Call Girls Mysore Just Call 8250077686 Top Class Call Girl Service Available
Anis2 Gp Tonini
1. Micro and nanotechnologies in cancer diagnostics and therapy Alp Nano Bio International School 2January 11-15, 2010, Sterzing (Bolzano, Italy) OMICS profiling and prognostic significance in cancer Gian Paolo Tonini Translational Pediatric Oncology, National Cancer Research Institute, Genoa, Italy
9. Target preparation Probe preparation Data analysis GENERAL DNA MICROARRAY PROCEDURE
10. SPOT TARGET ARRAY ARRAY SET PROBES ROWS COLUMNS NOMENCLATURE FOR MICROARRAYS
11. Non-Target Nucleic Acid TAAGCGTTGAG Target Nucleic Acid A C G T T C C G A A T GCAAGGCTT A C G T T C C G A A A C G T T C C G A A Spot 1 Spot 2 DNA MICROARRAY: THE PRINCIPLE Double strand complementarity Each spot
15. MECHANICAL PRINTING TECHNOLOGIES (1) CONTACT DISPENSING: direct contact between the printing mechanism and the solid support - Microspotting pins (TeleChem International) - Tweezer pins - Split pins - PIN- and RINGTM technique (Genetic MicroSystems)
16. Reservoir Siringe Solenoid valve Piezoelectric crystal Pressure Glass capillary Piezoelectric printing technology Syringe-solenoid printing technology MECHANICAL PRINTING TECHNOLOGIES (2) NONCONTACTINK-JETDISPENSING: ejection of drops from a dispenser onto the surface
18. PROBE IN SITU SYNTHESIS (1) Photolithography technology (Affymetrix technology)
19. mRNA reference sequence 5’3’ …ATGGTGGGAATGGGTCAGAAGGACTCCTATGTGGGTGACG… TTACCCAGTCTTCCTGAGGATACACCCAC TTACCCAGTCTTGCTGAGGATACACCCAC Perfect Match Oligo Mismatch Oligo 25 mer Perfect match probe cells Fluorescence intensity Image Mismatch probe cells - To control the hybridization specificity - To subtract non-specific hybridization GENECHIP® PROBE ARRAY DESIGN
20. Affymetrix chips Total RNA 5’ AAAAA 3’ 3’ TTTTT - AAAAA 3’ TTTTT - 1.FIRST STRAND cDNA SYNTHESIS: SuperScript cDNA Synthesis kit (Gibco BRL Life Technology) using a high quality HPLC-purified T7-(dT)24 5’ 5’ 10. IMAGE ANALYSIS 5’ 2.SECOND STRAND cDNA SYNTHESIS 3’ 3. CLEANUP OF DOUBLE-STRANDED cDNA: phenol/chloroform/isoamyl alcohol extraction, using Phase Lock GelTM (Eppendorf) AAAAA TTTTT - 5’ 9. IMAGE ACQUISITION 5’ 3’ 3’ U Biotinylated ribonucleotides 4.BIOTIN LABELING ANTISENSE COPY RNA (cRNA) BioArrayTM HighYieldTM RNA Transcript labeling kit (Enzo Diagnostics). The in vitro transcription reaction is performed by T7 RNA polymerase with biotin-labeled nucleotides C 3’ UUUUU 5’ 8. PROBE ARRAY STAINING 5. CLEANUP OF BIOTYNILATED cRNA: RNeasy Mini Kit (Qiagen) 7. HYBRIDIZATION 6. FRAGMENTATION Tris-acetate, pH 8.1, KOAc and MgOAc RNA Biotyn T7 primer DNA
21. Resistor Off Resistor On Resistor Off Liquid Vaporizes Fill Reservoir Gas Expands Drop Breaks Off Reservoir Refills < 1 msec A C G G A T G G A T C C G A T T C C A A T T C G PROBE IN SITU SYNTHESIS (2) Phosphoamidite / Ink-Jet process (Agilent Technologies)
23. Cy3 Cy5 Tumor cells Normal cells TARGET LABELLING (2) Emission spectra of some CyDye fluors 2-COLOR ASSAYS: - Fluorophores
24. Glass slide with sample Replicate slides Image analysis Discard spots with poor quality values Calculate ratios Average data Examine variation of ratio between replicates Visualize data Data report Store data in a database MICROARRAY DATA ANALYSIS
