Se ha denunciado esta presentación.
Utilizamos tu perfil de LinkedIn y tus datos de actividad para personalizar los anuncios y mostrarte publicidad más relevante. