetic study.  Precise transgene integration at specific loci.  Developing biotic and abiotic resistant traits in crop plants.  Potential tool for developing virus resistant crop varieties.  Can be used to eradicate unwanted species like herbicide resistant weeds, insect pest.  Potential tool for improving polyploid crops like potato and wheat. 50
  32. 32. Examples of crops modified with CRISPR technology 51 CROPS DESCRIPTION REFERNCES Corn Targeted mutagenesis Liang et al. 2014 Rice Targeted mutagenesis Belhaj et al. 2013 Sorghum Targeted gene modification Jiang et al. 2013b Sweet orange Targeted genome editing Jia and Wang 2014 Tobacco Targeted mutagenesis Belhaj et al. 2013 Wheat Targeted mutagenesis Upadhyay et al. 2013, Yanpeng et al. 2014 Potato Soybean Targeted mutagenesis Gene editing Shaohui et al., 2015 Yupeng et al., 2015
  33. 33. Genome editing tool Transformati on method Crops Targeted genes 52
  34. 34. ADVANTAGES SIMPLE DESIGN AND PREPARATION NEED NOT BE CYTOTOXIC ALLOW THR RNA FRAGMENTS TO BE MADE BY ANNELEING MULTIPLEXING GENES
  35. 35.  LIMITATIONS
  36. 36.  ETHICAL ISSUES
  37. 37. Case study-2 The Cas9/sgRNA of the CRISPR/Cas system has emerged as a robust technology for targeted gene editing in various organisms, including plants, where Cas9/sgRNA-mediated small deletions/insertions at single cleavage sites have been reported in transient and stable transformations, although genetic transmission of edits has been reported only in Arabidopsis and rice. Large chromosomal excision between two remote nuclease-targeted loci has been reported only in a few non-plant species. Here we report in rice Cas9/sgRNA- induced large chromosomal segment deletions, the inheritance of genome edits in multiple generations and construction of a set of facile vectors for high- efficiency, multiplex gene targeting. Four sugar efflux transporter genes were modified in rice at high efficiency; the most efficient system yielding 87–100% editing in T0 transgenic plants, all with di-allelic edits. Furthermore, genetic crosses segregating Cas9/sgRNA transgenes away from edited genes yielded several genome edited but transgene-free rice plants. We also demonstrated proof-of-efficiency of Cas9/sgRNAs in producing large chromosomal deletions (115–245 kb)involving three different clusters of genes in rice protoplasts and verification of deletions of two clusters in regenerated T0 generation plants. Together, these data demonstrate the power of our Cas9/sgRNA platform for targeted gene/genome editing in rice and other crops, enabling both basic research and agricultural Case study 1
  38. 38. MATERIALS AND METHODS 1. Plant material:-Japonica rice cultivar(kitaake) 2. Construction of plasmids expressing Cas9 and guide RNAs -pUbi-Cas9 binary vector which is synthesise by GeneScrept and cloned into pENTR4 3.transient gene expression in rice protoplasts -Isolation and transfection of rice mesophyll protoplasts were carried out. 4. Agrobacterium-mediated rice transformation -Agrobacterium tumefaciens strain EHA105 by electroporation. 5. Detection of targeted genomic editing events by T7E1 6. Detection of large fragment deletion by sanger sequencing 7. Genotyping 58
  39. 39. 59 Structure of Binary Vector
  40. 40. Results  Constrctions of CRISPR/CAS9 systems with different Grna-  Inheritance and stability study of targeted gene mutations in T1 and T2 generations  Cas9/sg RNA induce large chromosomal deletion in rice protoplast  CAS9/Sgrna activity produces rice plants containg large deletions of gene cluster
  41. 41. A) Schematic of a cluster of five diterpenoid genes within an~170kb region on rice chromosome number 4. (B) Agarose gel electrophoresis image of the PCR products amplified from DNA. (C) Sequences of large DNA segment deletion?induced by sgRNAs. 61
  42. 42. 62 Callus Line of T0 plant Callus lines containing the ~245kb deletions identified with PCR approach and confirmed with sequencing of amplicons. (C) DNA sequence changes in the representative plants generate from three callus lines (#16, 17 and 21) with the Cas9/ sgRNA induce large deletions (dashed lines) in one chromosome and small nucleotide changes (dashed lines for deletions and lower case letters for insertions) in the homologous chromosome.
