SlideShare una empresa de Scribd logo
1 de 149
Descargar para leer sin conexión
Winning the race against virus threats to
   food crops in sub-Saharan Africa:
       What we do and how we do it!
             A review from August 2007


                 P Lava Kumar




               Contract Review Seminar, 12 April 2010   www.iita.org
Outline

1. Introduction: The challenges

2. What we do and how we do it!
           •   Clonal crops
           •   Seed crops
           •   Germplasm health and quarantine
           •   Diagnostics
           •   Capacity building

3. Future plan
                 Stay fit and competitive

4. Conclusions


                                                    www.iita.org
1. The challenges




                    www.iita.org
Food security and poverty reduction
                                                   through agriculture development

                         • 10% increase in agriculture productivity in Africa is associated
                           with 7.2% decrease in poverty (IFPRI 2004).

                                        N = 327.2 million t
                                          76% IITA crops            6%
                         35                                   7%                                      140




                                                                                                            Production, tonnes (x 1 000,000)
                              1                     1    8%                       37%
                         30            2                                                              120
                                                                                cassava
Area, ha (x 1 000,000)




                         25                             11%                                           100
                                                        musa
                         20                                                                            80

                         15       2             3
                                                               yam
                                                                  15%
                                                                            16%
                                                                                                3      60
                                                                            maize
                         10
                                                         4              5               4              40
                                           4                  6             7       6
                                                                                            7
                          5                                                                            20
                          0                                                                            0
                              Maize   Sorghum Cassava     Rice          Wheat       Musa    Yams
                                                                                                    www.iita.org
Virus diseases
•Cause yield and quality loses

•Losses are often insidious.
 Frequently less conspicuous and
 go unnoticed or untreated.

Direct and indirect losses:
   •Reduction in growth
   •Reduction in vigor
   •Reduction in quality & market value
   •Reduction in transboundary trade
   •Costs of maintaining health

• MSV: $180 million to $480 million at
  5% annual incidence

• CMD: 42% yield reduction in
  EACMV-UG affected region

• CBSD: $100 million in 2003
                                  www.iita.org
Drivers of virus spread/evolution

Agriculture intensification
• Raising population demand on food production
• Rapid expansion in area
• New crops & varieties, continuous cultivation (absence of breaks)



Effects of Global Warming                  Effects of climate variability / change
                                           • Distribution of pests and diseases
                                           • Changes in geographical
                                             distribution of hosts and pathogens
                                           • Altering crop yields and losses due
                                             to changes in efficacy of
                                             management strategies
        Source: Nature Vol 438, No. 7066



                                                                           www.iita.org
Viruses are built to win?
 • Intracellular pathogens, completely dependent on hosts.

 • Difficult to eliminate them, without eliminating the host
 • Do viruses are there to protect hosts from invasive plants?

 • For instance virus resistance in wild relatives / landraces and susceptibility
   of introduced species supports this thought.
   (new encounter diseases of introduced crops)
           CMD in cassava
           MSV in maize
           CSSV in cocoa
           Rosette of groundnut

• New paradigm - Viruses are evolutionary drivers

• There is little choice for host and virus – either they
                                                                    Source:Wiki


  adjust or both will perish                                        Virus

• Why is it important here?

•Viruses have mechanisms to negate preventive tactics
                                                                             www.iita.org
• Diverse crops
• Diverse viruses
• Diverse vectors
• Diverse modes of virus spread &
• Diverse agro-ecologies




                                    www.iita.org
Diversity in viruses




        Types worked at IITA
                               www.iita.org
Diverse vectors and modes of dissemination


Whiteflies       Aphids




Beetles          Thrips




Leafhoppers      Mealybugs




                                                  www.iita.org
Ecological diversity:
                                          Clonal and seed crops

 Viruses of clonal crops –STATIC        Viruses of seed crops - DYNAMIC
• Infected clones retain viruses        • Only seed-transmitted viruses are
  indefinitely (What goes in stays        retained and passed to next
  forever!).                              generation.


• Increase in incidence incrementally   • Incidence depends on the vectors
  Reduction depends on the                and virus sources (seed-borne /
  replacement of infected stocks.         volunteer plants / alternative hosts).
                                          Conditions favoring insects favor
                                          high incidence

• In general viruses have narrow host
  range.                                • In general, broad host range


• Predictable annual situation.         • Unpredictable annual situation.

           Different viruses – crops demands different tactics
                                                                         www.iita.org
2. What we do?




                 www.iita.org
What we do?
                                                                              Strategic Objectives
         1. Understand the foe

         2. Develop tools to monitor them

         3. Establish technologies to prevent viruses (win over the virus)

         4. Disseminate the technologies




                     Characterize viruses                        Develop serological and nucleic acid-
                 (Biological and biochemical)                           based diagnostic tools



                                           Fundamental and applied
Study virus-vector interactions and           virology research for            Ensure germplasm health safety and
       disease epidemiology               mitigating the impact of virus             quarantine monitoring
                                                     diseases



               Develop disease control options,                   Knowledge and technology transfer
                 including resistant varieties                            to stakeholders

                                                                                                         www.iita.org
What we do?
                                                         Ways to win the race
                     Plant Health Monitoring                     Breeding Programs
                        Virus-free stocks

                                     All                                  All

                                  Exclusion                             Prevention
(Cassava & banana)




                           Quarantine & Inspection               Cultivation of resistant
                                                                         varieties




                                                                                                     Breeding programs
                               (From countries)
                          Planting virus free material           Conventionally bread /
    IPM / IDM




                                                                       transgenics


                       Reduce spread
                                                  Methods to reduce            Reduce impact




                                                                                                             All
                       Vector control
                                                   impact of virus              Cultivation of
                      Physical barriers
                                                                              tolerant varieties
                        Seed testing                  infections


                            Avoidance by cultural
                                   methods                     Reduce sources of inoculum
                                Field isolation                  Eliminate crop refuge,
                          Plant spacing / alternative               alternate sources
                                     dates

                                            Not effective in SSA                                   www.iita.org
3. How do we do it?




                      www.iita.org
Inter-disciplinary approach


              Core business                                       Inter-disciplinary business

     Virus Disease                            Transgenic                           Plant Breeding
                                              resistance                                            Resistant
                                                Viral genes                                         Varieties
             Virus isolation                   Host R genes
                                                                     Germplasm screening for
                                                                           resistance
Biochemical, molecular &
                                                                           Wild and Cultivated        DISEASE
                            Virus characterization                               species
                                                                                                    MANAGEMENT
    Biological Properties




            Virus isolates               Diagnostic tools           Disease Epidemiology             Monitoring
                                                                                                       Quarantine
                                                Bioassays                 Vector biology
                                              Serological &          Virus survival and spread
                                            Nucleic-acid assays       Environmental factors




        Virology – Breeding – Biotechnology – Germplasm – Quarantine – Extension

                                                                                                        www.iita.org
Crop specific activities
Cassava
Cassava mosaic begomoviruses & brown streak        Maize
•Epidemiology                                      Maize streak virus
•Virus diversity and diagnostics                   • Host resistance
•Host resistance and seed systems
•Whitefly control                                  Cowpea & soybean
                                                   Bean pod mottle virus
Yam                                                Blackeye cowpea mosaic virus
Yam potyvirus & badnavirus complex                 Cowpea mottle virus
•Epidemiology                                      Cowpea mild mottle virus
•Virus diversity and diagnostics                   Cowpea yellow mosaic virus
•Host plant resistance                             Cowpea aphid-borne mosaic virus
•Seed systems                                      Cucumber mosaic virus
                                                   Southern bean mosaic virus
Banana                                             Cowpea chlorotic mottle
Banana bunchy top                                  Soybean mosaic virus
•Epidemiology                                      Tobacco ringspot virus
•Investigations on management options              Tobacco streak virus
                                                   Soybean begomoviruses
Cocoa                                              • Host resistance
Cocoa swollen shoot virus                          • Diversity and distribution
•Distribution and diversity
•Seed systems
                                                                          www.iita.org
Generic activities


Plant health monitoring & quarantine
•Virus indexing
•Establishment of virus-free clonal and seed germplasm
•Facilitation of germplasm distribution

Diagnostics
•PCR and ELISA-based approaches
•Viruses, fungi, bacteria and others
•Mycotoxins

Capacity building
•Graduate and post-graduates (MSc & PhD)
•Training courses & workshops for groups
•Methods manual
•Public database
•Supply of tools and materials




                                                         www.iita.org
How we do it!




Case Studies




                    www.iita.org
Cassava virology

1. CMD and CBSD diversity

2. Alternative hosts of CMD

3. Improve diagnostics

4. Virus-host interactions and host resistance

5. Whitefly vector: dynamics, host interaction and control


OJ Alabi and RA Naidu (WSU, USA)       SA Akinbade & Ope

R Hanna, J Legg, G Melaku, E Kanju, P Ntawuruhunga & P Kulakow

•USAID-linkage grant, GLCI, IFAD, USAID
•IITA Opportunity Grant, Travel Grant & Strategic Grant
                                                             www.iita.org
Cassava mosaic disease
Caused by a complex of 7 species either alone or in mixed infection
•African cassava mosaic virus (ACMV)
•East African cassava mosaic virus (EACMV)
•South African cassava mosaic virus (SACMV)
•EACMV-Cameroon, EACMV-Malawi, EACMV-Kenya, EACMV-Zanzibar
EACMV-Uganda (Recombinant virus)




                                                                www.iita.org
CMG Distribution
                                                                        • Surveys were conducted in 7 countries
                                                                        • Samples analyzed by differential PCR &
                                                                          sequencing

              80
              70
              60                                                                                            ACMV
% incidence




              50                                                                                            Both
              40                                                                                            None
              30                                                                                            EACMV
              20                                                                                            UgV
              10
               0
                                                                  9



                                                                                          9




                                                                                         09
                                                                                          8
                        ia




                                                                                                     08
                                     08



                                                  89




                                                                                        -0
                                                               -0




                                                                                       -0
                    er




                                                                                     ie
                                                            08




                                                                                      e



                                                                                                 la
                                a



                                             a




                                                                                    07
                   ig




                                                                                   on
                                                                                   or
                                 n



                                              n




                                                                                                go
                                                         on
                N



                              ha



                                           ha




                                                                                  n
                                                                                Iv




                                                                               Le



                                                                                              An
                                                                               ni
                                                          o



                                                                              d'
                             G



                                          G



                                                       er




                                                                          Be



                                                                            ra
                                                                   e
                                                   am




                                                                         er
                                                                 ot
                                                                C




                                                                      Si
                                                  C




              •Only ACMV was detected in samples in Mali and Niger.
              •EACMV-UG was detected in Angola and Cameroon.
                                                                                                          www.iita.org
Tracking the spread of EACMV-UG


             2009




                                             2008


                                                       2009
•As of 2005, Spread in 2.6 million sq. km causing an
 estimated loss of 47% in affected countries.

 •Spread into Cameroon in West-Central Africa
 •Spread into Angola in Southern Africa
 •Also reported from Burkina Faso and Togo in 2009


  Kumar et al, 2008; Akinbade et al., 2010
                                                              www.iita.org
CMG Distribution
                                                            Conclusions
•ACMV is predominate, followed by mixed infection of ACMV and EACMV.
•Other viruses found are EACMV and EACMCV, but not SCMV or other EACMV’s
•EACMV-UG was detected only in Angola and Cameroon

•DNA-A segments of ACMV, EACMCV and EACMV-UG sequenced were
96-98% identical to previously reported sequences
                                                                    g i|1 4 8 8 9 7 7 4 7 || E a s t Afric a

• Evidence of EACMCV (recombinant
                                                                    g i|2 2 1 3 6 0 4 3 4 |E a s t Afr ic a
                                                                    g i|8 9 3 3 0 6 1 7 |e E a s t Afr ic a n

  species) in Ghana even in 1989, ten                    99
                                                                    g i|8 9 3 3 0 6 7 1 |e E a s t Afric a n
                                                                    g i|7 2 2 9 2 8 8 | E a s t Afric a n c
  years before its discovery.                                       g i|7 2 2 9 2 8 2 | E a s t Afric a n c
                                                                    g i|1 4 8 8 9 7 7 4 0 || E a s t Afric a
                                                                    g i|8 9 3 3 0 5 5 5 |E a s t Afr ic a n

• Isolates have same age as the first ever        100
                                                               51   g i|8 9 3 3 0 5 8 3 |E a s t Afr ic a n
                                                                    g i|8 9 3 3 0 9 4 2 |E a s t Afr ic a n

  sequences of ACMV published in 1980s.                             g i|8 9 3 3 0 7 4 8 | E a s t Afric a n
                                                                    g i|8 9 3 3 0 9 6 3 |E a s t Afr ic a n
                                             74
                                                                    g i|8 9 3 3 0 9 6 3 E a s t Afr ic a n
                                                                    g i|3 8 9 2 5 6 9 |E a s t Afr ic a n
• First ever recombinant ACMV                                  70   g i|7 0 0 8 1 1 3 |S o u th Afric a n
                                                                    AC M V F N4 3 5 2 7 7
  found in in Angola                                          100   G h a n a 1 9 8 9 AC M V
                                                                    IC M V AY 7 3 0 0 3 5 .2
                                                              100   S L C M V |NC 0 0 3 8 6 1
                                                                    E AC M C V -T z 1 AY 7 9 5 9 8 3
                                                        100
                                                                    E AC M C V -NG E U6 8 5 3 2 3
                                                              100
                                                                    E AC M C V -Iv o ry AF 2 5 9 8 9 6
                                                                    G h a n a -1 9 8 9 - E AC M C V
Kumar et al., 2008; Akinbade et al., 2010                                                www.iita.org
Recombinant ACMV
•Two types of ACMV detected: Wild type and Recombinant ACMV

• Entire AV1 and AV2 (ca 1000 bp) in DNA-A segment in recombinant
  ACMV has high similarities with EACMV.
• Named as ACMV-ANG. Further studies required to assess its affect on
  pathogenicity.
                           A16.3RecACMV Recombinant ACMV-ANG
                           A16.3UGMld    Potential parent of ACMV
                           ACMVX17095
                           ACMVAJ427910
                           ACMVICAF259894
                           ACMVSvrAF126802
                           ACMVMldAF126800
                           ACMVTZAY795982
                           EACMZVAJ717562
                           EACMKVKEAJ71758
                           0
                           SACMVNC003803
                           EACMCVAF112354
                           EACMCVNG
                           EACMCVIC
                           EACMMVAJ006460
                           EACMVKEAJ717542
                           EACMVTZ
                           EACMVUG2Mld    Potential parent of
                                            AV1 and AV2
                           EACMVUG2Svr
                           EACMVNC004674                            www.iita.org
Alternative hosts to CMGV

ACMV+EACMV
Senna occidentalis
Leucana leucocephala
Manihot glaziovii
Combretum confertum
Glycine max (soybean)

ACMV only
Ricinus communis                     Centrosema           Sida
Abelmoschus esculentus (Okra)*
Centrosema pubescens
Sida cordifolia*


• ACMV and EACMCV has high
  homologies
• Indicates active migration
  between cassava and other hosts    Leucana              Okra
• Risk of novel recombination's

  *New record in 2009                             Alabi et al., 2008
                                                                       www.iita.org
Cassava brown streak virus
                                                     Potyviridae: Ipomovirus




                                                              ?


      Prior to 2005

      Post 2005
                                                               ?



