Publicaciòn de AHA con 2 cepas diferentes de Eh

1. Am. J. Trop. Med. Hyg., 80(1), 2009, pp. 51–54
Copyright © 2009 by The American Society of Tropical Medicine and Hygiene
Short Report: Two Different Chitinase Genotypes in a Patient with an Amebic Liver
Abscess: A Case Report
Olivia Valenzuela, Patricia Morán, Fernando Ramos, Jorge I. Cardoza, Gabriela García, Alicia Valadez,
Liliana Rojas, Adriana Garibay, Enrique González, and Cecilia Ximénez*
Departamento de Ciencias Químico Biológicas, Universidad de Sonora, México; Departmento de Medicina Experimental, Facultad de
Medicina Universidad Nacional Autónoma de Mexico, México DF; Departamento de Medicina Interna, Hospital General del Estado,
Hermosillo Sonora, México
Abstract. The present work deals with the identification of a patient with two liver abscesses containing two different
strains of Entamoeba histolytica, as defined by chitinase gene plymorphisms.
INTRODUCTION before hospital admission, the patient had been complain-
ing of right upper quadrant abdominal pain, fever (> 38°C)
Entamoeba histolytica is an important cause of morbidity and an unexplained weight loss of 10 kg (22 lbs). The clini-
and mortality in Latin America, Asia, and Africa. The three cal diagnosis was ALA as confirmed by x-rays, a computed
major clinical forms of E. histolytica infection are asymptom- tomography (CT) scan, and enzyme-linked immunosorbent
atic colonization of the intestinal mucosa (asymptomatic cyst assay (ELISA), which indicated high levels (OD, 1.803) of
passers), amebic colitis or dysentery in which the trophozo- serum anti-E. histolytica antibodies (IgG).15 An electrocar-
ites invade the intestinal mucosa, and amebic liver abscesses diogram showed no abnormalities and the thoracic x-ray
(ALAs) where trophozoites invade the intestinal mucosa and showed a slight elevation of the right hemi-diaphragm
reach the hepatic parenchyma through the portal circulation (Figure 1A). The abdominal ultrasonography performed dur-
system.
ing admission showed a 13.1 cm long, 14.6 cm trans, and 9.3-
In Mexico, ALA is associated with significant morbid-
cm AP hypo-echoic area in the left hepatic lobe, which was
ity and low but significant mortality.1 Although ALA grows
indicative of a liver abscess. The right hepatic lobe showed
inexorably in humans and is always fatal without appropriate
only a slight increase in size (data not shown).
treatment, current anti-amebic therapy2 can treat even large
To improve the view of the right hepatic lobule, an abdom-
amebic abscesses.
inal CT scan was performed on day eight after admission.
The high rate of intestinal re-infection in highly endemic
A large left lobe abscess was clearly observed, and a sec-
areas is mainly the result of repetitive exposure to Entamoeba
ond independent abscess was detected in the right lobule
parasites.3–8 The development of repeated ALA is more fre-
(Figure 1B). Anti-amebic treatment with intravenous (IV)
quent than previously thought.9–11 Furthermore, it has been
metronidazole was established (500 mg every 8 hours) and
reported that roughly 50% of ALA cases develop more than
“intravenously” cefotaxime (1 g every 8 hours) was given for
one ALA at the same time.12,13
antimicrobial coverage. Cultures of the aspirated material
In the present work, we report an adult patient who devel-
yielded negative results.
oped two simultaneous and independent ALAs. The size of
The clinical course after a 72-hour treatment was poor
both abscesses necessitated drainage. The drained material
because of the persistence of fever (up to 38°C) and abdom-
was submitted to DNA extraction and subsequent polymerase
inal pain. The physician in charge decided to drain both
chain reaction (PCR) amplification of polymorphic regions in
abscesses because of the risk of rupture. The procedure was
the chitinase gene of E. histolytica species (Ehcht). The Ehcht
guided by ultrasound. A multi-purpose catheter was placed in
gene encodes a protein with a repeating structure at the amino
each abscess.
terminus.14 This degenerate heptapeptide repeat region exhib-
Both catheters were removed after 15 days because of sig-
its a polymorphism among isolates of Entamoeba species
nificant clinical improvement and the patient was discharged
with regard to the number and type of repeat copies. Results
3 days later. The patient remained under outpatient manage-
of the polymorphism study of the Ehcht gene from both of
ment with an oral regimen of metronidazole (500 mg every
the patient’s aspirated ALAs suggest that the two indepen-
8 hours) and ciprofloxacine (500 mg every 12 hours) for
dent liver abscesses were caused by two genetic variants of
another 5 days.