  43. 43. Figure 5. Inheritance of the Cas9/sgRNA modified SWEET13 and removal of transgenes in T1 progeny. (A) Each of the di-allelic mutations (4-and 11-bp deletions) in one representative T0 line (#7) was transmitted to its progeny (T1 plant 7–1 and -3). The sgRNA-targeted site is denoted inthe wild-type sequence as bold letters and the PAM sequence underlined.Nucleotide deletions are denoted as dashed lines. (B) PCR-detected presenceand absence of individual transgenes (Cas9, hptII and sgRNA) fromdifferent sources as indicated above each lane of the agarose gel picture.SWEET13 was used as a control for sample quality.
  44. 44. Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice Case study 1 64 Yang et al. (2014) USA Case study 2
  45. 45. MATERIALS AND METHODS  Plant material  Vector construction of cas9 and sgRNA  Hairy root transformation of soybean by A. rhizogenes (strain K599),soybean cotyledons were taken  GFP imaging via Olympus MVX10 microscope with a GFP filter  sequencing and analysis  Off target sequence identification  Biolistic transformation of somatic embroys 65
  46. 46. Results and discussion  Knock out of a GFP transgene  Modifying the soybean gene (Glyma07g14530, 3 events were modified and 6 events contain modified and wild both)  Targeting gene pairs(Glyma01g38150 & Glymallg07220)  Genetic modifications of somatic embryos  Mutation efficiency(the mutation efficiency is 10 fold higher than soybean hairy roots)  Evaluation of off target modifications
  47. 47. Schematic showing the targeted GFP sequences.
  48. 48. (B)C9 + GFP 5' target events  Wild-type sequences are in green, deletions are shown as dashes, and SNPs are shown in orange.
  49. 49. (C) C9 + GFP 3' target events  Wild-type sequences are in green, deletions are shown as dashes, and SNPs are shown in orange.
  50. 50. Modification efficiency for hairy root events 1. 01gDDM1- 78-80% indel frequency 2. 11gDDM1- 87-90% indel frequency 3. 01gDDM1 +11gDDM1 – 21-23% indel frequency
  51. 51. Figure 4 DNA modifications in somatic embryos. (A) Long-distance PCR for the Cas9 gene in recovered events with 01g + 11gDDM1 and 07g14530. Marker is a 1 Kb DNA ladder. Asterisks (*) indicate events with an intact Cas9. (B) Modifications were detected in three events transformed with the01g + 11gDDM1 vector. At the initial time-point, modifications were only detected in event 24. When samples were taken approximately 2 weeks later,modifications were detected in all three events. (C) Modifications were detected in 14 out of 16 individual regenerating embryos from event 24.
  52. 52. Conclusion of case study  Cas9 system is functional in two transformation methods.  It was possible to efficiently mutate all 11 loci.  CRISPR system will be a simple and inexpensive genome editing method in soybean.
  53. 53.  CONCLUSION Undoubtedly this process caught most attention for their potential in medical applications and numerous other biotechnological applications like crop editing, gene drives and synthetic biology Despite the enormous potential that lies within the CRISPR-Cas9 technology, further investigation is required to make the system an applicable and safe tool for therapeutically useful approaches
  54. 54. REFERENCES  RNA-guided genetic silencing systems in bacteria and archaea. Blake Wiedenheft Samuel H. Sternberg & Jennifer A. Doudna. Nature 2012  A Programmable Dual-RNA–Guided DNA Endonuclease in Adaptive Bacterial Immunity. Jinek et al. Science 2012  CRISPER handbook  RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Jiang et al. Nature Biotech 2013  CRISPR interference (CRISPRi) for sequence-specific control of gene expression. Larson et al., Nature protocols 2013  Targeted genome modifications in soybean with crispr/cas9. Jacobs et al. BMC Biotechnology(2015)  Large chromosomal deletions and heritable small genetic changes induced by CRISPR/Cas9 in rice, Zhou et al. Nucleic acid research 2014
  55. 55. 75

Notas del editor

  • So in contrast to the wild type, which will introduce a double strand break 3 bases to the 5 prime of the PAM site, the D10A nickase will cut only the opposite strand at this position.

    Work is still being done to understand the best strategies for using this system – and a lot of this work is showcased in a recent paper from Keithjoungs lab

×