•   First recognized in 1920s.
•   Affecting 1.6 million people in Eastern Africa
•   Kenya, Uganda, Tanzania, Malawi and Mozambique
•   Suspected in DRC, Burundi and Rwanda
                                                                    www.iita.org
FJ687181 CBSV (GRL00508) pCP
               FJ687175 CBSV (GRE05008) pCP
               FJ687169 CBSV (GRE03908) pCP
               AY008440 CBSV (type C) CP
               GQ329864 CBSV-Tz (full sequence) 200...
               FJ687179 CBSV (GRL00108) pCP
               FJ687178 CBSV (GRE07108) pCP
               FN434437 CBSV-Tan 70 (full sequence) ...
                                                           Ug        Ke                             CBSV Diversity
               FJ687182 CBSV (GRL00808) pCP
               FJ687184 CBSV (GRL01008) pCP
               FJ687164 CBSV (GRAO7208) pCP
                                                                Tz
               FJ687197 CBSV (GRS00608) pCP
               FJ687170 CBSV (GRE04408) pCP
               FJ687176 CBSV (GRE05108) pCP
               FJ687166 CBSV (GRE03108) pPC
               FJ687173. CBSV (GRE04708) pCP
               FJ687172 (GRE04608) pCP
               FJ687168 CBSV (GRE03708) pCP
                                                                           • About 50 partial coat protein (3’end)
                                                                             sequences generated at IITA.
               FJ687167 CBSV (GRE03608) pCP
               FN434436 CBSV-Mo 83 (full sequence) 2...


                                                                M
               FJ687191 CBSV (GRL02708) pCP
               FJ687186 CBSV (GRL01408) pCP
               FJ687202 CBSV (GRS05708) partial CP

61


          82
               FJ687201 CBSV (GRS05608) Partial CP
               FJ687185 CBSV (GRL01308) pCP
               FJ687183 CBSV (GRL00908) pCP
                                                                           • High diversity, two groups, but no
               FN423417 CBSV-CP (Nampula-Mozambique ...
               FJ687196 CBSV (GRS00208) pCP
               FJ687192 CBSV (GRL02908) pCP
                                                                             evidence of geographic separation.
               FJ687188 CBSV (GRL01808) pCP
               FJ687165 CBSV (GRA07308) pCP

          81   FJ687194 CBSV (GRL03308) pCP
     61        FJ687180 CBSV (GRL00408) pCP
               AY007597 CBSV CP
               FJ687205 CBSV (GRS07008) partial CP
               FJ687199 CBSV (GRS03208) pCP
               FJ687203CBSV (GRS5908) partial CP
               FJ687200 CBSV (GRS05208) partial CP
               FJ687204 CBSV (GRS06308) partial CP
               FJ687198 CBSV (GRS01708) pCP
               FJ687189 CBSV (GRL02308) pCP                                           100 FN433933 CBSVM 43 2007 (M
                                                                                                         a          alawi:Salima)
               AY008442 CBSV (type A) CP
               FJ821795 CBSV (KBH1) CP                                               79   FN433932 CBSV-M 42 2007 (M
                                                                                                         a          alawi:Chit...




                                                                                                                                                                          UG, Ken, Mal
     64        FJ821794 CBSV (KBH2) CP




                                                                                                                                           92-95%
               AF311053 CBSV
                                                                                     61
          69   AF311052 CBSV                                                              FN434109 CBSV-Ug 23 (full sequence) 2...




                                                                                                                                                          86-87%
          67   FJ687195 CBSV (GRL03408) pCP
               FJ687193 CBSV (GRL03108) pCP                                          70
     66        FN423418 CBSV-CP (Naliendele-2-Tanzan...                                    FN433930 CBSVKenya 125 1999 (Kenya:K...
               FN423416 CBSV-CP (Naliendele-1 Tanzan...
                                                                                    100




                                                                                                                                                                      70-71%
               AY008441 CBSV (type B) CP
               FN433930 CBSV Kenya 125 1999 (Kenya:K...
                                                                                          FN433931 CBSV-Ke 54 1997 (Kenya:Kilifi)
          95   Sh1.1 U                                                        100
     89        Sh1.4 U
               CBSV-TZ-Short-1
                                                                                          FJ185044. CBSV-Uganda (2006)
          92   CBSV-TZ-Short-2

          61   EU916832 CBSV (BSA4) CP                                                    N 012698 CBSVisolate M full geno...
                                                                                           C                    LB3
               EU916830 CBSV (IGA8) CP

                                                                                                FN434437 CBSV-Tan 70 (full sequence) ...




                                                                                                                                                             79-80%
               EU916827 CBSV (NTG10) CP




                                                                                                                                                                             Tz, Moz
               EU916829 CBSV (LWR2) CP
               EU916828 CBSV (HMA9) CP




                                                                                                                                                    96%
               FN434109 CBSV-Ug 23 (full sequence) 2...
                                                                              100
                                                                                                FN434436 CBSV-M 83 (full sequence) 2...
                                                                                                               o
               DQ837304 CBSV (WKS) pCP

99             DQ837303 CBSV (NAM) pCP
               DQ837302 CBSV (MKN) p                                                      100   GQ329864 CBSV-Tz (full sequence) 200...
          54   Ten11.2 U


          72
               EU916831 CBSV (BSA2) CP
               EU916825 CBSV (MLB3) CP
                                                                                                NC 006941 CVYV
     84        NC 012698
               EU916826 CBSV (MLB9) CP

          84   FN433932 CBSV-Ma 42 2007 (Malawi:Chit...
               FN433933 CBSV Ma 43 2007 (Malawi:Salima)
                                                                           NJ Tree of full-length CBSV genomes
               FN433931 CBSV-Ke 54 1997 (Kenya:Kilifi)
                                                          0.1

                                                                          Sequences from Genebank
               CBSV-TZ-Long-1
               Lg1.1 U
          87   Lg1.3 U
               CBSV-TZ-Long-2
                                                                                                                                                    www.iita.org
Improved diagnostics


CBSV and CMBVs are complex and often necessitates multiple tests.

Cassava brown streak virus
•Sequence information points to divergent types (2 species and several strains?)

Cassava mosaic begomoviruses (CMBVs) in SSA
• African cassava mosaic
• East African cassava mosaic
• East African cassava mosaic Cameroon virus
• East African cassava mosaic Zanzibar virus
• East African cassava mosaic Malawi virus
• East African cassava mosaic Kenya virus
• East African cassava mosaic virus-Uganda
• South African cassava mosaic virus
• Indian cassava mosaic


                                                                      www.iita.org
Simultaneous detection of
                  ACMV and EACMV complex

Primer           Sequence (5’ to 3’)    Length (nts)     Size (bp)
CMBRep/F      CRTCAATGACGTTGTACCA           19
ACMVRep/R     CAGCGGMAGTAAGTCMG             17         368 for ACMV
EACMVRep/R    GGTTTGCAGAGAACTACATC          20         650 for EACMV




         • Detects all CMBs reported in SSA, with
           exception of EACMZV, SACMV, ICMV, SLCMV

                               Alabi et al., 2008
                                                         www.iita.org
Multiplex PCR for simultaneous
ACMV
              EACMCV             detection of CMBV and CBSV

                                          CBSV-S1/S2 + CMB                CBSV-L1/L2 + CMB

                                                                           Sap         DNA&RNA
                ACMV &                       Sap         DNA & RNA
                                         M1 2 3 4 5 6 7 1 2 34 5 6 7 M1 2 3 4 5 6 7 1 2 34 5 6 7 M
                EACMCV
                                EACMV

                                ACMV

                                CBSV



                                                       Lanes 1 to 4: CBSV infected samples
                                                       Lane 5: Healthy cassava
                                                       Lane 6: CMD afffected cassava
Primer name        Sequence (5’ to 3’)                 Lane 7: CBSD affected cassava
                                                       Lane M: Molecular weight marker (100 kb ladder)
CBSVcp-L1     CAGAATAGTGTTGCTGCAGGTAA
CBSVcp-L2     CTACATTATTATCATCTCC


CBSVcp-S1     GCAGGTAAGGCGTTTGTG
CBSVcp-S2     TCTACCAACATTCGCTG
                                                      Kumar et al., 2009
                                                                                          www.iita.org
Ongoing / future priorities

CBSD
• Improvement in diagnostics – NASH and RT-PCR (GLCI)
• Alternative hosts for CBSV (GLCI)
• Impact of CBSV strains on host resistance (GLCI & USAID)
• Understand the causation of root necrosis (GLCI)
• CBSV evolution and within field and location diversity (USAID)
• ELISA-based assays to CBSV (USAID / GLCI)
• Protocol for the production of CBSV-free tissue culture material (GLCI)

CMD and CBSD
• Whitefly management programs as away to reduce disease incidence (IITA
  Strategic grant)

Generic
• Monitoring programs to prevent the spread of CBSD and EACMV-UG spread
  CMGV and CBSV diversity and its impact on host resistance
• Development of dual resistant cassava varieties

                                                                            www.iita.org
Maize virology
  1. Host plant resistance to Maize streak virus

  2. Mechanisms of resistance

  3. High-throughput phenotyping for MSV

 • MSV is restricted to only Africa
 • The most damaging disease of maize in SSA
 • Annual losses, $120 – 480 million
 • Breeding for MSV resistance is integral in our programs




A Menkir and S Hearne
M Salaudeen, O Taiwo, A Razaq
•DTMA and Core funds
                                                                www.iita.org
Screening for MSV resistance




                           6-7 DAS

 Material selection
           1                  0
                                  7
                      60

                      54 Days   after 10
     3
                      48     sowing
                       42
                        36
                             30
                                  14

                                                     9-10 DAS
                                           Inoculation with leaf hoppers


   30 to 50 DAS
Symptom scoring
at weekly intervals
                                               13-14 DAS
                                           First symptoms
                                       (most genotypes have 3-4
                                        days incubation period)
                                                                           www.iita.org
High-throughput phenotyping for MSV


Disease evaluation
0 = No infection or escape
1 = Most resistant (less than 10% streaks)
2 = Resistant (10-25% streaks)
3 = Moderately resistant (25-50% streaks)
4 = Susceptible (50-75% streaks)
5 = Highly susceptible (>75% streaks)



Virus quantification in plants by ELISA




Rep # 1    Rep # 2    Rep # 3     Rep # 4
      Control line
      Test line
                                             S5   S4   S3   S2        S1
                                                            www.iita.org
Good recovery                   Susceptible




                Good recovery
                                              www.iita.org
Performance of maize genotypes
                                                                                                                Group A
                                                                         High recovery
                                                                         5.0
                                                                                                                                             MsvS10




                                                        Severity score
                                                                         4.0
                                                                                                                                             MsvS09
                                                                         3.0
                                                                                                                                             MsvS18
                                                                         2.0
                                                                                                                                             MsvS08
                                                                         1.0
                                                                                                                                             Msv S26
                                                                         0.0
                                                                                                                                             MsvS07
                                                                                           1       2       3           4       5       6
                                                                                                                                             MsvS12
                                               MsvS04                                                          Weeks
                           Group B
                                               MsvS11
                                               MsvS20
        5.0
                                               MsvS03
        4.0
                                               MsvS17
        3.0
score




                                               Msv S30
        2.0
                                               MsvS19
        1.0
                                               MsvS02

                                                                         No recover                                   Group C
        0.0                                    MsvS22
              1   2   3           4   5    6   MsvS06                                                                                        Msv S27
                          Weeks                MsvS01                                6.0                                                     MsvS16
                                               MsvS14                                5.0                                                     MsvS15
Moderate recovery
                                                                          Severity



                                               MsvS24                                4.0
                                                                                                                                             Msv S28
                                                                                     3.0
                                                                                                                                             MsvS13
                                                                                     2.0
                                                                                                                                             MsvS21
                                                                                     1.0
                                                                                                                                             MsvS23
                                                                                     0.0
                                                                                               1       2       3           4       5   6     Msv S25
                                                                                                                                             Msv S29
                                                                                                                   Weeks
                                                                                                                                             Pool 6 control


                                                                                                                                           www.iita.org
Virus concentration vs Severity score
              0.80

              0.60
                                                                    Leaf 1
ODv values




              0.40                                                  leaf 2

                                                                    Leaf 3
              0.20
                                                                 After 6 weeks
              0.00
                           MX10    MX5               MX3   MX4
                     6.0
                     5.0                                          Week 1

                     4.0                                          Week 2
             score




                                                                  Week 3
                     3.0
                                                                  week 4
                     2.0
                                                                  week 5
                     1.0                                          week 6
                     0.0
                           MX10     MX5              MX3   MX4
                 Group       A      B     Genotype
                                                      C     D

                                                                      www.iita.org
Recovery mechanism offers
                                           protection to MSV
          6.0

          5.0

          4.0                                               Group A
                                                            Group B
          3.0
                                                            Group C
          2.0                                               Pool 6 control

          1.0

          0.0
                1      2      3      4     5      6



• No evidence of resistance to leafhopper feeding.
• Incubation period is 3-4 days in genotypes evaluated so far
• Most genotypes showed recover type resistance (reduction in chlorotic
  streaks as well as virus concentration)
• No indication of symptom remission.
• No immunity
                                                                             www.iita.org
MSV resistance in S1 testcrosses

     • Field experiment for incidence, severity and agronomic performance
     • 6 S1 crosses were highly resistant to MSV and good agronomic performance.
     • Resistance is superior to what has been found in MSV transgenics
       (Shepherd et al., 2007)


                        80.0                                                    3.5
                                                67.6
Disease incidence (%)




                        70.0                      3.0                           3
                                         58.3




                                                                                      Disease severity
                                                        2.8
                        60.0                                                    2.5
                                                              2.5
                        50.0 45.0 45.2                              2.1
                                                                          2.0 2.02                       Incidence
                        40.0
                                                                                1.5                      Severity
                        30.0
                        20.0                                                    1
                        10.0                                                    0.5
                        0.0                                                     0
                               1WPI WPI3WPI WPI5WPI6WPI WPI8WPI WPI
                                  2       4              7    9
                                             Time (week)
                        Salaudeen et al., 2010
                                                                                                                     www.iita.org
On-going and future plans



• Further characterization of promising lines and release to farmers
• Augment resistance to MSV in other backgrounds
• Identification of association markers for MSV (DTMA)
• Mechanisms of resistance
• Host-MSV interactions




                                                                   www.iita.org
Yam virology

                        • Diversity and distribution of viruses infecting yams
                          in West Africa
                        • Characterization of YBSD
                        • Development of diagnostic tools
                        • Symptomology and synergistic interactions
                        • Host resistance
                        • Evaluation of mapping population
                        • Virus-free seed systems




R Asiedu and A Sartie
O Patricia, R Ronke, M Toually and S Asala,
•IFAD and Core funds
                                                                          www.iita.org
Virus reported to infect
                                        Dioscorea yams in West Africa

        Virus                                     Distribution              Disease importance
        Yam mosaic virus                          Worldwide                         High
        (YMV; Potyvirus)
        Yam mild mosaic virus                     Worldwide                        High*
        (YMMV; Potyvirus)
        Cucumber mosaic virus                     Worldwide                        High*
        (CMV; Cucumovirus)
        Dioscorea bacilliform viruses (many       Worldwide                        High*
        strains and species) (DBV; Badnavirus)

        Dioscorea sansibarensis bacilliform       Benin                        Not known***
        virus (DsBV; Badnavirus)
        Yam internal brown spot virus             Cote d’Ivory, Benin(?),          High**
        (IBSV; Badnavirus*)                       The Caribbean
        Dioscorea ring mottle virus               Togo                         Not known***
        (DaRMV; Potyvirus)
        Dioscorea mottle virus                    Nigeria                      Not known***
        (DMoV; Comovirus?)