E. histolytica.
The ELISA method used to detect and quantify E. his-
tolytica antibody was previously reported.16 The cut-off point
CASE REPORT for IgG (OD of 0.525) was defined as the best optical den-
sity value obtained from the receiver operating characteristic
The patient was a 48-year-old male with a history of dia- (ROC) curve for serum samples and for detection of anti-
betes, alcoholism, and smoking for the last 20 years. The
amebic antibodies.16
patient was admitted to the Hospital General del Estado
The DNA was extracted from independent aspirate sam-
in Hermosillo, Sonora, on September 28, 2007. For 10 days
ples of each ALA (right and left hepatic lobules) using the
QIAamp DNA Mini Kit (Qiagen Inc., Valencia, CA) in accor-
dance with the provider’s protocol.
* Address correspondence to Cecilia Ximénez, Departamento de
Medicina Experimental, Facultad de Medicina, UNAM, Dr. Balmis
Amplification of the highly polymorphic region of the
148, Col. Doctores, CP 06726, México D.F., México. E-mail: chitinase gene was done by PCR using primers described in
cximenez@servidor.unam.mx Table 1. The PCR conditions were previously described.17
51

2. 52 VALENZUELA AND OTHERS
Figure 1. A, Thoracic x-ray taken during patient admission. The image shows elevation of the hemidiaphragm. B, Computed tomography (CT)
scan showing an image of both large abscesses in the left and right hepatic lobules.
After electrophoresis, the gels were photographed for our E. histolytica HM1:IMSS is shown in Figure 2A. Sequences of
records. The PCR products were purified using the GFX kit both left and right lobules abscesses are shorter than the E.
(Amersham Pharmacia Biotech, Sao Paulo, Brazil) and then histolytica HM1:IMSS strain, there is also a nucleotide change
sequenced at the University of Arizona (Genomic Analysis & (G by A) in position 109 on the HM1:IMSS strain (Figure 2B).
Technology Core, Tucson, AZ). The sequences were aligned The sequence of Ehcht gene in the left hepatic lobule abscess
with the reported sequences of E. histolytica present in the is identical to genotype H reported previously in ALA cases
Gen Bank data base (Figure 2A and B). in Mexico (Gen Bank accession no. EF-445962). However,
the Ehcht gene sequence obtained in the right hepatic lobule
abscess is identical to the one on NIH-200 and K1 E. histolyt-
RESULTS AND DISCUSSION
ica strains reported by Ghosh and others.4
In the present work, we report a patient with ALA who Translation of the nucleotide sequences into amino acid
developed two independent abscesses located in the right and sequences and the corresponding alignment is shown in
left hepatic lobules (Figure 1A and B). The clinical findings Figure 2B and correlates with the nucleotide sequences men-
were coincident with the presence of high levels of circulating tioned earlier.