32. METAPHASE COMPARATIVE GENOMIC HYBRIDIZATION (CGH) (in our lab since 1998) by Raffaella Defferrari -Whole-genome screeningcapability; - Theresolutionis no less than ~ 10 Mb for loss and gains; - Analysisrequires experienced cytogenetics to determine regions of imbalances
33. METAPHASE COMPARATIVE GENOMIC HYBRIDIZATION (CGH) (in our lab since 1998) -Whole-genome screeningcapability; - Theresolutionis no less than ~ 10 Mb for loss and gains; - Analysisrequires experienced cytogenetics to determine regions of imbalances
34. METAPHASE CGH ARRAY CGH (in our lab since 2001) ARRAY CGH PLATFORMS Bacterial Artificial Chromosomes (BACs) Yeast Artificial Chromosomes (YACs) Plasmid Artificial Chromosomes (PACs) Cosmids Matrix CGH 1 Mb 300 Kb – 2 Mb cDNA < 200 kb cDNA aCGH 0.5 – 2 Kb -Whole-genome screeningcapability; - Theresolutionis no less than ~ 10 Mb for loss and gains; - Analysisrequires experienced cytogenetics to determine regions of imbalances Oligonucleotides -This system significantlyincreases resolutionfor localizing regions of imbalance; - Just as with expression microarray screening,analysis is straightforward and automatic Oligonucleotide aCGH (in our lab since 2005) < 6 kb 30 – 70 bp Probe length Resolution
35. Gene view Chromosome view Genome view View of the feature of probe data and annotations CGH Analytics software (Agilent Technologies)
40. Test RNA Reference RNA Up-regulated gene expression Down-regulated gene expression GENE EXPRESSION PROFILING Quantitate mRNA levels to compare which genes are turned off and on in specific cell states (e.g. tumor vs. normal cell)
41. The length of the branch is inversely proportional to the degree of similarity Shades of red indicate increased relative expression Shades of green indicate decreased relative expression HIERARCHICAL CLUSTERING ALGORITHM - Provides measures of distance between multiple possible grouping of genes - Sorts all genes, such that similar genes appear near each other. This is shown as a DENDROGRAM
42. Tumor 1 Tumor 2 min max HIERARCHICAL CLUSTERING DENDROGRAM OF EXPRESSION DATA Each color patch represents the expression level of the associated gene (ROWS) in each sample (COLUMNS), with a continuum of expression levels from dark green (lowest) to bright red (highest). The Tumor 1 and Tumor 2 are placed on a different trunk 65 Genes more highly expressed in Tumor 1 samples than in Tumor 2 Cluster 1 56 genes more intensely expressed in Tumor 2 tumors than in Tumor 1 ones Cluster 2 Bioconductor software (www.bioconductor.org) Cluster method: average linkage Distance metric: euclidean
43. From single gene to the genome and prognostic valuean example of pediatric cancer
45. Neuroblastoma onset as a localized or a disseminated tumor Localized tumor: favourable prognosis Metastatic tumor: unvafourable prognosis Primary Tumor
46.
47. C + C - A B Southern blot Double colour FISH analysis on interphase nuclei Detection Of MYCN gene amplification by Katia Mazzocco
48.
49. Age at diagnosis INSS stage MYCN status DNA index Shimada histopathology OUTCOME BASED ON RISK FACTORS Maris JM, CurrOpinPediatr 2005, 17:7-13
54. Chromosome 3p, 9p, 11q, 14q deletionGENETIC ABNORMALITIES OF NEUROBLASTOMA SUGGESTED TO PERFORM A PANGENOMIC ANALYSIS BY MICROARRAY
55.
56.