*Often detected in mixed infection; known to have synergistic effect on symptom expression
**Virus-like disease of unknown etiology
***Limited information on virus characters

                                                                                                 www.iita.org
Yam virus diagnostics


• Diagnostic tools established for all major yam
  viruses.
 -Poly and monoclonal antibodies for Yam
 mosaic virus, Yam mild mosaic virus, Yam
 badna viruses available.


-Specific and generic primers for PCR/RT-PCR
  based diagnostics.


-Methods for virus detection in tubers
 established.




                                          www.iita.org
                                                 ©Lava - 09
Yam virus diagnostics &
                  symptomatology

• Uneven distribution of viruses in tubers
• Variation in symptom expression in plants
  germinated from the same tuber.
• Evidence of synergistic interaction
  between YMV and YMMV.




                                        www.iita.org
                                               ©Lava - 09
Evaluation of mapping population
                                                   Virus indexing   Following evaluation
Sl.   Accession
No.   name            Genotype details*            Tuber    Plant
 1    TDr 93-2        Resistant to YMV              Y        ng     -
 2    TDr 1621        Resistant to YMV              Y        ng     -
 3    TDr 1640        Resistant to YMV              Y         Y     Susceptible
 4    TDr 89/ 02665   Resistant to YMV              Y         -     -
 5    TDr 97/ 00777   Highly susceptible to YMV     Y        Y, B   Susceptible
 6    TDr 93-32       Highly susceptible to YMV     Y         Y     Moderately Tolerant (Promising)
 7    TDr 95/ 18531   Susceptible to YMV            Y        Y, B   Susceptible
 8    TDr 747         Susceptible to YMV            Y        Y, B   Susceptible
 9    TDr3661         Susceptible to YMV             -       Y, B   Moderately Tolerant (Promising)
10    TDr 2261        Susceptible to YMV            Y        Y, B   Susceptible
11    TDr 95-127      No information                Y        Y, B   Susceptible
12    TDr 95/ 01932   No information                Y        ng     -
13    TDr 99/ 02789   No information                Y        Y, B   Moderate
14    TDr 98/ 01317   No information                Y        Y, B   Moderately Tolerant (Promising)
15    TDa85/ 00250    Resistant to anthracnose      Y,B      Y, B   Moderately Tolerant (Promising)
16    TDa87/ 01091    Resistant to anthracnose      Y        Y, B   Moderately Tolerant (Promising)
17    TDa95/ 00328    Susceptible to anthracnose   Y, B      Y, B   Tolerant (Recommended
18    TDa95- 310      Susceptible to anthracnose   Y, B      Y, B   Tolerant Recommended
19    TDa92- 2        Susceptible to anthracnose   Y, B      Y, B   Susceptible
20    TDa98/ 01166    No information                Y        Y, B   Tolerant (Recommended)

                                                                                                      www.iita.org
Evaluation of mapping population




                          www.iita.org
Yam brown spot disease (YBSD)
          (Potential CBSD of yam?)

       • A virus-like disease of unknown etiology
         recognized in Cote d’Ivory in early 1980s,
         and in Benin in 2008.

       • Symptoms are similar to the internal
         brown spot disease (IBSD) first reported
         from the Caribbean in mid 1970s.

       • Loss in tuber quality.

       • This can emerge as a serious threat.
B




                                                www.iita.org
                                                       ©Lava - 09
Studies on IBSD etiology


                                1


                                2


                                3
1
                                4
                3

        2                           5




    1       2        3      4           5

                                            www.iita.org
                                                   ©Lava - 09
Studies on IBSD etiology




• Wide spread in Cote d’Ivoire
• Known for about 40 to 60 years




                                                                                     5
                                                                      3


                                                                                4
                                                1



                                                           2
• Bètè-bètè is highly susceptible

                                       Distribution and severity of necrotic symptoms in tuber
                    Tubers                                sections (mean)*
                                                                          4
           No.       No.     Percent     1     2 (apico-      3        (median-
         observed   symp*    symp*     (Top)   median)     (middle)     base)        5 (base)
           178       105       60       3.0      3.0           2.8        2.5          2.1

                                                                                         www.iita.org
Phenotyping yams for
                                                       virus resistance

                                                             •D. rotundata accessions were
                                                             evaluated in 2008-09 season.

                                                             •987 accessions in total (3488
                                                             plants)




Score:
1 = highly resistant (no visible symptoms)
2 = resistant (mild mottling/mosaic on few leaves)
3 = moderately resistant (mild mottling/mosaic on most leaves)
4 = susceptible (severe mottling / mosaic on most leaves)
5 = highly susceptible (severe mosaic/mottling, stunting and distortion)            www.iita.org
Phenotyping yams for
                                                              virus resistance
                        Susceptible 5%
                          (Score 4)
                                          Resistant 7%
Highly susceptible 5%                      (Score 2)
       (Score 5)                                             •There is no immunity or very
                                                             high resistance in these
                                                             germplasm.
 N = 987




                      Moderately resistant 83%
                             (Score 3)




Score:
1 = highly resistant (no visible symptoms)
2 = resistant (mild mottling/mosaic on few leaves)
3 = moderately resistant (mild mottling/mosaic on most leaves)
4 = susceptible (severe mottling / mosaic on most leaves)
5 = highly susceptible (severe mosaic/mottling, stunting and distortion)            www.iita.org
Next steps



• Determine the diversity of viruses in West Africa and improve diagnostic
  tools
• Understand the etiology of YBSD
• Symptomology and yield losses
• Evaluation of mapping population for YMV
• Virus-free seed systems




                                                                       www.iita.org
Soybean virology

                        • Baseline studies to assess the impact of
                          virus diseases on soybean

                        • Evaluation of improved varieties and
                          breeding lines against
                          widespread/economically important
                          viruses.

                        • Monitor seed stocks and eliminate virus
                          contaminated seed.



H Tefera, C Fatokun,
T Imbor, R Adesida and P Ogunsanya
•TL2 and Core funds
                                                              www.iita.org
Baseline studies in Nigeria
     Virus                       Abbreviation    Genus           Vectors
1    Bean pod mottle             BPMV            Comovirus       Beatles
2    Black eye cowpea mosaic     BICMV           Potyvirus       Aphids
3    Cowpea aphid-borne mosaic   CABMV           Potyvirus       Aphids
4    Cowpea mottle               CMeV            Carmovirus      Beatles
5    Cowpea yellow mosaic        CYMV            Comovirus       Beatles
6    Cucumber mosaic             CMV             Cucumovirus     Aphids
7    Cowpea severe mosaic        CpSMV           Comovirus       Beatles
8    Cowpea mild mottle          CPMMV           Carlavirus      Whiteflies
9    Southern bean mosaic        SBMV            Sobemovirus     Beatles
10   Tobacco streak              TSV             Nepovirus       Nematodes
11   Soybean mosaic              SMV             Potyvirus       Aphids
12   Soybean chlorotic blotch*   SbCBV           Begomovirus     Whiteflies
13   Soybean mild mottle*        SbMMV           Begomovirus     Whiteflies
14   Cassava mosaic virus**      CMD             Begomovirus     Whiteflies



      *New viruses; **New report                Ezeri et al., 2009
                                                                              www.iita.org
www.iita.org
2.7


                                      2.5
                                                          3.4
                            3.9             3.8
            3.3
                                                          3.4


      3.3                                         3.7
                      4.2
3.2                           4.1
                  3
                                                    4.5
                                  4




                                                                www.iita.org
Virus incidence in various states


                  120

                  100
    % infection




                   80

                   60

                   40

                   20

                    0




                                                  Ba u
                             a




                                              A d un a
                                                 Ka a
                       e




                                         yo




                                                         hi
                                                          o
                                                 Ka o



                                                          a

                                                         er




                                                 pl a
                                              as CT



                                                         a
                                   gi




                                                      ea
                              b




                                                        w



                                                        n



                                                     aw
                    nu




                                                       rn
                                                       in




                                                       ar



                                                     uc
                                  Ko




                                                      ig
                                        O
                           ra




                                                    Ka
                                                    ra
                                                     F



                                                    ts




                                                   Bo

                                                  Kw
                                                    d
                   Be




                                                   at
                                                   N
                                                 am
                        Ta




                                                 sa
                                              N




                                                  State



•Virus incidence exceed 50% in 13 of the 15 states (87%) surveyed

                                                                    www.iita.org
Relative abundance of viruses in Nigeria

                CpSMV
                BICMV
                  SMV
                CpSMV
                  TSV
        Virus




                 BPMV
                 SBMV
                 CMeV
                 CYMV
                  CMV
                CABMV
                CPMMV

                        0   20   40       60       80   100   120
                                      Proportion




Imbor et al., 2010
                                                                    www.iita.org
Relative abundance of viruses in
                                      latent infections


            0.7 CMeV
            1.5 BPMV
            1.5 CABMV
virus



            2        CYMV
             4        TSV
                 9    CMV
                                            CPMMV         99
                                           Total = 166     100


        0             20    40      60      80           100
                             % infection




                                                                 www.iita.org
Distribution of viruses in Nigeria

Agro-ecological zone   State       Viruses present                                        Total
Derived Sav            Benue       CPMMV,CABMV,CMV,CYMV, SBMV, BPMV, CMeV, TSV, SMV         9
                       Taraba      CPMMV, CMV, CYMV, BPMV, CMeV, TSV,SMV                    7
                       Kogi        CPMMV                                                    1
                       Oyo         CPMMV, CMV                                               2
                       FCT         CPMMV, CMV, BPMV, CMeV, TSV, CpSMV,SMV                   7
                       Nassarawa   CPMMV, CMV, BPMV,SMV                                     4
Sud/Sahel/N.G.Sav      Katsina     CPMMV                                                    1
                       Kano        CPMMV, CABMV, CMV                                        3
                       Kaduna      CPMMV, CMV, BPMV                                         3
Sud/ South G.Sav       Adamawa     CPMMV                                                    1
                       Niger       CPMMV                                                    1
                       Borno       CPMMV                                                    1
                       Kwara       CPMMV, CMV                                               2
Mid-Altitude, Sud/D.
Sav                    Plateau     CPMMV, CABMV, CMV, BPMV                                  4
                       Bauchi      CPMMV                                                    1

                                                                                      www.iita.org
New whitefly-transmitted
                     begomoviruses in soybean
                             [Legumoviruses]


                       •Soybean chlorotic blotch virus (SbCBV)
                       •Soybean mild mottle virus (SbMMV)
                       •Begomoviruses (legumogroup)
                       •Novel types within features of both new
                       world and old world begomoviruses




Alabi et al., 2010
                                                       www.iita.org
Novel features
                                    CRA                                                      CRB



      AC4
    (2117…2410)
                                                                    AV1
                                                                  (260…1021)

                                                                                              SbCBV
                                 SbCBV
                                                                                             2647 bp      BV1
                                2708 bp                 AC5                    BC1
                                                                                                        (373…1158)

     AC1                                            (701…995)
                                                                         (1219…2310)
  (1479…2567)


                                         AC3
                                     (1018…1431)




                              AC2
                           (1163…1579)
                                                                                First bipartite legumoviruses
                                                                                that lack AV2 gene;
                                    IR



                                               V2
                                              (1…507)
                    C4
                              SbMMV
                  (2198…25)


                              2768 bp                              V1
   C1
                                                                                       First monopartite legumovirus
                                                                (299…1072)
(1563…2612)


                                         C3
                                   (1069…1473)
                      C2
                  (1187…1624)




                                                                                                                       www.iita.org
96    AYVV       AJ558120
                                                                                                                                                                             100   CoTSV      DQ875869
                                                         57          SbCLV      AB050781                                                                               68          SiYMYuV    DQ875873
                                                   77                AYVHuV     DQ866124
                                                                                                                                                                                   SiGMV      AF0841
                                                                     TbLCYnV    AJ512761                                                                         80
                                             86                                                                                                                                    AbMV       X15984
                                                                     ToLCMYV    AF327436
                                                                                                                                                                                   ToMHV      Y14875
                                                                     StaLCuV    AJ810156
                                       80
                                                                     EpYVV      AB007990     Asia                                               100                                ToMoTV
                                                                                                                                                                                   ToMoV
                                                                                                                                                                                              AF012301
                                                                                                                                                                                              AY965901
                                                                     VeYVV      AM182232                                                                                     97
                                                                                                                                                                                   BDMV       M88180
                                             81                66    PepLCV     AF134484
                                 61                                                                                                                                                ToLCSinV   AJ508783
                                                   69                TYLCCNV    AJ319675                                                              79
                                                                                                                                           89                                      CdTV       AF101478
                                                                     ToLCTWV    DQ866125                                                                   55
                                                         95          ToLCVV     DQ641705                                                                                           SiGMCRV    X99551
                                                                                                                                                                 67
                                                                     AYVSLV     AF314144                                                                                           SiGMHV     Y11098
                                                                                                                                                                       99
                                                               92    ChiLCV     DQ6759                                                                                       100   SiYVV      Y11100-1
                                                                     ToLCBDV    AF188481                                                                                           CLCrV      AF480941
                           86                99
                                                                     AEV        AJ437618                                                                                           DesLDV     DQ875871
                                                   99                                                                                                            85
                                                                     CYVMV      AJ507777                                                                                           PYMPV      Y15033
                                                                                                                                                                       99
                                                         85          PaLCuV     Y15934                                                                                       100   PYMV       D00941
                                                              100
                                                                     ToLCNDV    DQ169056     India                                                                            73   BGMV
                                                                                                                                                                                   TGMV
                                                                                                                                                                                              M88687
                                                                                                                                                                                              K02030
                                                              100    ICMV       Z24758
                                                                     SLCMV      AJ579307                                                                                     99    SiMMV      AJ5573
               100                                                                                                                                                                 ToRMV      AF291706




                                                                                                                                                                                                         New World
                                                                     CLCuBV     AY7050
                                                   55




                                                                                                                     Old World
                                                                     BYVMV      AF241479                                                                               97          SiMoV      AJ5574
                                                        100          OYVMV      AJ0021                                                                                       100   ToYSV      DQ336351
                                                              100
                                                                     CLCuGV     AF155064                                                                                      70   BGYMV      AF173556
                                                        100   100                                                                                                      55
                                                                     CLCUGV     EU024120                                                                                           MaYMFV     AY044136
                                                                     HoLCrV     AY036009                                              56                                           MaMPRV     AY044134
                                                                     ACMV       X17095                                                                                             DiYMoV     AF170101
                                                                     TLCuKV     EU350585                                                                                           MeMV       AY965899
                     92                                        75    TbLCZV     AF350330                                                                                           TYMLCV     AY508994
                                                         85          ToCSV      AF261885                                                                                     99    PHYVV      AY044163
                           75                      88                ToYLCrV    AY502935                                                                                           RhGMV      DQ356429
                                             59                      ChaYMV     AJ223191                                                                                     100   CabLCuJV   DQ178609
          66                                                                                                                                                     61
                                       93                            OYLCrV     EU024119                                                                                           CabLCuV    U65530
                                 76
                                                               86
                                                                     ToLCMLV    AY502936     Africa                              55                                    61          PepGMV     AY928517
                                                                     ToLCArV    DQ519575                                                                                     76    RhGMSV     DQ6673
                                                              100    TYLCMalV   AF271234                                                                                     82    BCaMV      AF110190
                                                                     TYLCMLV    FM212660                                                                                           EuMV       DQ3189
                                                               97    EACMCV     AF112354                                                                                           CuLCrV     AF327559
                                                         91                                                                                                      82
                                                                     EACMV      AJ717542                                                                                           MCLCuV     AF4790
     75                                      56                      EACMMV     AJ0060                                                                                 97          SLCV       M182
                                                                     SACMV      AF155806                                                                                     100   SMLCV      AF421553
                                                  100                EACMKV     AJ717580                                                                                           ToCMoV     AF491306
                                                               97    EACMZV     AJ717562             ‘Legumovirus’                                                                 CoGMV      DQ641689
                                                                                           Africa


