5. From OncoLog, April 2006, Vol. 51, No. 4 Breaks in “Backward” DNA Associated with Leukemia When otherwise normal DNA adopts an unusual shape called Z-DNA, it can lead to the kind of genetic instability associated with cancers such as leukemia and lymphoma, according to a study by researchers at The University of Texas M. D. Anderson Cancer Center. The study, presented in the February 21 edition of the Proceedings of the National Academy of Sciences , demonstrates for the first time that the odd shape can cause DNA breaks in mammalian cells.
6. Interestingly, sequences prone to forming Z-DNA are often found in genetic “hot spots,” areas of DNA prone to the genetic rearrangements associated with cancer. About 90% of patients with Burkitt’s lymphoma, for example, have DNA breaks that map to regions with the potential to form these odd DNA structures.
7. Imagine untwisting the DNA ladder and then winding it up the other way. The resulting “Z-DNA” would be a twisted mess with segments jutting out left and right and with the all-important base pairs that hold the DNA code zigzagging like a jagged zipper. It just doesn’t look right, and it doesn’t act right, either, according to Karen Vasquez, Ph.D., lead author of the study This awkward shape can cause the DNA molecule to break completely apart. “ Our study shows that DNA itself can act as a mutagen, resulting in genetic instability,” said Dr. Vasquez. “The discovery opens up a new field of inquiry into the role of DNA shape in genomic instability and cancer.”
10. (a) Telomeres on human chromosomes consist of the hexanucleotide sequence TTAGGG repeated between 1000 and 1700 times. These TTAGGG tandem repeats are attached to the 3'-ends of the DNA strands and are paired with the complementary sequence 3'-AATCCC-5' on the other DNA strand. Thus, a G-rich region is created at the 3'-end of each DNA strand and a C-rich region is created at the 5'-end of each DNA strand. Typically, at each end of the chromosome, the G-rich strand protrudes 12 to 16 nucleotides beyond its complementary C-rich strand. (b) Like other telomerases, human telomerase is a ribonucleoprotein. The ribonucleic acid of human telomerase is an RNA molecule 962 nucleotides long. This RNA serves as the template for the DNA polymerase activity of telomerase. Nucleotides 46 to 56 of this RNA are CUAA CCCUAA C and provide the template function for the telomerase-catalyzed addition of TTAGGG units to the 3'-end of a DNA strand.
11. Repeated G rich sequence on one strand in humans: (TTAGGG) n Repeats can be several thousand basepairs long. In humans, telomeric repeats average 5-15 kilobases Telomere specific proteins, eg. TRF1 & TRF2 bind to the repeat sequence and protect the ends Without these proteins, telomeres are acted upon by DNA repair pathways leading to chromosomal fusions Telomeres *
14. Eukaryotic DNA polymerases Eukaryotes have at least 15 DNA Polymerases ( 5 most important): Pol α : acts as a primase (synthesizing a RNA primer), and then as a DNA Pol elongating that primer with DNA nucleotides. After a few hundred nucleotides elongation is taken over by Pol δ and ε. Pol β : is implicated in repairing DNA. Pol γ : replicates mitochondrial DNA. Pol δ : is the main polymerase in eukaryotes, it is highly processive and has 3'->5' exonuclease activity. Pol ε : may substitute for Pol δ in lagging strand synthesis, however the exact role is uncertain. η , ι , κ , and Rev1 are Y-family DNA polymerases and Pol ζ is a B-family DNA polymerase. These polymerases are involved in the bypass of DNA damage. There are also other eukaryotic polymerases known, which are not as well characterized: θ , λ , φ , σ , and μ . There are also others, but the nomenclature has become quite jumbled. *
33. Stained with SYBR-Green Stained with Ethidium Bromide Agarose gel of DNA digested with restriction enzymes Stained with Ethidium Bromide (black and white print) Visualized in a transilluminator with UV light
35. Transfer of electrophoretically separated fragments of DNA, after denaturation, from the gel to an absorbent sheet of material, such as nitrocellulose, to which the DNA binds. The sheet is immersed in a solution containing a labeled probe that will hybridize to fragment(s) of interest. The method was first devised by E. M. Southern to transfer DNA fragments from an agarose gel to a nitrocellulose paper for hybridization, but similar transfer methods are now also used for transfering RNA or protein to papers of a variety of types followed by hybridization (RNA) or labeled antibody treatment (protein) to identify specific molecules. The Southern blot is named after its inventor, the British biologist M.E. Southern. There is also a Northern blot (RNA) and a Western blot (Protein). Southern blot (DNA) *
36. RNA Analysis: Northern blot 1,3,5: Total RNA 2,4: mRNA Agarose gel A : Stain with Ethidium Bromide B : Autoradiography ( 32 P) A B *
37. DNA Analysis: PCR P olymerase C hain R eaction Kary Mullis Nobel Prize in Chemistry 1993 *
38. RT-PCR: R everse T ranscription-PCR From mRNA is produced DNA (copy, cDNA) by using reverse transcriptase (RT). This cDNA is amplified by PCR . The size of the amplified DNA differs of the genomic DNA if introns are present in the gene. RNA Analysis : RNA DNA RT Reverse transcriptase PCR *
39.
40.
41.