anti-amebic antibodies, as detected by ELISA. Together, these Even though simultaneous intestinal infections by E. his-
results point to an amebic etiology for the liver abscess (OD tolytica and E. dispar have been previously reported,17,19–21 this
at 490 nm of 1.8).15,16 was the first report that showed amebic infection by more than
Entamoeba histolytica was confirmed as the causative agent one genetic variant of the E. histolytica species in the same
by PCR analyses of the drainage material from both abscesses. patient. This phenomenon has been described for other par-
Samples from the two abscesses contained fragments of the asitic infections, such as trypanosomiasis, leishmaniasis, and
Ehcht gene, the amplified region was located between the sig- malaria.22,23
nal sequence and the catalytic site of the protein, which has It is known that ALA occurs without any colitis symptoms
heptapeptide repetitive sequences rich in hydrophilic amino and without any detectable parasites in the colon. On the
acids (Ser, Glu, Ssp, Hys, and His). However, some hydro- basis of these clinical observations, Charmot24 emphasized
phobic amino acids (Pro, Val, and Ile) were also present in the possibility that E. histolytica hepatotropic strains may
the sequences.18 The alignment of the respective nucleotide exist by mentioning that “the localization, heterogeneity, and
sequences of the PCR products obtained from material of the experimental data associated with clinical expression sug-
both left and right hepatic lobules and the reported sequences gest the existence inside the species E. histolytica of various
in the Gen Bank database (accession no. XM 647113.1) for strains: non-pathogenic one, invasive for the intestine mucous
membrane ones, and invasive for liver tissue ones.” Recently,
Ali and others25 genotyped E. histolytica strains from fecal and
Table 1 aspirated ALA samples of the same patient and demonstrated
Primer sequences the existence of co-infection by different types of strains. Their
Primer Sequence results, together with our finding, have opened a series of pos-
CHI5 GAAS*AACAGAAGGAACACCAGG sible explanations for this phenomenon. Ali’s group used poly-
CHI-Eh/Ed3 TCTGTATTGTGCCCAATT morphic intergenic regions (short tandem repeats) associated
Hsp 1 GAGTTCTCTTTTTATACTTTTATATGTT with tRNA genes as the target for genotyping the strains. The
Hsp 2 ATTAACAATAAAGAGGGAGGT authors mentioned that their results were compatible with a
StgaD-H5 AAATCCTGCCACTGTCGTAA
StgaD-H3 AATCCCCGTTGAAGAGTTCT possible new infection during the lapse between the first inoc-
SQ 5 GTGGTCTAAGGCGTGTGACT culum and the development of ALA symptoms, an account that
SQ H3 GTGGGACCACTTTTTATACCTA is reasonable in endemic regions. Another possible explanation
*S=C+G is the existence of ecologic niches in endemic environments in

3. TWO DIFFERENT EhCHT GENOTYPES IN AN AMEBIC LIVER ABSCESS 53
Figure 2. A, Nucleotide sequence alignment of the polymerase chain reaction (PCR) amplification products amplified by CHI primers. The
DNA was independently extracted from the drainage material of the left and right hepatic lobule abscesses. B, Alignment of the deduced amino
acid sequences obtained from the PCR products of the Eh chitinase gene. The DNA from the E. histolytica HM1:IMSS strain was simultaneously
studied as a reference strain. The corresponding heptapeptides were marked in color. This figure appears in color at www.ajtmh.org.
which genetically heterogeneous Entamoeba species could Medicina Interna, Hospital General del Estado, Hermosillo Sonora,
exist (i.e., E. histolytica and E. dispar species, as was previously México, Boulevard Luis Encinas y Reyes Col. Centro. CP 83000,
Tel/Fax: +52 662 2121422.
mentioned, or intraspecies genetic variants).6,19–21
Another explanation mentioned by Ali and others is that a Reprint requests: Cecilia Ximénez, Departamento de Medicina
recombination event may have occurred on the parasite DNA Experimental, Facultad de Medicina, UNAM, Dr. Balmis 148, Col.
Doctores, CP 06726, México D.F., México, Tel: +5255-56-23-26-66,
during the migration process from the intestine to the liver.25 Fax: +5255-56-23-26-79, E-mail: cximenez@servidor.unam.mx.
These events are relatively frequent in multiple copy genes,
such as the STR sequences in tRNA genes.26,27 These types of REFERENCES
chromosomal structures are less stable than the sequences
located in single copy genes, such as the chitinase gene. 1. Mexican Health Minister. Available at: http://dgepi.salud.gob.
In fact, we tested three loci of the intergenic region associ- mx.anuario/index.html.
2. Stanley SL Jr, 2003. Amoebiasis. Lancet 361: 1025–1034.
ated with tRNA genes in the abscess material (loci D-A, STR 3. Blessmann J, Buss H, Nu PA, Dinh BT, Ngo QT, Van AL, Alla MD,
Stga-D, S-Q) (data not shown). The same genotype was obtained Jackson TF, Ravdin JI, Tannich E, 2002. Real-time PCR for
in the two abscess samples. Genotype was also detected in detection and differentiation of Entamoeba histolytica and
ALA cases elsewhere.25,28,29 Entamoeba dispar in fecal samples. J Clin Microbiol 40:
Our results and those reported by Ali and others underscore 4413–4417.