                                                                     CPGMV      AF029217                                                                                     100   CoYVV      AY727904
                                                                     SbCBV      GQ472985                                                                                     100   SLCCNV     AF509742
                                                        100          SbCBV      GQ472987                                                                               98          SLCPHV     AB085794
                                                              100
                                                                     SbMMV      GQ472984                                                                         100               LYMV       AF5097
98
                                                                     DoYMV      AY309241                                                                                           ToLCGV     AY190291
                                                                                                                                                           100
                                 99                                  KuMV       DQ641690                                                                                     100   ToLCNDV    DQ169057
                                                                                           Asia




                                       66                            RhYMV      FM208848                                                                                           ICMV       Z24759
                                                                                                                                                      99
                                            100                      MYMIV      AY049772                                                                                           SLCMV      AJ579308
                                                                                                                                                                             100
                                                   96                HgYMV      AJ627904                                                                                           ClCMV      DQ641693
                                                        100          MYMV       AJ421642
                                                               95                                                                                                                  PepLCIV    AB2678
                                                                     CoYVV      AY727903                                                                         100
                                                               100
                                                                     CoGMV      DQ641688     Jute                                                                      100
                                                                                                                                                                             100
                                                                                                                                                                                   TYLCKaV
                                                                                                                                                                                   TYLCTHV
                                                                                                                                                                                              DQ169055
                                                                                                                                                                                              X63016
                                                                     DiYMoV     AF1168                                                                                       100   HgYMV      AJ627905
                          100                                 100    PepGMV     AY928516                                                                               100
                                                                                                                     New World

                                                                                                                                           97                                      MYMV       AJ867554




                                                                                                                                                                                                         Old World
                                                                     SLCV       M183                                                                             100               MYMIV      AY049771
                                100
                                       60
                                                                     BGMV       M88686       Americas                                                      99                      KuMV       DQ641691
                                                                     BDMV       M88179                                                                                             RhYMV      FM208848
                                                                                                                                                                             56
                                             81                      CdTV       AF101476                                                                                           ACMV       X17096
                                                  100                ToMoV      AY965900                                                                                     100   SbCBV      GQ472986
                                                         91          SiGMV      AF049336                                                        99
                                                              100                                                                                                                  SbCBV      GQ472988
                                                                     SPLCESV    EF6741                                                                                             WmCSV      AJ2653
                                                                     SPLCGV     AF326775                                                              95
                                                                                                                                                                                   EACMCV     AF112355
                                      100                            SPLCCaV    EF6742                                                                     100                     EACMV      AJ704949
                                             99
                                                   68
                                                                     SPLCLaV
                                                                     IYVV
                                                                                EF67
                                                                                AJ132548
                                                                                             Sweet potato                                                        100               EACMZV     AJ704942
                                                                                                                                                                       100         EACMKV     AJ704965
                                                         61
                                                              100
                                                                     SPLCV
                                                                     BSCTV
                                                                                AJ586885
                                                                                U02311
                                                                                                                                                                             66    SACMV
                                                                                                                                                                                   BSCTV
                                                                                                                                                                                              www.iita.org
                                                                                                                                                                                              AF155807
                                                                                                                                                                                              U02311
Search for resistance to CPMMV
    TGX 1448-2E   TGX1903-1F    TGX1951-4E
    TGX1440-1E    TGX1903-3F    TGX1954-1F
    TGX1485-ID    TGX1904-4F    TGX1955-4F
    TGX1740-2F    TGX1904-6F    TGX1956-1F
    TGX1830-20E   TGX1908-8F    TGX1961-1F
    TGX1835-10E   TGX1910-14F   TGX1963-3F
    TGX1844-18E   TGX1932-1F    TGX1965-7F
    TGX1844-4E    TGX1935-3F    TGX1971-1F
    TGX1869-31E   TGX1937-1F    TGX1972-1F
    TGX1871-12F   TGX1945-1F    TGX1987-10F
    TGX1876-4E    TGX1949-7F    TGX1987-14F
    TGX1889-12F   TGX1950-7F    TGX1987-43F
    TGX1895-33F   TGX1951- 3F   TGX1987-57F
    TGX1895-50F                 TGX1987-62F
                                TGX1987-8F


 •47 elite lines evaluated in screenhouse
 •No immunity, variation in susceptibility
 •Activity in progress
                                              www.iita.org
Soybean reaction to CPMMV

               250

               200
No. of seeds




               150

               100

               50

                0
                     1   3   5   7   9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43

         Control                                          Accessions
                                                   (8 plants per accession)
                         Susceptible check




                                                                                    www.iita.org
Disease of unknown etiology



     • Virus-like disease of
       unknown etiology.
     • Extreme reduction in
       leaf lamina, stunting of
       plant and thickening of
       stems.
     • African soybean dwarf?




                               www.iita.org
New soybean disease in
                                   Southern Africa

•Incidence of soybean phyllody was high in Mozambique (15-25%)




Virus disease incidence was very low in Southern Africa
•Low incidence
•CPMMV and SMV detected in few fields
                                                             www.iita.org
Next steps


• Evaluation of soybean genotypes for resistance to
  abundant viruses (CPMMV, SMV, CMV, BPMV, CABMV)

• Characterization of soybean phyllody

• Diagnostics for common soybean viruses

• Characterization of new soybean infecting viruses




                                                      www.iita.org
Cowpea virology

                               Focus:
                               • Evaluation of germplasm
                                 (landraces / improved varieties)
                                 for resistance to viruses
                                [adding value to drought and striga
                                resistance; earliness etc.]
                               • Breeding for multiple virus
                                 resistance

                               • Establishment of virus-free cowpea
                                 seed stocks


C Fatokun, B Ousman
K Ogunsola, R Adesida, P Ogunsanya
Core and TL2
                                                               www.iita.org
Important viruses of
                                    cowpea in West Africa

               Virus              Abbreviation       Genus       Vector

1   Blackeye cowpea mosaic        BlCMV           Potyvirus    Aphids

2   Cowpea aphid-borne mosaic     CABMV           Potyvirus    Aphids

3   Cucumber mosaic               CMV             Cucumovirus Aphids

4   Cowpea mottle                 CMeV            Carmovirus   Beetles

5   Cowpea mosaic                 CPMV            Comovirus    Beetles

6   Southern bean mosaic          SBMV            Sobemovirus Beetles

7   Cowpea mild mottle            CMMV            Carlavirus   Whiteflies
        *All these viruses are seed transmitted

       Viruses of minor importance (sporadic incidence):
       Bean pod mottle virus; Peanut mottle; Sunn-hemp mosaic;
       Cowpea golden mosaic; Cowpea severe mosaic virus
                                                                        www.iita.org
Distribution of cowpea infecting
  viruses in West Africa in 2008




                         www.iita.org
Cowpea virus diversity and distribution

                       1978 samples from 166 sites from 5 countries (2008-09)
                                                              Ghana and Togo
                  45
                                                                   (N=639)
                  40
                       Nigeria (N=833)
                  35
     %Infection




                  30
                  25
                  20                      Benin and Mali
                                             (N=899)
                  15
                  10
                  5
                  0




                                                                 CAbMV
                           CAbMV




                                              CAbMV




                                                                CPMMV
                          CPMMV




                                          Mixed infect
                            CPMV




                                             CPMMV




                                                                  CPMV
                                                                 BlCMV
                           BlCMV




                                               CPMV




                                                             Mixed infect
                            SBMV




                                                                  SBMV
                              CMV




                                                                    CMV
                            CMeV




                                              BlCMV




                                                                  CMeV
                                               SBMV
                                                CMV

                                               CMeV
                       Mixed infec




•   Present situation is not significantly different from a decade ago.
•   Virus equation remains same: CABMV > BlCMV > CPMV > SBMV > CMoV > CMV
                                                                                www.iita.org
Cowpea viruses in
  southern Africa


   • Severe incidence in
     Mozambique

   • Detected: BlCMV,
     CpSMV, CMV, CABMV,
     SBMV

   • Evidence of new
     strains / species




                    www.iita.org
Screening elite lines for
       virus resistance




                   www.iita.org
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops
Winning against virus threats to African food crops

Más contenido relacionado

La actualidad más candente

Central & West Asia and North Africa: Where Wheat Improvement Matters
Central & West Asia and North Africa:  Where Wheat Improvement MattersCentral & West Asia and North Africa:  Where Wheat Improvement Matters
Central & West Asia and North Africa: Where Wheat Improvement MattersCIMMYT
 
A Bianchini
A BianchiniA Bianchini
A BianchiniMonsanto
 
Manejo pós-colheita e beneficiamento do algodão
Manejo pós-colheita e beneficiamento do algodãoManejo pós-colheita e beneficiamento do algodão
Manejo pós-colheita e beneficiamento do algodãoGeagra UFG
 
Insect-damaged wheat: suni bug, cereal bug, sunn pest, wheat bug, shield bug,...
Insect-damaged wheat: suni bug, cereal bug, sunn pest, wheat bug, shield bug,...Insect-damaged wheat: suni bug, cereal bug, sunn pest, wheat bug, shield bug,...
Insect-damaged wheat: suni bug, cereal bug, sunn pest, wheat bug, shield bug,...Milling and Grain magazine
 
2015. Le Huy Ham. The cassava revolution in Vietnam
2015. Le Huy Ham. The cassava revolution in Vietnam2015. Le Huy Ham. The cassava revolution in Vietnam
2015. Le Huy Ham. The cassava revolution in VietnamFOODCROPS
 
Bt cotton in india and regulatory regime
Bt cotton in india and regulatory regimeBt cotton in india and regulatory regime
Bt cotton in india and regulatory regimeDR VIJENDRA SANGAM
 
Progress in cowpea cultivation, improvement, and storage in burkina faso from...
Progress in cowpea cultivation, improvement, and storage in burkina faso from...Progress in cowpea cultivation, improvement, and storage in burkina faso from...
Progress in cowpea cultivation, improvement, and storage in burkina faso from...Tropical Legumes III
 
B4FA 2012 Tanzania: Marker-assisted selection in cassava production - Esther ...
B4FA 2012 Tanzania: Marker-assisted selection in cassava production - Esther ...B4FA 2012 Tanzania: Marker-assisted selection in cassava production - Esther ...
B4FA 2012 Tanzania: Marker-assisted selection in cassava production - Esther ...b4fa
 

La actualidad más candente (11)

Anticipated Impact of Modern Biotechnology on Nutrient Use Efficiency
Anticipated Impact of Modern Biotechnology on Nutrient Use EfficiencyAnticipated Impact of Modern Biotechnology on Nutrient Use Efficiency
Anticipated Impact of Modern Biotechnology on Nutrient Use Efficiency
 
Central & West Asia and North Africa: Where Wheat Improvement Matters
Central & West Asia and North Africa:  Where Wheat Improvement MattersCentral & West Asia and North Africa:  Where Wheat Improvement Matters
Central & West Asia and North Africa: Where Wheat Improvement Matters
 
A Bianchini
A BianchiniA Bianchini
A Bianchini
 
Manejo pós-colheita e beneficiamento do algodão
Manejo pós-colheita e beneficiamento do algodãoManejo pós-colheita e beneficiamento do algodão
Manejo pós-colheita e beneficiamento do algodão
 
Insect-damaged wheat: suni bug, cereal bug, sunn pest, wheat bug, shield bug,...
Insect-damaged wheat: suni bug, cereal bug, sunn pest, wheat bug, shield bug,...Insect-damaged wheat: suni bug, cereal bug, sunn pest, wheat bug, shield bug,...
Insect-damaged wheat: suni bug, cereal bug, sunn pest, wheat bug, shield bug,...
 
2015. Le Huy Ham. The cassava revolution in Vietnam
2015. Le Huy Ham. The cassava revolution in Vietnam2015. Le Huy Ham. The cassava revolution in Vietnam
2015. Le Huy Ham. The cassava revolution in Vietnam
 
Smokey Alley v. Monsanto
Smokey Alley v. MonsantoSmokey Alley v. Monsanto
Smokey Alley v. Monsanto
 
Bt cotton in india and regulatory regime
Bt cotton in india and regulatory regimeBt cotton in india and regulatory regime
Bt cotton in india and regulatory regime
 
Progress in cowpea cultivation, improvement, and storage in burkina faso from...
Progress in cowpea cultivation, improvement, and storage in burkina faso from...Progress in cowpea cultivation, improvement, and storage in burkina faso from...
Progress in cowpea cultivation, improvement, and storage in burkina faso from...
 
B4FA 2012 Tanzania: Marker-assisted selection in cassava production - Esther ...
B4FA 2012 Tanzania: Marker-assisted selection in cassava production - Esther ...B4FA 2012 Tanzania: Marker-assisted selection in cassava production - Esther ...
B4FA 2012 Tanzania: Marker-assisted selection in cassava production - Esther ...
 
Increasing Crop Productivity in the West African Savannas: Experiences from n...
Increasing Crop Productivity in the West African Savannas: Experiences from n...Increasing Crop Productivity in the West African Savannas: Experiences from n...
Increasing Crop Productivity in the West African Savannas: Experiences from n...
 

Destacado

Biotechnology ammeriolation for viral diseases
Biotechnology ammeriolation for viral diseasesBiotechnology ammeriolation for viral diseases
Biotechnology ammeriolation for viral diseaseswani amir
 
Th1_Canopy temperature as field phenotyping trait for rainfed-lowland rice br...
Th1_Canopy temperature as field phenotyping trait for rainfed-lowland rice br...Th1_Canopy temperature as field phenotyping trait for rainfed-lowland rice br...
Th1_Canopy temperature as field phenotyping trait for rainfed-lowland rice br...Africa Rice Center (AfricaRice)
 
Arti penting karantina tumbuhan
Arti penting karantina tumbuhanArti penting karantina tumbuhan
Arti penting karantina tumbuhanWahono Diphayana
 
Improvement of Banana and Plantain in West and Central Africa
Improvement of Banana and Plantain in West and Central AfricaImprovement of Banana and Plantain in West and Central Africa
Improvement of Banana and Plantain in West and Central AfricaExternalEvents
 
Certificación Orgánica Paso a Paso
Certificación Orgánica Paso a PasoCertificación Orgánica Paso a Paso
Certificación Orgánica Paso a Pasoaaoch
 
How to deal with complex virus disease problems
How to deal with complex virus disease problems How to deal with complex virus disease problems
How to deal with complex virus disease problems Senthil Natesan
 
RNA silencing for broad spectrum virus resistance in plants
RNA silencing for broad spectrum virus resistance in plantsRNA silencing for broad spectrum virus resistance in plants
RNA silencing for broad spectrum virus resistance in plantsDr. Geetanjali Baruah
 
Cacao orgánico
Cacao orgánicoCacao orgánico
Cacao orgánicoGUELFI
 
Pest and diseases of cocoa (presentation)
Pest and diseases of cocoa (presentation)Pest and diseases of cocoa (presentation)
Pest and diseases of cocoa (presentation)Biela Ngah
 
Diseases And Pests Of Pre Harvest Cocoa
Diseases And Pests Of  Pre Harvest CocoaDiseases And Pests Of  Pre Harvest Cocoa
Diseases And Pests Of Pre Harvest CocoaDENNIS90
 
Pests of cocoa ( Theobroma cacao)
Pests of cocoa ( Theobroma cacao)Pests of cocoa ( Theobroma cacao)
Pests of cocoa ( Theobroma cacao)Sam raj
 
Plant Viruses Diseases and Symptoms
Plant Viruses Diseases and SymptomsPlant Viruses Diseases and Symptoms
Plant Viruses Diseases and SymptomsZohaib Hassan
 
Banana plant deficiency symptoms and corrective measures [compatibility mode]
Banana plant deficiency symptoms and corrective measures [compatibility mode]Banana plant deficiency symptoms and corrective measures [compatibility mode]
Banana plant deficiency symptoms and corrective measures [compatibility mode]Rahul Mane
 
Plant tissue culture techniques of Banana
Plant tissue culture techniques of BananaPlant tissue culture techniques of Banana
Plant tissue culture techniques of BananaLoyola College
 

Destacado (20)

Biotechnology ammeriolation for viral diseases
Biotechnology ammeriolation for viral diseasesBiotechnology ammeriolation for viral diseases
Biotechnology ammeriolation for viral diseases
 
Th1_Canopy temperature as field phenotyping trait for rainfed-lowland rice br...
Th1_Canopy temperature as field phenotyping trait for rainfed-lowland rice br...Th1_Canopy temperature as field phenotyping trait for rainfed-lowland rice br...
Th1_Canopy temperature as field phenotyping trait for rainfed-lowland rice br...
 