42. J Clin Microbiol. 2002 September; 40(9): 3334–3340. Detection and Quantification of Oral Treponemes in Subgingival Plaque by Real-Time PCR Yasuyuki Asai, Takayoshi Jinno, Hajime Igarashi, Yoshinori Ohyama, and Tomohiko Ogawa* Department of Oral Microbiology, Asahi University School of Dentistry, 1851-1 Hozumi, Hozumi-cho, Motosu-gun, Gifu 501-0296, Japan
43. Oral treponemes have been associated with periodontal diseases. We developed a highly sensitive and specific method to detect and quantify cultivable oral treponemes ( Treponema denticola , Treponema vincentii , and Treponema medium ) in 50 subgingival plaque samples from 13 healthy subjects as well as 37 patients with periodontal diseases using real-time PCR assays with specific primers and a TaqMan probe for each 16S rRNA sequence. The specificity for each assay was examined by using DNA specimens from various treponemal and other bacterial species . The TaqMan real-time PCR was able to detect from 103 to 108 cells of the oral treponemes….
45. TABLE 1. PCR primers for detection of oral treponemes Adapted from Asai et al., J Clin Microbiol 2002
46. TABLE 1. PCR primers for detection of oral treponemes (cont.) Adapted from Asai et al., J Clin Microbiol 2002
47. Fig.1 Electrophoresis evaluation of PCR products amplified with primers for T. denticola (A), T. vincentii (B), T. medium (C), and total treponemes (D) and with a ubiquitous primer (E). Lanes: M, molecular size marker (a 100-bp DNA ladder); 1, T. denticola ; 2, T. vincentii ; 3, T. medium ; 4, T. socranskii ; 5, T. phagedenis ; 6, T. pectinovorum ; 7, P. gingivalis ; 8, P. nigrescens ; 9, A. actinomycetemcomitans ; 10, E. coli ; 11, F. nucleatum ; 12, S. mutans ; 13, S. oralis ; and 14, S. salivarius . The expected sizes are noted by arrows. Adapted from Asai et al., J Clin Microbiol 2002
48.
49. RFLP : R estriction F ragment L ength P olymorphism *
51. Collect Tissue Sample How to do DNA Fingerprinting The Big Picture >1000 cells RFLP / Southern blot PCR Analysis RFLP / Southern blot >20 cells *
52.
53. How to Focus on Specific Regions of Genome Need a probe: A short single stranded DNA which is complementary to the region of interest CAGTATACACAAGTACCGTACCTGGCTCAGTTATACGCCGA A probe will base pair to the region of interest GTCATATGTGTTCATGGCATGGACCGAGTCAATATGCGGCT ::::::::::::::::::::::::::::::::::::::::: ATGGCATGGACC :::::::::::: probe
58. Transfection of foreign genes into mammalian cells viral promoter recognized by mammalian cells Polylinker region (sequences recognized by several restriction enzymes) Produce a recombinant plasmid by cloning of an specific gene into the “skeleton” of a plasmid (vector) *
65. DNA Sequence Historically there are two main methods of DNA sequencing: Maxam & Gilbert , using chemical sequencing Sanger , using dideoxynucleotides . Modern sequencing equipment uses the principles of the Sanger technique. *
75. siRNA Small interfering RNA: 20-25 nt with specific complementary sequence for a target mRNA is introduce in the cell. The targeted mRNA is degraded. The corresponding protein it is not expressed. Inhibition of caspase-3 synthesis by siRNA Andrew Fire Craig Mello Nobel Prize - Medicine 2006 *
76. DNA ARRAY Microarrays are simply ordered sets of DNA molecules of known sequence. Usually rectangular, they can consist of a few hundred to hundreds of thousands of sets. Microarray analysis permits scientists to detect thousands of genes in a small sample simultaneously and to analyze the expression of those genes . *
77. DNA ARRAY Simultaneous expression analysis of hundreds or thousands genes in cell culture or tissues *
Between 1000 and 1700 times Telmerase is a ribonucleoprotein
At end there are repate of gt
Telomerase is specialized reverse trnscriptate RNA to do DNA
Eukaryotic systems 15 dna polymerase more sophiscated then prokayotes Dela is the most importy Aphla is the start
Telemerase that has teyplate of , continue to prolong
Cancer Genetic info is same somatic cell, telomerase is not active or not expressed cancer prolongs telomerase overproduce
How dna is managed in lab, Dna pur from bcteria, fungi, culture tissues Bacteria not interistedn in chromosomal, but interested in plasmid
Need to extract dna out of cell Purification there are 2 methods Put in a detergain, that completely destryed, and so on Dna on the glass rod, then transfers to another tube
Commercial kit
Transgenic add one gene that isn’t there Knockout block out a gene can check to see if the gene is critical can see what different between normal and knockout specimen
When we purify dna Genomic dna put in gel Restriction enzyme cut in different parts gets a smear band Ehidium bromikde can make flourencen w/ uv light Plasmid cn go in different orientation
Resticiton enzyhme is molecular scissors to cut sequence Alul and haeloll produce blunt ends
Class 2
When we cut, there is 1 over here, one over there
Restiction enzymes Have particulate sequence to put in different plasmid
Put whole dna Nothern rna Southern dna Western protein
Nothern is the same as southern
Pcr tech to use very small amount of DNA can see in gel After 2 hours milions of sequsions
Rt-pcr Rna to dna
discription
Discription Whent to volcano’s in the sea bacteria growing there, in that critical temops TAQ polimerzawse
Rapid detetion of dna sequences
See if some particular bacteris is present in certain oral stuff Taqman real time pcra was to dect 103 to 108 cells
Certain patients are different to each other
Able to cut dna in different places
99% dna is the same Some region had different sequence
Dan fingerprinting
Lots of sample use souther blot Only a little use PCR
Cut sequsnce Can recombine 2 sequenses
Plasma express foreign gene
Cell in culture, reach nucleus Put extra gene that usually not there
Short time it is expressed
How to knockout gene put double strand rna, mrna siRNA
Result of expressio of dna
Extra gene to cure diseas
All the list of all the methods Have some idea of how to do certain things There is a person that supposted to be a fatehr, Which methoid wouold we use (fingerprinting)