57. Life threatening symptoms NO RANDOMIZATION LINES (Low Intermediate NB European Study) Low Risk Study L2 Patients MYCN single copy L2 < 18 months L2 < 18 months Wide-genome analyses No life threatening symptoms No symptoms Symptoms Genomic type 2 Type 1 Type 2 Genomic type 2 Genomic type 1 Type 2 Type 1 Genomic type 1 structural changes no structural changes structural changes no structural changes structural changes structural changes no structural changes no structural changes RANDOMIZE NO RANDOMIZATION RANDOMIZE NO RANDOMIZATION Observational nterventional VP/Carbo2 - 4 2 - 4 VP/ Carbo to resolve 2 - 4 VP/ Carbo to resolve 2 - 4 VP/ Carbo to resolve 2 - 4 VP/ Carbo to resolve Interventional 2-4 VP/Carbo Observational Co2 - 4, VP/Carbo2 - 4 LTS LTS LTS LTS 2-4 CO, 2-4 VP/Carbo Treatment group a Treatment group b Treatment group c Treatment group c Treatment group c Surgical resection 1 year Surgical resection 1 year Aim for surgical resection Aim for surgical resection Aim for surgical resection Aim for surgical resection Aim for surgical resection Aim for surgical resection Aim for surgical resection Aim for surgical resection from diagnosis if IDRF from diagnosis if IDRF when IDRF negative when IDRF negative when IDRF negative when IDRF negative when IDRF negative when IDRF negative when IDRF negative when IDRF negative negative negative Study A/I Study A/I Study C/III Study C/III Study B/II Study A/I Study A/I Study C/III Study C/III Study B/II
61. Unbiased amplification of total RNA by Ribo-SPIA® RNA Amplification 20 ng RNA High quality RNA Quantification of the 59-gene signature by qPCR PROSPECTIVE STUDY WITHIN CLINICAL PROTOCOL Detection of inhibitors by SPUD assay (Nolan et al., 2006)
63. Genome analysis of metastatic neuroblastoma By a-CGH using high resolution oligonucleotide Human Genome CGH 44K (Agilent Technologies). Group 1 (49 cases) patients 4S, NMYC normal Group 2(37 cases) patients stage 4; < 18 months; MYCN normal; 3 years EFS Group 3(cases 47) patients stage 4; > 19 months; Any case dead for disease. The trend of average number of numerical changes tends to decrease: from Group 1 to Group 3 On the contrary The trend of average number of segmental changes tends to increase: From Group 1 to Group 3
64. Genome analysis of metastatic neuroblastoma By a-CGH using high resolution oligonucleotide Human Genome CGH 44K (Agilent Technologies). Numerical aberrations Structural aberrations The frequency of significant structural changes tends to increase From Group 1 to Group 3 The frequency of significant numerical changes tends to decrease From Group 1 to Group 3
65. Transcriptome analysis of metastatic neuroblastoma Gene expression analysis was performed 11K oligonucleotide microarray (10,163 probes for 8,155 Unigene transcrits) Group 1 vs. Group 2 Group 2 vs. Group 3 30 9 Group 1 (49 cases) patients 4S, NMYC normal Group 2(37 cases) patients stage 4; < 18 months; MYCN normal; 3 years EFS Group 3(cases 47) patients stage 4; > 19 months; Any case dead for disease. 4 66 2 109 240 1436 Group 1 vs. Group 3
66. Cromosome region 5’ 3’ 5’ 3’ Probe Set Genome and gene expression Intergration Chromosome region Normalized gene Expression data # Probe Set # Probe Set OUTPUT Significant differentially expressed probe sets # Probe Set Significant Analysis Microarray (SAM): a statistical method for finding significant genes in a set of microarray experiments FDR = 0.05
73. Joint expression analysis of microRNAs and of their target sequences at mRNA level“SHORT-SURVIVORS”: dead of disease within 36 months from diagnosis “LONG-SURVIVORS”: alive with an overall survival time > 36 months
78. NOW MLPA Translation of Omics to the Clinic NEXT mRNA/miRNA signature Array CGH Howwillchange the moleculardiagnosisofcancer 1990 Southern blot FISH LOH - PCR
80. DNA copy number Numerical Aberrations Segmental Aberrations RNA expression profiling Trisomies Unfavorable Signature Favorable Signature Very low Low High Intermediate Risk for death USING OMICS TO PREDICT PATIENT OUTCOME A model
81.
82. Correct Storage Of Biological SamplesClinicians SIOPEN-R-NET Central Database Reference National Lab For Biology Studies MYCN, 1p36 FISH MLPA/array CGH ... RT-qPCR
84. Laser CaptureMicrodissectionof stromal and tumorcells Stroma Tumor Tumor cells Stromal cells - Tumor cells mainly express genes associated with cell replication, DNA repair and antiapoptoticpathways; - Stromal cells express genes of cell-cell communication and apoptosis. Albino D. et al., CANCER, 2008, 113/6: 1412-22
90. THANKS TO..... Paola Scaruffi Simona Coco Sara Stigliani Francesca Valdora Carla De Vecchi Translational Paediatric Oncology IST, Genoa, Italy Stefano Bonassi Clinical and Molecular Epidemiology IRCCS San RaffaelePisana, Roma, Italy JessicaThieben Andrè Oberthuer Matthias Fischer Barbara Hero Frank Berthold Paediatric Oncology Centre, Children’s Hospital, Cologne, Germany Stefano Moretti Fabio Gallo Molecular Epidemiology IST, Genoa, Italy FINANCIAL SUPPORT Italian Neuroblastoma Foundation Associazione Italiana per la Ricerca sul Cancro Ministero dell’Università, Ricerca Scientifica e Tecnologica