Update on Cassava Brown Streak Disease (CBSD) Status, prospects and implicati...
Update on Cassava Brown Streak Disease (CBSD) Status, prospects and implicati...Update on Cassava Brown Streak Disease (CBSD) Status, prospects and implicati...
Update on Cassava Brown Streak Disease (CBSD) Status, prospects and implicati...
 
Arti penting karantina tumbuhan
Arti penting karantina tumbuhanArti penting karantina tumbuhan
Arti penting karantina tumbuhan
 
Improvement of Banana and Plantain in West and Central Africa
Improvement of Banana and Plantain in West and Central AfricaImprovement of Banana and Plantain in West and Central Africa
Improvement of Banana and Plantain in West and Central Africa
 
BBTV in sub-Saharan Africa: Status and Needs
BBTV in sub-Saharan Africa: Status and NeedsBBTV in sub-Saharan Africa: Status and Needs
BBTV in sub-Saharan Africa: Status and Needs
 
Certificación Orgánica Paso a Paso
Certificación Orgánica Paso a PasoCertificación Orgánica Paso a Paso
Certificación Orgánica Paso a Paso
 
How to deal with complex virus disease problems
How to deal with complex virus disease problems How to deal with complex virus disease problems
How to deal with complex virus disease problems
 
RNA silencing for broad spectrum virus resistance in plants
RNA silencing for broad spectrum virus resistance in plantsRNA silencing for broad spectrum virus resistance in plants
RNA silencing for broad spectrum virus resistance in plants
 
Cacao orgánico
Cacao orgánicoCacao orgánico
Cacao orgánico
 
Viral diseases management in plants.
Viral diseases management in plants.Viral diseases management in plants.
Viral diseases management in plants.
 
Pest & disease of Cocoa
Pest & disease of CocoaPest & disease of Cocoa
Pest & disease of Cocoa
 
Pest and diseases of cocoa (presentation)
Pest and diseases of cocoa (presentation)Pest and diseases of cocoa (presentation)
Pest and diseases of cocoa (presentation)
 
Diseases And Pests Of Pre Harvest Cocoa
Diseases And Pests Of  Pre Harvest CocoaDiseases And Pests Of  Pre Harvest Cocoa
Diseases And Pests Of Pre Harvest Cocoa
 
Pests of cocoa ( Theobroma cacao)
Pests of cocoa ( Theobroma cacao)Pests of cocoa ( Theobroma cacao)
Pests of cocoa ( Theobroma cacao)
 
Plant Viruses Diseases and Symptoms
Plant Viruses Diseases and SymptomsPlant Viruses Diseases and Symptoms
Plant Viruses Diseases and Symptoms
 
Plagas de cacao
Plagas de cacao Plagas de cacao
Plagas de cacao
 
Banana plant deficiency symptoms and corrective measures [compatibility mode]
Banana plant deficiency symptoms and corrective measures [compatibility mode]Banana plant deficiency symptoms and corrective measures [compatibility mode]
Banana plant deficiency symptoms and corrective measures [compatibility mode]
 
Banana diseases
Banana diseasesBanana diseases
Banana diseases
 
Plant tissue culture techniques of Banana
Plant tissue culture techniques of BananaPlant tissue culture techniques of Banana
Plant tissue culture techniques of Banana
 

Similar a Winning against virus threats to African food crops

121003 modern agril and erosion of diversity
121003 modern agril and erosion of diversity121003 modern agril and erosion of diversity
121003 modern agril and erosion of diversityRamanjaneyulu GV
 
Cassava Weed Management Project Progress Presentation
Cassava Weed Management Project Progress PresentationCassava Weed Management Project Progress Presentation
Cassava Weed Management Project Progress PresentationCassava Matters
 
Modelling crop sequences: a new approach. Roger Lawes
Modelling crop sequences: a new approach. Roger LawesModelling crop sequences: a new approach. Roger Lawes
Modelling crop sequences: a new approach. Roger LawesJoanna Hicks
 
CIMMYT breeding strategies and methodologies to breed high yielding, yellow r...
CIMMYT breeding strategies and methodologies to breed high yielding, yellow r...CIMMYT breeding strategies and methodologies to breed high yielding, yellow r...
CIMMYT breeding strategies and methodologies to breed high yielding, yellow r...ICARDA
 
Genetic diversity of common beans as impacted on By farmer variety selection ...
Genetic diversity of common beans as impacted on By farmer variety selection ...Genetic diversity of common beans as impacted on By farmer variety selection ...
Genetic diversity of common beans as impacted on By farmer variety selection ...CIAT
 
Management of SPVD: A model for production, multiplication and delivery of cl...
Management of SPVD: A model for production, multiplication and delivery of cl...Management of SPVD: A model for production, multiplication and delivery of cl...
Management of SPVD: A model for production, multiplication and delivery of cl...ILRI
 
Mike Bushell - Threats to Food Security and Food Chain Livelihoods from Weeds...
Mike Bushell - Threats to Food Security and Food Chain Livelihoods from Weeds...Mike Bushell - Threats to Food Security and Food Chain Livelihoods from Weeds...
Mike Bushell - Threats to Food Security and Food Chain Livelihoods from Weeds...Global Risk Forum GRFDavos
 

Similar a Winning against virus threats to African food crops (20)

121003 modern agril and erosion of diversity
121003 modern agril and erosion of diversity121003 modern agril and erosion of diversity
121003 modern agril and erosion of diversity
 
Cassava Weed Management Project Progress Presentation
Cassava Weed Management Project Progress PresentationCassava Weed Management Project Progress Presentation
Cassava Weed Management Project Progress Presentation
 
Cassava Weed Management Project Progress Presentation
Cassava Weed Management Project Progress PresentationCassava Weed Management Project Progress Presentation
Cassava Weed Management Project Progress Presentation
 
Modelling crop sequences: a new approach. Roger Lawes
Modelling crop sequences: a new approach. Roger LawesModelling crop sequences: a new approach. Roger Lawes
Modelling crop sequences: a new approach. Roger Lawes
 
CIMMYT breeding strategies and methodologies to breed high yielding, yellow r...
CIMMYT breeding strategies and methodologies to breed high yielding, yellow r...CIMMYT breeding strategies and methodologies to breed high yielding, yellow r...
CIMMYT breeding strategies and methodologies to breed high yielding, yellow r...
 
Genetic diversity of common beans as impacted on By farmer variety selection ...
Genetic diversity of common beans as impacted on By farmer variety selection ...Genetic diversity of common beans as impacted on By farmer variety selection ...
Genetic diversity of common beans as impacted on By farmer variety selection ...
 
Management of SPVD: A model for production, multiplication and delivery of cl...
Management of SPVD: A model for production, multiplication and delivery of cl...Management of SPVD: A model for production, multiplication and delivery of cl...
Management of SPVD: A model for production, multiplication and delivery of cl...
 
testing of a bioherbiode technology for Striga control
testing of a bioherbiode technology for Striga controltesting of a bioherbiode technology for Striga control
testing of a bioherbiode technology for Striga control
 
Agriculture and food security dimentions of aflatoxin
Agriculture and food security dimentions of aflatoxinAgriculture and food security dimentions of aflatoxin
Agriculture and food security dimentions of aflatoxin
 
Breeding Staple Crops
Breeding Staple CropsBreeding Staple Crops
Breeding Staple Crops
 
Exploring best options for the inclusion of rural poor in cassava value chain...
Exploring best options for the inclusion of rural poor in cassava value chain...Exploring best options for the inclusion of rural poor in cassava value chain...
Exploring best options for the inclusion of rural poor in cassava value chain...
 
Breeding by integrative design for making more productive, resilient and cons...
Breeding by integrative design for making more productive, resilient and cons...Breeding by integrative design for making more productive, resilient and cons...
Breeding by integrative design for making more productive, resilient and cons...
 
The seed sector in Vietnam- Nguyen Mau Dung
The seed sector in Vietnam- Nguyen Mau DungThe seed sector in Vietnam- Nguyen Mau Dung
The seed sector in Vietnam- Nguyen Mau Dung
 
Access to Venture Capital fund for small enterprises
Access to Venture Capital fund  for small enterprisesAccess to Venture Capital fund  for small enterprises
Access to Venture Capital fund for small enterprises
 
3.1 session by hershey
3.1 session by hershey   3.1 session by hershey
3.1 session by hershey
 
Strategies for enhancing technology adoption potential
Strategies for enhancing technology adoption potentialStrategies for enhancing technology adoption potential
Strategies for enhancing technology adoption potential
 
Narrowing the Crop Yield Gap through Better Agronomy & Plant Health Management
Narrowing the Crop Yield Gap through Better Agronomy & Plant Health ManagementNarrowing the Crop Yield Gap through Better Agronomy & Plant Health Management
Narrowing the Crop Yield Gap through Better Agronomy & Plant Health Management
 
Iita yam breeding 2005-2015
Iita yam breeding 2005-2015Iita yam breeding 2005-2015
Iita yam breeding 2005-2015
 
Mike Bushell - Threats to Food Security and Food Chain Livelihoods from Weeds...
Mike Bushell - Threats to Food Security and Food Chain Livelihoods from Weeds...Mike Bushell - Threats to Food Security and Food Chain Livelihoods from Weeds...
Mike Bushell - Threats to Food Security and Food Chain Livelihoods from Weeds...
 
Assessment of genetic diversity among Rwandan cassava (Manihot esculenta) ger...
Assessment of genetic diversity among Rwandan cassava (Manihot esculenta) ger...Assessment of genetic diversity among Rwandan cassava (Manihot esculenta) ger...
Assessment of genetic diversity among Rwandan cassava (Manihot esculenta) ger...
 

Más de International Institute of Tropical Agriculture

Más de International Institute of Tropical Agriculture (20)

Make your research visible and create more impact using DataCite DOIs
Make your research visible and  create more impact using  DataCite DOIsMake your research visible and  create more impact using  DataCite DOIs
Make your research visible and create more impact using DataCite DOIs
 
Induction of early flowering in cassava through light supplementation and CM...
Induction of early flowering in cassava  through light supplementation and CM...Induction of early flowering in cassava  through light supplementation and CM...
Induction of early flowering in cassava through light supplementation and CM...
 
Producing yam mother plants to collect vines for propagation
Producing yam mother plants to collect  vines for propagationProducing yam mother plants to collect  vines for propagation
Producing yam mother plants to collect vines for propagation
 
Effects of moult and breeding on the body condition of some forest birds in s...
Effects of moult and breeding on the body condition of some forest birds in s...Effects of moult and breeding on the body condition of some forest birds in s...
Effects of moult and breeding on the body condition of some forest birds in s...
 
Conserving Nigeria’s rarest endemic bird: Ibadan Malimbe, Malimbusibadanensis
Conserving Nigeria’s rarest endemic bird: Ibadan Malimbe, MalimbusibadanensisConserving Nigeria’s rarest endemic bird: Ibadan Malimbe, Malimbusibadanensis
Conserving Nigeria’s rarest endemic bird: Ibadan Malimbe, Malimbusibadanensis
 
Cassava brown streak epidemiology in Eastern Democratic Republic of the Congo
Cassava brown streak epidemiology in Eastern Democratic  Republic of the CongoCassava brown streak epidemiology in Eastern Democratic  Republic of the Congo
Cassava brown streak epidemiology in Eastern Democratic Republic of the Congo
 
9 osunbade identification of end users preferences of a cassava product
9 osunbade identification of end users preferences of a cassava product9 osunbade identification of end users preferences of a cassava product
9 osunbade identification of end users preferences of a cassava product
 
7 helen ufondu perception of yam landraces quality among value chain actors i...
7 helen ufondu perception of yam landraces quality among value chain actors i...7 helen ufondu perception of yam landraces quality among value chain actors i...
7 helen ufondu perception of yam landraces quality among value chain actors i...
 
8 kazeem quality attributes and consumer acceptability of cookies flavoured
8 kazeem quality attributes and consumer acceptability of cookies flavoured8 kazeem quality attributes and consumer acceptability of cookies flavoured
8 kazeem quality attributes and consumer acceptability of cookies flavoured
 
6 anajekwu ekpereka chemical, functional and pasting properties of flours pro...
6 anajekwu ekpereka chemical, functional and pasting properties of flours pro...6 anajekwu ekpereka chemical, functional and pasting properties of flours pro...
6 anajekwu ekpereka chemical, functional and pasting properties of flours pro...
 
5 seun olowote effect of drying method on caroteniod content of yellow maize
5 seun olowote effect of drying method on caroteniod content of yellow maize5 seun olowote effect of drying method on caroteniod content of yellow maize
5 seun olowote effect of drying method on caroteniod content of yellow maize
 
4 ayodele adenitan survey of dried plantain (musa paradisiaca) chips processo...
4 ayodele adenitan survey of dried plantain (musa paradisiaca) chips processo...4 ayodele adenitan survey of dried plantain (musa paradisiaca) chips processo...
4 ayodele adenitan survey of dried plantain (musa paradisiaca) chips processo...
 
2 akin olagunju does crop diversification influenc e food and nutrition secur...
2 akin olagunju does crop diversification influenc e food and nutrition secur...2 akin olagunju does crop diversification influenc e food and nutrition secur...
2 akin olagunju does crop diversification influenc e food and nutrition secur...
 
3 akinsola carotenoid apparent retention in ogi flour made from different pro...
3 akinsola carotenoid apparent retention in ogi flour made from different pro...3 akinsola carotenoid apparent retention in ogi flour made from different pro...
3 akinsola carotenoid apparent retention in ogi flour made from different pro...
 
1 pearl amadi assessing the level of consumption of pro vitamin a cassava pr...
1 pearl amadi assessing the level of consumption of pro  vitamin a cassava pr...1 pearl amadi assessing the level of consumption of pro  vitamin a cassava pr...
1 pearl amadi assessing the level of consumption of pro vitamin a cassava pr...
 