4. Ghosh S, Frisardi M, Ramírez-Avila L, Descoteaux S, Sturm-
the complexity of the host-parasite relationship of Entamoeba Ramírez K, Newton-Sánchez OA, Santos-Preciado JI, Ganguly
and humans. This report furthers our understanding of the C, Lohia A, Reed S, Samuelson J, 2000. Molecular epidemiology
genetic heterogeneity of E. histolytica species in endemic of Entamoeba spp.: evidence of a bottleneck (Demographic
environments. sweep) and transcontinental spread of diploid parasites. J Clin
Microbiol 38: 3815–3821.
Received August 27, 2008. Accepted for publication September 29, 5. Haque R, Petri WA Jr, 2006. Diagnosis of amebiasis in Bangladesh.
2008. Arch Med Res 37: 273–276.
6. Ramos F, García G, Valadez A, Morán P, González E, Gómez A,
Acknowledgments: We especially thank Leopoldo Moncayo-Salazar Melendro EI, Valenzuela O, Ximénez C, 2005a. E. dispar strain:
and Ignacio Antillón-Valenzuela in the Department of Internal analysis of polymorphism as a tool for study of geographic dis-
Medicine at the Hospital General del Estado, Hermosillo Sonora, for tribution. Mol Biochem Parasitol 141: 175–177.
their participation in the clinical management of the patient. We also 7. Stauffer W, Abd-Alla M, Ravdin JI, 2006. Prevalence and inci-
thank Alexel Burgara for his technical support, Mrs. Ma. Elena Ortiz dence of Entamoeba histolytica infection in South Africa and
for her secretarial assistance, and Mr. Marco Gudiño for his help with Egypt. Arch Med Res 37: 266–269.
the graphic design. 8. Ximénez C, 2006. Epidemiology of amebiasis in Mexico: a molecu-
lar approach. Arch Med Res 37: 263–265.
Financial Support: The present work was partially supported by the
9. De León A, 1970. Delayed prognosis in amebic hepatic abscess.
grants IN-226806 and IN-204208 from PAPIIT, DGAPA, UNAM, and
Arch Med Res 1 (Suppl ): 205–206.
PE-200105 from PAPIME, DGAPA, UNAM.
10. Ramiro M, Morán P, Olvera H, Curiel O, González E, Ramos F,
Authors’ addresses: Olivia Valenzuela and Adriana Garibay, Melendro EI, Ximénez C, 2000. Reincidence of amebic liver
Departamento de Ciencias Químico Biológicas, Universidad de abscess: a case report. Arch Med Res 31 (4 Suppl): S1–S3.
Sonora, Boulevard Luis Encinas Jonson y Boulevard Rosales s/n, CP 11. Valenzuela O, Morán P, Gómez A, Cordova K, Corrales N, Cardoza
83000, Hermosillo, Sonora, México, Tel: +52662-2-76-35-62. Patricia J, Gomez N, Cano M, Ximénez C, 2007. Epidemiology of ame-
Morán, Fernando Ramos, Gabriela García, Alicia Valadez, Liliana bic liver abscess in Mexico: the case of Sonora. Ann Trop Med
Rojas, Enrique González, and Cecilia Ximénez, Departamento de Parasitol 101: 1–6.
Medicina Experimental, Facultad de Medicina UNAM, Dr. Balmis 12. Blessmann J, Le Van A, Tannich E, 2006. Epidemiology and
148, Col. Doctores, CP 06726, México D.F., México, Tel: +5255-56-23- treatment of amebiasis in Hue, Vietnam. Arch Med Res 3:
26-66, Fax: +5255-56-23-26-79. Jorge I. Cardoza, Departamento de 270–272.

4. 54 VALENZUELA AND OTHERS
13. Lodhi S, Sarwari AR, Muzammil M, Salam A, Smego RA, 2004. infection with Entamoeba histolytica among non-dysenteric
Features distinguishing amoebic from pyogenic liver abscess: a Mexican children. Arch Med Res 28: 311–313.
review of 577 adult cases. Trop Med Int Health 9: 718–723. 21. Morán P, Ramos F, Ramiro M, Curiel O, González E, Valadez A,
14. De La Vega H, Specht CA, Semino CE, Robbins PW, Eichinger D, Gómez A, García G, Melendro EI, Ximénez C, 2005. Infection
Caplivski D, Ghosh S, Samuelson J, 1997. Cloning and expression by immunodeficiency virus-1 is not a risk factor for amebiasis.
of chitinases of Entamoebae. Mol Biochem Parasitol 85: 139–147. Am J Trop Med Hyg 73: 296–300.
15. Valenzuela O, Ramos F, Morán P, González E, Valadez A, Gómez 22. Cuervo P, Cupolillo E, Nehme N, Hernandez V, Saravia N,
A, Melendro EI, Ramiro M, Muñoz O, Ximénez C, 2001. Fernandes O, 2004. Leishmania (Viannia): genetic analysis of
Persistence of secretory antiamoebic antibodies in patients cutaneous and mucosal strains isolated from the same patient.
with past invasive intestinal or hepatic amoebiasis. Parasitol Exp Parasitol 108: 59–66.
Res 87: 849–852. 23. Kassberger F, Birkenmaier A, Khattab A, Kremsner PG, Klinkert
16. Morán P, Gómez A, Valadez A, Ramos F, González E, García G, MQ, 2002. PCR typing of Plasmodium falciparum in matched
Limón A, Valenzuela O, Ramiro M, Hidalgo H, Melendro EI, peripheral, placental and umbilical cord blood. Parasitol Res 88:
Ximénez C, 2007. Amebic and Pyogenic Liver Abscess: 1073–1079.
Importance of Differential Diagnosis in Endemic Areas of 24. Charmot G, 1980. Do hepatotropic strains of Entamoeba histolyt-
Amebiasis. International Proceedings 5th European Congress ica exist? Bull Soc Pathol Exot Filiales 73: 405–410.
on Tropical Medicine and International Health, Amsterdam, 25. Ali IK, Clark CG, Petri WA Jr, 2008. Molecular epidemiology of
The Netherlands, 57–64. amebiasis. Infect Genet Evol 8: 698–707.
17. Ramos F, Morán P, González E, García G, Ramiro M, Gómez A, De 26. Pratt-Hyatt MJ, Kapadia KM, Wilson TE, Engelke DR, 2006.
León M del C, Melendro EI, Valadez A, Ximénez C, 2005. High Increased recombination between active tRNA genes. DNA
prevalence rate of Entamoeba histolytica asymptomatic infection Cell Biol 25: 359–364.
in a rural Mexican community. Am J Trop Med Hyg 73: 87–91. 27. Eichler EE, Sankoff D, 2003. Structural dynamics of eukaryotic
18. Hopp TP, Woods KR, 1981. Prediction of protein antigenic deter- chromosome evolution. Science 301: 793–797.
minants from amino acid sequences. Proc Natl Acad Sci USA 28. Haghighi A, Kobayashi S, Takeuchi T, Masuda G, Nozaki T, 2002.
78: 3824–3828. Remarkable genetic polymorphism among Entamoeba histolyt-
19. Acuña-Soto R, Samuelson J, De Girolami P, Zarate I, Milan ica isolates from a limited geographic area. J Clin Microbiol 40:
Velasco F, Schoolnick G, Wirth D, 1993. Application of polymerase 4081–4090.
chain reaction to the epidemiology of pathogenic and nonpatho- 29. Tawari B, Ali IKM, Scott C, Quail MA, Berriman M, Hall N,
genic Enamoeba histolytica. Am J Trop Med Hyg 48: 58–70. Clark CG, 2008. Patterns of evolution in the unique tRNA
20. Newton-Sánchez OA, Sturm-Ramírez K, Romero-Zamora JL, gene arrays of the genus Entamoeba. Mol Biol Evol 25:
Santos-Preciado JI, Samuelson J, 1997. High rate of occult 187–198.