Prof janice olawoye
Prof janice olawoyeProf janice olawoye
Prof janice olawoye
 
Inqaba biotech presentation
Inqaba biotech presentationInqaba biotech presentation
Inqaba biotech presentation
 
Iarsaf symposium adaptation to climate change
Iarsaf symposium adaptation to climate changeIarsaf symposium adaptation to climate change
Iarsaf symposium adaptation to climate change
 
Bimaf iita iarsaf presentation-ibadan 21.05.19
Bimaf  iita iarsaf presentation-ibadan 21.05.19Bimaf  iita iarsaf presentation-ibadan 21.05.19
Bimaf iita iarsaf presentation-ibadan 21.05.19
 
In a class of 50
In a class of 50In a class of 50
In a class of 50
 

Último

Human Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR SystemsHuman Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR SystemsMark Billinghurst
 
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)Mark Simos
 
Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024Enterprise Knowledge
 
Story boards and shot lists for my a level piece
Story boards and shot lists for my a level pieceStory boards and shot lists for my a level piece
Story boards and shot lists for my a level piececharlottematthew16
 
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmaticsKotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmaticscarlostorres15106
 
Dev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio WebDev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio WebUiPathCommunity
 
What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024Stephanie Beckett
 
Unraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdfUnraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdfAlex Barbosa Coqueiro
 
DevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platformsDevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platformsSergiu Bodiu
 
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...Patryk Bandurski
 
Connect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck PresentationConnect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck PresentationSlibray Presentation
 
Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?Mattias Andersson
 
Scanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsScanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsRizwan Syed
 
Developer Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQLDeveloper Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQLScyllaDB
 
Gen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdfGen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdfAddepto
 
Training state-of-the-art general text embedding
Training state-of-the-art general text embeddingTraining state-of-the-art general text embedding
Training state-of-the-art general text embeddingZilliz
 
Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!Manik S Magar
 
SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024Lorenzo Miniero
 

Último (20)

Human Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR SystemsHuman Factors of XR: Using Human Factors to Design XR Systems
Human Factors of XR: Using Human Factors to Design XR Systems
 
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)
Tampa BSides - Chef's Tour of Microsoft Security Adoption Framework (SAF)
 
Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024Designing IA for AI - Information Architecture Conference 2024
Designing IA for AI - Information Architecture Conference 2024
 
Story boards and shot lists for my a level piece
Story boards and shot lists for my a level pieceStory boards and shot lists for my a level piece
Story boards and shot lists for my a level piece
 
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmaticsKotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
Kotlin Multiplatform & Compose Multiplatform - Starter kit for pragmatics
 
Dev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio WebDev Dives: Streamline document processing with UiPath Studio Web
Dev Dives: Streamline document processing with UiPath Studio Web
 
What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024What's New in Teams Calling, Meetings and Devices March 2024
What's New in Teams Calling, Meetings and Devices March 2024
 
E-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptx
E-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptxE-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptx
E-Vehicle_Hacking_by_Parul Sharma_null_owasp.pptx
 
Unraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdfUnraveling Multimodality with Large Language Models.pdf
Unraveling Multimodality with Large Language Models.pdf
 
DevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platformsDevEX - reference for building teams, processes, and platforms
DevEX - reference for building teams, processes, and platforms
 
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
Integration and Automation in Practice: CI/CD in Mule Integration and Automat...
 
Connect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck PresentationConnect Wave/ connectwave Pitch Deck Presentation
Connect Wave/ connectwave Pitch Deck Presentation
 
Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?Are Multi-Cloud and Serverless Good or Bad?
Are Multi-Cloud and Serverless Good or Bad?
 
DMCC Future of Trade Web3 - Special Edition
DMCC Future of Trade Web3 - Special EditionDMCC Future of Trade Web3 - Special Edition
DMCC Future of Trade Web3 - Special Edition
 
Scanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL CertsScanning the Internet for External Cloud Exposures via SSL Certs
Scanning the Internet for External Cloud Exposures via SSL Certs
 
Developer Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQLDeveloper Data Modeling Mistakes: From Postgres to NoSQL
Developer Data Modeling Mistakes: From Postgres to NoSQL
 
Gen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdfGen AI in Business - Global Trends Report 2024.pdf
Gen AI in Business - Global Trends Report 2024.pdf
 
Training state-of-the-art general text embedding
Training state-of-the-art general text embeddingTraining state-of-the-art general text embedding
Training state-of-the-art general text embedding
 
Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!Anypoint Exchange: It’s Not Just a Repo!
Anypoint Exchange: It’s Not Just a Repo!
 
SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024SIP trunking in Janus @ Kamailio World 2024
SIP trunking in Janus @ Kamailio World 2024
 

Winning against virus threats to African food crops

  • 1. Winning the race against virus threats to food crops in sub-Saharan Africa: What we do and how we do it! A review from August 2007 P Lava Kumar Contract Review Seminar, 12 April 2010 www.iita.org
  • 2. Outline 1. Introduction: The challenges 2. What we do and how we do it! • Clonal crops • Seed crops • Germplasm health and quarantine • Diagnostics • Capacity building 3. Future plan Stay fit and competitive 4. Conclusions www.iita.org
  • 3. 1. The challenges www.iita.org
  • 4. Food security and poverty reduction through agriculture development • 10% increase in agriculture productivity in Africa is associated with 7.2% decrease in poverty (IFPRI 2004). N = 327.2 million t 76% IITA crops 6% 35 7% 140 Production, tonnes (x 1 000,000) 1 1 8% 37% 30 2 120 cassava Area, ha (x 1 000,000) 25 11% 100 musa 20 80 15 2 3 yam 15% 16% 3 60 maize 10 4 5 4 40 4 6 7 6 7 5 20 0 0 Maize Sorghum Cassava Rice Wheat Musa Yams www.iita.org
  • 5. Virus diseases •Cause yield and quality loses •Losses are often insidious. Frequently less conspicuous and go unnoticed or untreated. Direct and indirect losses: •Reduction in growth •Reduction in vigor •Reduction in quality & market value •Reduction in transboundary trade •Costs of maintaining health • MSV: $180 million to $480 million at 5% annual incidence • CMD: 42% yield reduction in EACMV-UG affected region • CBSD: $100 million in 2003 www.iita.org
  • 6. Drivers of virus spread/evolution Agriculture intensification • Raising population demand on food production • Rapid expansion in area • New crops & varieties, continuous cultivation (absence of breaks) Effects of Global Warming Effects of climate variability / change • Distribution of pests and diseases • Changes in geographical distribution of hosts and pathogens • Altering crop yields and losses due to changes in efficacy of management strategies Source: Nature Vol 438, No. 7066 www.iita.org
  • 7. Viruses are built to win? • Intracellular pathogens, completely dependent on hosts. • Difficult to eliminate them, without eliminating the host • Do viruses are there to protect hosts from invasive plants? • For instance virus resistance in wild relatives / landraces and susceptibility of introduced species supports this thought. (new encounter diseases of introduced crops) CMD in cassava MSV in maize CSSV in cocoa Rosette of groundnut • New paradigm - Viruses are evolutionary drivers • There is little choice for host and virus – either they Source:Wiki adjust or both will perish Virus • Why is it important here? •Viruses have mechanisms to negate preventive tactics www.iita.org
  • 8. • Diverse crops • Diverse viruses • Diverse vectors • Diverse modes of virus spread & • Diverse agro-ecologies www.iita.org
  • 9. Diversity in viruses Types worked at IITA www.iita.org
  • 10. Diverse vectors and modes of dissemination Whiteflies Aphids Beetles Thrips Leafhoppers Mealybugs www.iita.org
  • 11. Ecological diversity: Clonal and seed crops Viruses of clonal crops –STATIC Viruses of seed crops - DYNAMIC • Infected clones retain viruses • Only seed-transmitted viruses are indefinitely (What goes in stays retained and passed to next forever!). generation. • Increase in incidence incrementally • Incidence depends on the vectors Reduction depends on the and virus sources (seed-borne / replacement of infected stocks. volunteer plants / alternative hosts). Conditions favoring insects favor high incidence • In general viruses have narrow host range. • In general, broad host range • Predictable annual situation. • Unpredictable annual situation. Different viruses – crops demands different tactics www.iita.org
  • 12. 2. What we do? www.iita.org
  • 13. What we do? Strategic Objectives 1. Understand the foe 2. Develop tools to monitor them 3. Establish technologies to prevent viruses (win over the virus) 4. Disseminate the technologies Characterize viruses Develop serological and nucleic acid- (Biological and biochemical) based diagnostic tools Fundamental and applied Study virus-vector interactions and virology research for Ensure germplasm health safety and disease epidemiology mitigating the impact of virus quarantine monitoring diseases Develop disease control options, Knowledge and technology transfer including resistant varieties to stakeholders www.iita.org
  • 14. What we do? Ways to win the race Plant Health Monitoring Breeding Programs Virus-free stocks All All Exclusion Prevention (Cassava & banana) Quarantine & Inspection Cultivation of resistant varieties Breeding programs (From countries) Planting virus free material Conventionally bread / IPM / IDM transgenics Reduce spread Methods to reduce Reduce impact All Vector control impact of virus Cultivation of Physical barriers tolerant varieties Seed testing infections Avoidance by cultural methods Reduce sources of inoculum Field isolation Eliminate crop refuge, Plant spacing / alternative alternate sources dates Not effective in SSA www.iita.org
  • 15. 3. How do we do it? www.iita.org
  • 16. Inter-disciplinary approach Core business Inter-disciplinary business Virus Disease Transgenic Plant Breeding resistance Resistant Viral genes Varieties Virus isolation Host R genes Germplasm screening for resistance Biochemical, molecular & Wild and Cultivated DISEASE Virus characterization species MANAGEMENT Biological Properties Virus isolates Diagnostic tools Disease Epidemiology Monitoring Quarantine Bioassays Vector biology Serological & Virus survival and spread Nucleic-acid assays Environmental factors Virology – Breeding – Biotechnology – Germplasm – Quarantine – Extension www.iita.org
  • 17. Crop specific activities Cassava Cassava mosaic begomoviruses & brown streak Maize •Epidemiology Maize streak virus •Virus diversity and diagnostics • Host resistance •Host resistance and seed systems •Whitefly control Cowpea & soybean Bean pod mottle virus Yam Blackeye cowpea mosaic virus Yam potyvirus & badnavirus complex Cowpea mottle virus •Epidemiology Cowpea mild mottle virus •Virus diversity and diagnostics Cowpea yellow mosaic virus •Host plant resistance Cowpea aphid-borne mosaic virus •Seed systems Cucumber mosaic virus Southern bean mosaic virus Banana Cowpea chlorotic mottle Banana bunchy top Soybean mosaic virus •Epidemiology Tobacco ringspot virus •Investigations on management options Tobacco streak virus Soybean begomoviruses Cocoa • Host resistance Cocoa swollen shoot virus • Diversity and distribution •Distribution and diversity •Seed systems www.iita.org
  • 18. Generic activities Plant health monitoring & quarantine •Virus indexing •Establishment of virus-free clonal and seed germplasm •Facilitation of germplasm distribution Diagnostics •PCR and ELISA-based approaches •Viruses, fungi, bacteria and others •Mycotoxins Capacity building •Graduate and post-graduates (MSc & PhD) •Training courses & workshops for groups •Methods manual •Public database •Supply of tools and materials www.iita.org
  • 19. How we do it! Case Studies www.iita.org
  • 20. Cassava virology 1. CMD and CBSD diversity 2. Alternative hosts of CMD 3. Improve diagnostics 4. Virus-host interactions and host resistance 5. Whitefly vector: dynamics, host interaction and control OJ Alabi and RA Naidu (WSU, USA) SA Akinbade & Ope R Hanna, J Legg, G Melaku, E Kanju, P Ntawuruhunga & P Kulakow •USAID-linkage grant, GLCI, IFAD, USAID •IITA Opportunity Grant, Travel Grant & Strategic Grant www.iita.org
  • 21. Cassava mosaic disease Caused by a complex of 7 species either alone or in mixed infection •African cassava mosaic virus (ACMV) •East African cassava mosaic virus (EACMV) •South African cassava mosaic virus (SACMV) •EACMV-Cameroon, EACMV-Malawi, EACMV-Kenya, EACMV-Zanzibar EACMV-Uganda (Recombinant virus) www.iita.org
  • 22. CMG Distribution • Surveys were conducted in 7 countries • Samples analyzed by differential PCR & sequencing 80 70 60 ACMV % incidence 50 Both 40 None 30 EACMV 20 UgV 10 0 9 9 09 8 ia 08 08 89 -0 -0 -0 er ie 08 e la a a 07 ig on or n n go on N ha ha n Iv Le An ni o d' G G er Be ra e am er ot C Si C •Only ACMV was detected in samples in Mali and Niger. •EACMV-UG was detected in Angola and Cameroon. www.iita.org
  • 23. Tracking the spread of EACMV-UG 2009 2008 2009 •As of 2005, Spread in 2.6 million sq. km causing an estimated loss of 47% in affected countries. •Spread into Cameroon in West-Central Africa •Spread into Angola in Southern Africa •Also reported from Burkina Faso and Togo in 2009 Kumar et al, 2008; Akinbade et al., 2010 www.iita.org
  • 24. CMG Distribution Conclusions •ACMV is predominate, followed by mixed infection of ACMV and EACMV. •Other viruses found are EACMV and EACMCV, but not SCMV or other EACMV’s •EACMV-UG was detected only in Angola and Cameroon •DNA-A segments of ACMV, EACMCV and EACMV-UG sequenced were 96-98% identical to previously reported sequences g i|1 4 8 8 9 7 7 4 7 || E a s t Afric a • Evidence of EACMCV (recombinant g i|2 2 1 3 6 0 4 3 4 |E a s t Afr ic a g i|8 9 3 3 0 6 1 7 |e E a s t Afr ic a n species) in Ghana even in 1989, ten 99 g i|8 9 3 3 0 6 7 1 |e E a s t Afric a n g i|7 2 2 9 2 8 8 | E a s t Afric a n c years before its discovery. g i|7 2 2 9 2 8 2 | E a s t Afric a n c g i|1 4 8 8 9 7 7 4 0 || E a s t Afric a g i|8 9 3 3 0 5 5 5 |E a s t Afr ic a n • Isolates have same age as the first ever 100 51 g i|8 9 3 3 0 5 8 3 |E a s t Afr ic a n g i|8 9 3 3 0 9 4 2 |E a s t Afr ic a n sequences of ACMV published in 1980s. g i|8 9 3 3 0 7 4 8 | E a s t Afric a n g i|8 9 3 3 0 9 6 3 |E a s t Afr ic a n 74 g i|8 9 3 3 0 9 6 3 E a s t Afr ic a n g i|3 8 9 2 5 6 9 |E a s t Afr ic a n • First ever recombinant ACMV 70 g i|7 0 0 8 1 1 3 |S o u th Afric a n AC M V F N4 3 5 2 7 7 found in in Angola 100 G h a n a 1 9 8 9 AC M V IC M V AY 7 3 0 0 3 5 .2 100 S L C M V |NC 0 0 3 8 6 1 E AC M C V -T z 1 AY 7 9 5 9 8 3 100 E AC M C V -NG E U6 8 5 3 2 3 100 E AC M C V -Iv o ry AF 2 5 9 8 9 6 G h a n a -1 9 8 9 - E AC M C V Kumar et al., 2008; Akinbade et al., 2010 www.iita.org
  • 25. Recombinant ACMV •Two types of ACMV detected: Wild type and Recombinant ACMV • Entire AV1 and AV2 (ca 1000 bp) in DNA-A segment in recombinant ACMV has high similarities with EACMV. • Named as ACMV-ANG. Further studies required to assess its affect on pathogenicity. A16.3RecACMV Recombinant ACMV-ANG A16.3UGMld Potential parent of ACMV ACMVX17095 ACMVAJ427910 ACMVICAF259894 ACMVSvrAF126802 ACMVMldAF126800 ACMVTZAY795982 EACMZVAJ717562 EACMKVKEAJ71758 0 SACMVNC003803 EACMCVAF112354 EACMCVNG EACMCVIC EACMMVAJ006460 EACMVKEAJ717542 EACMVTZ EACMVUG2Mld Potential parent of AV1 and AV2 EACMVUG2Svr EACMVNC004674 www.iita.org
  • 26. Alternative hosts to CMGV ACMV+EACMV Senna occidentalis Leucana leucocephala Manihot glaziovii Combretum confertum Glycine max (soybean) ACMV only Ricinus communis Centrosema Sida Abelmoschus esculentus (Okra)* Centrosema pubescens Sida cordifolia* • ACMV and EACMCV has high homologies • Indicates active migration between cassava and other hosts Leucana Okra • Risk of novel recombination's *New record in 2009 Alabi et al., 2008 www.iita.org
  • 27. Cassava brown streak virus Potyviridae: Ipomovirus ? Prior to 2005 Post 2005 ? • First recognized in 1920s. • Affecting 1.6 million people in Eastern Africa • Kenya, Uganda, Tanzania, Malawi and Mozambique • Suspected in DRC, Burundi and Rwanda www.iita.org
  • 28. FJ687181 CBSV (GRL00508) pCP FJ687175 CBSV (GRE05008) pCP FJ687169 CBSV (GRE03908) pCP AY008440 CBSV (type C) CP GQ329864 CBSV-Tz (full sequence) 200... FJ687179 CBSV (GRL00108) pCP FJ687178 CBSV (GRE07108) pCP FN434437 CBSV-Tan 70 (full sequence) ... Ug Ke CBSV Diversity FJ687182 CBSV (GRL00808) pCP FJ687184 CBSV (GRL01008) pCP FJ687164 CBSV (GRAO7208) pCP Tz FJ687197 CBSV (GRS00608) pCP FJ687170 CBSV (GRE04408) pCP FJ687176 CBSV (GRE05108) pCP FJ687166 CBSV (GRE03108) pPC FJ687173. CBSV (GRE04708) pCP FJ687172 (GRE04608) pCP FJ687168 CBSV (GRE03708) pCP • About 50 partial coat protein (3’end) sequences generated at IITA. FJ687167 CBSV (GRE03608) pCP FN434436 CBSV-Mo 83 (full sequence) 2... M FJ687191 CBSV (GRL02708) pCP FJ687186 CBSV (GRL01408) pCP FJ687202 CBSV (GRS05708) partial CP 61 82 FJ687201 CBSV (GRS05608) Partial CP FJ687185 CBSV (GRL01308) pCP FJ687183 CBSV (GRL00908) pCP • High diversity, two groups, but no FN423417 CBSV-CP (Nampula-Mozambique ... FJ687196 CBSV (GRS00208) pCP FJ687192 CBSV (GRL02908) pCP evidence of geographic separation. FJ687188 CBSV (GRL01808) pCP FJ687165 CBSV (GRA07308) pCP 81 FJ687194 CBSV (GRL03308) pCP 61 FJ687180 CBSV (GRL00408) pCP AY007597 CBSV CP FJ687205 CBSV (GRS07008) partial CP FJ687199 CBSV (GRS03208) pCP FJ687203CBSV (GRS5908) partial CP FJ687200 CBSV (GRS05208) partial CP FJ687204 CBSV (GRS06308) partial CP FJ687198 CBSV (GRS01708) pCP FJ687189 CBSV (GRL02308) pCP 100 FN433933 CBSVM 43 2007 (M a alawi:Salima) AY008442 CBSV (type A) CP FJ821795 CBSV (KBH1) CP 79 FN433932 CBSV-M 42 2007 (M a alawi:Chit... UG, Ken, Mal 64 FJ821794 CBSV (KBH2) CP 92-95% AF311053 CBSV 61 69 AF311052 CBSV FN434109 CBSV-Ug 23 (full sequence) 2... 86-87% 67 FJ687195 CBSV (GRL03408) pCP FJ687193 CBSV (GRL03108) pCP 70 66 FN423418 CBSV-CP (Naliendele-2-Tanzan... FN433930 CBSVKenya 125 1999 (Kenya:K... FN423416 CBSV-CP (Naliendele-1 Tanzan... 100 70-71% AY008441 CBSV (type B) CP FN433930 CBSV Kenya 125 1999 (Kenya:K... FN433931 CBSV-Ke 54 1997 (Kenya:Kilifi) 95 Sh1.1 U 100 89 Sh1.4 U CBSV-TZ-Short-1 FJ185044. CBSV-Uganda (2006) 92 CBSV-TZ-Short-2 61 EU916832 CBSV (BSA4) CP N 012698 CBSVisolate M full geno... C LB3 EU916830 CBSV (IGA8) CP FN434437 CBSV-Tan 70 (full sequence) ... 79-80% EU916827 CBSV (NTG10) CP Tz, Moz EU916829 CBSV (LWR2) CP EU916828 CBSV (HMA9) CP 96% FN434109 CBSV-Ug 23 (full sequence) 2... 100 FN434436 CBSV-M 83 (full sequence) 2... o DQ837304 CBSV (WKS) pCP 99 DQ837303 CBSV (NAM) pCP DQ837302 CBSV (MKN) p 100 GQ329864 CBSV-Tz (full sequence) 200... 54 Ten11.2 U 72 EU916831 CBSV (BSA2) CP EU916825 CBSV (MLB3) CP NC 006941 CVYV 84 NC 012698 EU916826 CBSV (MLB9) CP 84 FN433932 CBSV-Ma 42 2007 (Malawi:Chit... FN433933 CBSV Ma 43 2007 (Malawi:Salima) NJ Tree of full-length CBSV genomes FN433931 CBSV-Ke 54 1997 (Kenya:Kilifi) 0.1 Sequences from Genebank CBSV-TZ-Long-1 Lg1.1 U 87 Lg1.3 U CBSV-TZ-Long-2 www.iita.org
  • 29. Improved diagnostics CBSV and CMBVs are complex and often necessitates multiple tests. Cassava brown streak virus •Sequence information points to divergent types (2 species and several strains?) Cassava mosaic begomoviruses (CMBVs) in SSA • African cassava mosaic • East African cassava mosaic • East African cassava mosaic Cameroon virus • East African cassava mosaic Zanzibar virus • East African cassava mosaic Malawi virus • East African cassava mosaic Kenya virus • East African cassava mosaic virus-Uganda • South African cassava mosaic virus • Indian cassava mosaic www.iita.org
  • 30. Simultaneous detection of ACMV and EACMV complex Primer Sequence (5’ to 3’) Length (nts) Size (bp) CMBRep/F CRTCAATGACGTTGTACCA 19 ACMVRep/R CAGCGGMAGTAAGTCMG 17 368 for ACMV EACMVRep/R GGTTTGCAGAGAACTACATC 20 650 for EACMV • Detects all CMBs reported in SSA, with exception of EACMZV, SACMV, ICMV, SLCMV Alabi et al., 2008 www.iita.org
  • 31. Multiplex PCR for simultaneous ACMV EACMCV detection of CMBV and CBSV CBSV-S1/S2 + CMB CBSV-L1/L2 + CMB Sap DNA&RNA ACMV & Sap DNA & RNA M1 2 3 4 5 6 7 1 2 34 5 6 7 M1 2 3 4 5 6 7 1 2 34 5 6 7 M EACMCV EACMV ACMV CBSV Lanes 1 to 4: CBSV infected samples Lane 5: Healthy cassava Lane 6: CMD afffected cassava Primer name Sequence (5’ to 3’) Lane 7: CBSD affected cassava Lane M: Molecular weight marker (100 kb ladder) CBSVcp-L1 CAGAATAGTGTTGCTGCAGGTAA CBSVcp-L2 CTACATTATTATCATCTCC CBSVcp-S1 GCAGGTAAGGCGTTTGTG CBSVcp-S2 TCTACCAACATTCGCTG Kumar et al., 2009 www.iita.org
  • 32. Ongoing / future priorities CBSD • Improvement in diagnostics – NASH and RT-PCR (GLCI) • Alternative hosts for CBSV (GLCI) • Impact of CBSV strains on host resistance (GLCI & USAID) • Understand the causation of root necrosis (GLCI) • CBSV evolution and within field and location diversity (USAID) • ELISA-based assays to CBSV (USAID / GLCI) • Protocol for the production of CBSV-free tissue culture material (GLCI) CMD and CBSD • Whitefly management programs as away to reduce disease incidence (IITA Strategic grant) Generic • Monitoring programs to prevent the spread of CBSD and EACMV-UG spread CMGV and CBSV diversity and its impact on host resistance • Development of dual resistant cassava varieties www.iita.org
  • 33. Maize virology 1. Host plant resistance to Maize streak virus 2. Mechanisms of resistance 3. High-throughput phenotyping for MSV • MSV is restricted to only Africa • The most damaging disease of maize in SSA • Annual losses, $120 – 480 million • Breeding for MSV resistance is integral in our programs A Menkir and S Hearne M Salaudeen, O Taiwo, A Razaq •DTMA and Core funds www.iita.org
  • 34. Screening for MSV resistance 6-7 DAS Material selection 1 0 7 60 54 Days after 10 3 48 sowing 42 36 30 14 9-10 DAS Inoculation with leaf hoppers 30 to 50 DAS Symptom scoring at weekly intervals 13-14 DAS First symptoms (most genotypes have 3-4 days incubation period) www.iita.org
  • 35. High-throughput phenotyping for MSV Disease evaluation 0 = No infection or escape 1 = Most resistant (less than 10% streaks) 2 = Resistant (10-25% streaks) 3 = Moderately resistant (25-50% streaks) 4 = Susceptible (50-75% streaks) 5 = Highly susceptible (>75% streaks) Virus quantification in plants by ELISA Rep # 1 Rep # 2 Rep # 3 Rep # 4 Control line Test line S5 S4 S3 S2 S1 www.iita.org
  • 36. Good recovery Susceptible Good recovery www.iita.org
  • 37. Performance of maize genotypes Group A High recovery 5.0 MsvS10 Severity score 4.0 MsvS09 3.0 MsvS18 2.0 MsvS08 1.0 Msv S26 0.0 MsvS07 1 2 3 4 5 6 MsvS12 MsvS04 Weeks Group B MsvS11 MsvS20 5.0 MsvS03 4.0 MsvS17 3.0 score Msv S30 2.0 MsvS19 1.0 MsvS02 No recover Group C 0.0 MsvS22 1 2 3 4 5 6 MsvS06 Msv S27 Weeks MsvS01 6.0 MsvS16 MsvS14 5.0 MsvS15 Moderate recovery Severity MsvS24 4.0 Msv S28 3.0 MsvS13 2.0 MsvS21 1.0 MsvS23 0.0 1 2 3 4 5 6 Msv S25 Msv S29 Weeks Pool 6 control www.iita.org
  • 38. Virus concentration vs Severity score 0.80 0.60 Leaf 1 ODv values 0.40 leaf 2 Leaf 3 0.20 After 6 weeks 0.00 MX10 MX5 MX3 MX4 6.0 5.0 Week 1 4.0 Week 2 score Week 3 3.0 week 4 2.0 week 5 1.0 week 6 0.0 MX10 MX5 MX3 MX4 Group A B Genotype C D www.iita.org
  • 39. Recovery mechanism offers protection to MSV 6.0 5.0 4.0 Group A Group B 3.0 Group C 2.0 Pool 6 control 1.0 0.0 1 2 3 4 5 6 • No evidence of resistance to leafhopper feeding. • Incubation period is 3-4 days in genotypes evaluated so far • Most genotypes showed recover type resistance (reduction in chlorotic streaks as well as virus concentration) • No indication of symptom remission. • No immunity www.iita.org
  • 40. MSV resistance in S1 testcrosses • Field experiment for incidence, severity and agronomic performance • 6 S1 crosses were highly resistant to MSV and good agronomic performance. • Resistance is superior to what has been found in MSV transgenics (Shepherd et al., 2007) 80.0 3.5 67.6 Disease incidence (%) 70.0 3.0 3 58.3 Disease severity 2.8 60.0 2.5 2.5 50.0 45.0 45.2 2.1 2.0 2.02 Incidence 40.0 1.5 Severity 30.0 20.0 1 10.0 0.5 0.0 0 1WPI WPI3WPI WPI5WPI6WPI WPI8WPI WPI 2 4 7 9 Time (week) Salaudeen et al., 2010 www.iita.org
  • 41. On-going and future plans • Further characterization of promising lines and release to farmers • Augment resistance to MSV in other backgrounds • Identification of association markers for MSV (DTMA) • Mechanisms of resistance • Host-MSV interactions www.iita.org
  • 42. Yam virology • Diversity and distribution of viruses infecting yams in West Africa • Characterization of YBSD • Development of diagnostic tools • Symptomology and synergistic interactions • Host resistance • Evaluation of mapping population • Virus-free seed systems R Asiedu and A Sartie O Patricia, R Ronke, M Toually and S Asala, •IFAD and Core funds www.iita.org
  • 43. Virus reported to infect Dioscorea yams in West Africa Virus Distribution Disease importance Yam mosaic virus Worldwide High (YMV; Potyvirus) Yam mild mosaic virus Worldwide High* (YMMV; Potyvirus) Cucumber mosaic virus Worldwide High* (CMV; Cucumovirus) Dioscorea bacilliform viruses (many Worldwide High* strains and species) (DBV; Badnavirus) Dioscorea sansibarensis bacilliform Benin Not known*** virus (DsBV; Badnavirus) Yam internal brown spot virus Cote d’Ivory, Benin(?), High** (IBSV; Badnavirus*) The Caribbean Dioscorea ring mottle virus Togo Not known*** (DaRMV; Potyvirus) Dioscorea mottle virus Nigeria Not known*** (DMoV; Comovirus?) *Often detected in mixed infection; known to have synergistic effect on symptom expression **Virus-like disease of unknown etiology ***Limited information on virus characters www.iita.org
  • 44. Yam virus diagnostics • Diagnostic tools established for all major yam viruses. -Poly and monoclonal antibodies for Yam mosaic virus, Yam mild mosaic virus, Yam badna viruses available. -Specific and generic primers for PCR/RT-PCR based diagnostics. -Methods for virus detection in tubers established. www.iita.org ©Lava - 09
  • 45. Yam virus diagnostics & symptomatology • Uneven distribution of viruses in tubers • Variation in symptom expression in plants germinated from the same tuber. • Evidence of synergistic interaction between YMV and YMMV. www.iita.org ©Lava - 09
  • 46. Evaluation of mapping population Virus indexing Following evaluation Sl. Accession No. name Genotype details* Tuber Plant 1 TDr 93-2 Resistant to YMV Y ng - 2 TDr 1621 Resistant to YMV Y ng - 3 TDr 1640 Resistant to YMV Y Y Susceptible 4 TDr 89/ 02665 Resistant to YMV Y - - 5 TDr 97/ 00777 Highly susceptible to YMV Y Y, B Susceptible 6 TDr 93-32 Highly susceptible to YMV Y Y Moderately Tolerant (Promising) 7 TDr 95/ 18531 Susceptible to YMV Y Y, B Susceptible 8 TDr 747 Susceptible to YMV Y Y, B Susceptible 9 TDr3661 Susceptible to YMV - Y, B Moderately Tolerant (Promising) 10 TDr 2261 Susceptible to YMV Y Y, B Susceptible 11 TDr 95-127 No information Y Y, B Susceptible 12 TDr 95/ 01932 No information Y ng - 13 TDr 99/ 02789 No information Y Y, B Moderate 14 TDr 98/ 01317 No information Y Y, B Moderately Tolerant (Promising) 15 TDa85/ 00250 Resistant to anthracnose Y,B Y, B Moderately Tolerant (Promising) 16 TDa87/ 01091 Resistant to anthracnose Y Y, B Moderately Tolerant (Promising) 17 TDa95/ 00328 Susceptible to anthracnose Y, B Y, B Tolerant (Recommended 18 TDa95- 310 Susceptible to anthracnose Y, B Y, B Tolerant Recommended 19 TDa92- 2 Susceptible to anthracnose Y, B Y, B Susceptible 20 TDa98/ 01166 No information Y Y, B Tolerant (Recommended) www.iita.org
  • 47. Evaluation of mapping population www.iita.org
  • 48. Yam brown spot disease (YBSD) (Potential CBSD of yam?) • A virus-like disease of unknown etiology recognized in Cote d’Ivory in early 1980s, and in Benin in 2008. • Symptoms are similar to the internal brown spot disease (IBSD) first reported from the Caribbean in mid 1970s. • Loss in tuber quality. • This can emerge as a serious threat. B www.iita.org ©Lava - 09
  • 49. Studies on IBSD etiology 1 2 3 1 4 3 2 5 1 2 3 4 5 www.iita.org ©Lava - 09
  • 50. Studies on IBSD etiology • Wide spread in Cote d’Ivoire • Known for about 40 to 60 years 5 3 4 1 2 • Bètè-bètè is highly susceptible Distribution and severity of necrotic symptoms in tuber Tubers sections (mean)* 4 No. No. Percent 1 2 (apico- 3 (median- observed symp* symp* (Top) median) (middle) base) 5 (base) 178 105 60 3.0 3.0 2.8 2.5 2.1 www.iita.org
  • 51. Phenotyping yams for virus resistance •D. rotundata accessions were evaluated in 2008-09 season. •987 accessions in total (3488 plants) Score: 1 = highly resistant (no visible symptoms) 2 = resistant (mild mottling/mosaic on few leaves) 3 = moderately resistant (mild mottling/mosaic on most leaves) 4 = susceptible (severe mottling / mosaic on most leaves) 5 = highly susceptible (severe mosaic/mottling, stunting and distortion) www.iita.org
  • 52. Phenotyping yams for virus resistance Susceptible 5% (Score 4) Resistant 7% Highly susceptible 5% (Score 2) (Score 5) •There is no immunity or very high resistance in these germplasm. N = 987 Moderately resistant 83% (Score 3) Score: 1 = highly resistant (no visible symptoms) 2 = resistant (mild mottling/mosaic on few leaves) 3 = moderately resistant (mild mottling/mosaic on most leaves) 4 = susceptible (severe mottling / mosaic on most leaves) 5 = highly susceptible (severe mosaic/mottling, stunting and distortion) www.iita.org
  • 53. Next steps • Determine the diversity of viruses in West Africa and improve diagnostic tools • Understand the etiology of YBSD • Symptomology and yield losses • Evaluation of mapping population for YMV • Virus-free seed systems www.iita.org
  • 54. Soybean virology • Baseline studies to assess the impact of virus diseases on soybean • Evaluation of improved varieties and breeding lines against widespread/economically important viruses. • Monitor seed stocks and eliminate virus contaminated seed. H Tefera, C Fatokun, T Imbor, R Adesida and P Ogunsanya •TL2 and Core funds www.iita.org
  • 55. Baseline studies in Nigeria Virus Abbreviation Genus Vectors 1 Bean pod mottle BPMV Comovirus Beatles 2 Black eye cowpea mosaic BICMV Potyvirus Aphids 3 Cowpea aphid-borne mosaic CABMV Potyvirus Aphids 4 Cowpea mottle CMeV Carmovirus Beatles 5 Cowpea yellow mosaic CYMV Comovirus Beatles 6 Cucumber mosaic CMV Cucumovirus Aphids 7 Cowpea severe mosaic CpSMV Comovirus Beatles 8 Cowpea mild mottle CPMMV Carlavirus Whiteflies 9 Southern bean mosaic SBMV Sobemovirus Beatles 10 Tobacco streak TSV Nepovirus Nematodes 11 Soybean mosaic SMV Potyvirus Aphids 12 Soybean chlorotic blotch* SbCBV Begomovirus Whiteflies 13 Soybean mild mottle* SbMMV Begomovirus Whiteflies 14 Cassava mosaic virus** CMD Begomovirus Whiteflies *New viruses; **New report Ezeri et al., 2009 www.iita.org
  • 57. 2.7 2.5 3.4 3.9 3.8 3.3 3.4 3.3 3.7 4.2 3.2 4.1 3 4.5 4 www.iita.org
  • 58. Virus incidence in various states 120 100 % infection 80 60 40 20 0 Ba u a A d un a Ka a e yo hi o Ka o a er pl a as CT a gi ea b w n aw nu rn in ar uc Ko ig O ra Ka ra F ts Bo Kw d Be at N am Ta sa N State •Virus incidence exceed 50% in 13 of the 15 states (87%) surveyed www.iita.org
  • 59. Relative abundance of viruses in Nigeria CpSMV BICMV SMV CpSMV TSV Virus BPMV SBMV CMeV CYMV CMV CABMV CPMMV 0 20 40 60 80 100 120 Proportion Imbor et al., 2010 www.iita.org
  • 60. Relative abundance of viruses in latent infections 0.7 CMeV 1.5 BPMV 1.5 CABMV virus 2 CYMV 4 TSV 9 CMV CPMMV 99 Total = 166 100 0 20 40 60 80 100 % infection www.iita.org
  • 61. Distribution of viruses in Nigeria Agro-ecological zone State Viruses present Total Derived Sav Benue CPMMV,CABMV,CMV,CYMV, SBMV, BPMV, CMeV, TSV, SMV 9 Taraba CPMMV, CMV, CYMV, BPMV, CMeV, TSV,SMV 7 Kogi CPMMV 1 Oyo CPMMV, CMV 2 FCT CPMMV, CMV, BPMV, CMeV, TSV, CpSMV,SMV 7 Nassarawa CPMMV, CMV, BPMV,SMV 4 Sud/Sahel/N.G.Sav Katsina CPMMV 1 Kano CPMMV, CABMV, CMV 3 Kaduna CPMMV, CMV, BPMV 3 Sud/ South G.Sav Adamawa CPMMV 1 Niger CPMMV 1 Borno CPMMV 1 Kwara CPMMV, CMV 2 Mid-Altitude, Sud/D. Sav Plateau CPMMV, CABMV, CMV, BPMV 4 Bauchi CPMMV 1 www.iita.org
  • 62. New whitefly-transmitted begomoviruses in soybean [Legumoviruses] •Soybean chlorotic blotch virus (SbCBV) •Soybean mild mottle virus (SbMMV) •Begomoviruses (legumogroup) •Novel types within features of both new world and old world begomoviruses Alabi et al., 2010 www.iita.org
  • 63. Novel features CRA CRB AC4 (2117…2410) AV1 (260…1021) SbCBV SbCBV 2647 bp BV1 2708 bp AC5 BC1 (373…1158) AC1 (701…995) (1219…2310) (1479…2567) AC3 (1018…1431) AC2 (1163…1579) First bipartite legumoviruses that lack AV2 gene; IR V2 (1…507) C4 SbMMV (2198…25) 2768 bp V1 C1 First monopartite legumovirus (299…1072) (1563…2612) C3 (1069…1473) C2 (1187…1624) www.iita.org
  • 64. 96 AYVV AJ558120 100 CoTSV DQ875869 57 SbCLV AB050781 68 SiYMYuV DQ875873 77 AYVHuV DQ866124 SiGMV AF0841 TbLCYnV AJ512761 80 86 AbMV X15984 ToLCMYV AF327436 ToMHV Y14875 StaLCuV AJ810156 80 EpYVV AB007990 Asia 100 ToMoTV ToMoV AF012301 AY965901 VeYVV AM182232 97 BDMV M88180 81 66 PepLCV AF134484 61 ToLCSinV AJ508783 69 TYLCCNV AJ319675 79 89 CdTV AF101478 ToLCTWV DQ866125 55 95 ToLCVV DQ641705 SiGMCRV X99551 67 AYVSLV AF314144 SiGMHV Y11098 99 92 ChiLCV DQ6759 100 SiYVV Y11100-1 ToLCBDV AF188481 CLCrV AF480941 86 99 AEV AJ437618 DesLDV DQ875871 99 85 CYVMV AJ507777 PYMPV Y15033 99 85 PaLCuV Y15934 100 PYMV D00941 100 ToLCNDV DQ169056 India 73 BGMV TGMV M88687 K02030 100 ICMV Z24758 SLCMV AJ579307 99 SiMMV AJ5573 100 ToRMV AF291706 New World CLCuBV AY7050 55 Old World BYVMV AF241479 97 SiMoV AJ5574 100 OYVMV AJ0021 100 ToYSV DQ336351 100 CLCuGV AF155064 70 BGYMV AF173556 100 100 55 CLCUGV EU024120 MaYMFV AY044136 HoLCrV AY036009 56 MaMPRV AY044134 ACMV X17095 DiYMoV AF170101 TLCuKV EU350585 MeMV AY965899 92 75 TbLCZV AF350330 TYMLCV AY508994 85 ToCSV AF261885 99 PHYVV AY044163 75 88 ToYLCrV AY502935 RhGMV DQ356429 59 ChaYMV AJ223191 100 CabLCuJV DQ178609 66 61 93 OYLCrV EU024119 CabLCuV U65530 76 86 ToLCMLV AY502936 Africa 55 61 PepGMV AY928517 ToLCArV DQ519575 76 RhGMSV DQ6673 100 TYLCMalV AF271234 82 BCaMV AF110190 TYLCMLV FM212660 EuMV DQ3189 97 EACMCV AF112354 CuLCrV AF327559 91 82 EACMV AJ717542 MCLCuV AF4790 75 56 EACMMV AJ0060 97 SLCV M182 SACMV AF155806 100 SMLCV AF421553 100 EACMKV AJ717580 ToCMoV AF491306 97 EACMZV AJ717562 ‘Legumovirus’ CoGMV DQ641689 Africa CPGMV AF029217 100 CoYVV AY727904 SbCBV GQ472985 100 SLCCNV AF509742 100 SbCBV GQ472987 98 SLCPHV AB085794 100 SbMMV GQ472984 100 LYMV AF5097 98 DoYMV AY309241 ToLCGV AY190291 100 99 KuMV DQ641690 100 ToLCNDV DQ169057 Asia 66 RhYMV FM208848 ICMV Z24759 99 100 MYMIV AY049772 SLCMV AJ579308 100 96 HgYMV AJ627904 ClCMV DQ641693 100 MYMV AJ421642 95 PepLCIV AB2678 CoYVV AY727903 100 100 CoGMV DQ641688 Jute 100 100 TYLCKaV TYLCTHV DQ169055 X63016 DiYMoV AF1168 100 HgYMV AJ627905 100 100 PepGMV AY928516 100 New World 97 MYMV AJ867554 Old World SLCV M183 100 MYMIV AY049771 100 60 BGMV M88686 Americas 99 KuMV DQ641691 BDMV M88179 RhYMV FM208848 56 81 CdTV AF101476 ACMV X17096 100 ToMoV AY965900 100 SbCBV GQ472986 91 SiGMV AF049336 99 100 SbCBV GQ472988 SPLCESV EF6741 WmCSV AJ2653 SPLCGV AF326775 95 EACMCV AF112355 100 SPLCCaV EF6742 100 EACMV AJ704949 99 68 SPLCLaV IYVV EF67 AJ132548 Sweet potato 100 EACMZV AJ704942 100 EACMKV AJ704965 61 100 SPLCV BSCTV AJ586885 U02311 66 SACMV BSCTV www.iita.org AF155807 U02311
  • 65. Search for resistance to CPMMV TGX 1448-2E TGX1903-1F TGX1951-4E TGX1440-1E TGX1903-3F TGX1954-1F TGX1485-ID TGX1904-4F TGX1955-4F TGX1740-2F TGX1904-6F TGX1956-1F TGX1830-20E TGX1908-8F TGX1961-1F TGX1835-10E TGX1910-14F TGX1963-3F TGX1844-18E TGX1932-1F TGX1965-7F TGX1844-4E TGX1935-3F TGX1971-1F TGX1869-31E TGX1937-1F TGX1972-1F TGX1871-12F TGX1945-1F TGX1987-10F TGX1876-4E TGX1949-7F TGX1987-14F TGX1889-12F TGX1950-7F TGX1987-43F TGX1895-33F TGX1951- 3F TGX1987-57F TGX1895-50F TGX1987-62F TGX1987-8F •47 elite lines evaluated in screenhouse •No immunity, variation in susceptibility •Activity in progress www.iita.org
  • 66. Soybean reaction to CPMMV 250 200 No. of seeds 150 100 50 0 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 Control Accessions (8 plants per accession) Susceptible check www.iita.org
  • 67. Disease of unknown etiology • Virus-like disease of unknown etiology. • Extreme reduction in leaf lamina, stunting of plant and thickening of stems. • African soybean dwarf? www.iita.org
  • 68. New soybean disease in Southern Africa •Incidence of soybean phyllody was high in Mozambique (15-25%) Virus disease incidence was very low in Southern Africa •Low incidence •CPMMV and SMV detected in few fields www.iita.org
  • 69. Next steps • Evaluation of soybean genotypes for resistance to abundant viruses (CPMMV, SMV, CMV, BPMV, CABMV) • Characterization of soybean phyllody • Diagnostics for common soybean viruses • Characterization of new soybean infecting viruses www.iita.org
  • 70. Cowpea virology Focus: • Evaluation of germplasm (landraces / improved varieties) for resistance to viruses [adding value to drought and striga resistance; earliness etc.] • Breeding for multiple virus resistance • Establishment of virus-free cowpea seed stocks C Fatokun, B Ousman K Ogunsola, R Adesida, P Ogunsanya Core and TL2 www.iita.org
  • 71. Important viruses of cowpea in West Africa Virus Abbreviation Genus Vector 1 Blackeye cowpea mosaic BlCMV Potyvirus Aphids 2 Cowpea aphid-borne mosaic CABMV Potyvirus Aphids 3 Cucumber mosaic CMV Cucumovirus Aphids 4 Cowpea mottle CMeV Carmovirus Beetles 5 Cowpea mosaic CPMV Comovirus Beetles 6 Southern bean mosaic SBMV Sobemovirus Beetles 7 Cowpea mild mottle CMMV Carlavirus Whiteflies *All these viruses are seed transmitted Viruses of minor importance (sporadic incidence): Bean pod mottle virus; Peanut mottle; Sunn-hemp mosaic; Cowpea golden mosaic; Cowpea severe mosaic virus www.iita.org
  • 72. Distribution of cowpea infecting viruses in West Africa in 2008 www.iita.org
  • 73. Cowpea virus diversity and distribution 1978 samples from 166 sites from 5 countries (2008-09) Ghana and Togo 45 (N=639) 40 Nigeria (N=833) 35 %Infection 30 25 20 Benin and Mali (N=899) 15 10 5 0 CAbMV CAbMV CAbMV CPMMV CPMMV Mixed infect CPMV CPMMV CPMV BlCMV BlCMV CPMV Mixed infect SBMV SBMV CMV CMV CMeV BlCMV CMeV SBMV CMV CMeV Mixed infec • Present situation is not significantly different from a decade ago. • Virus equation remains same: CABMV > BlCMV > CPMV > SBMV > CMoV > CMV www.iita.org
  • 74. Cowpea viruses in southern Africa • Severe incidence in Mozambique • Detected: BlCMV, CpSMV, CMV, CABMV, SBMV • Evidence of new strains / species www.iita.org
  • 75. Screening elite lines for virus resistance www.iita.org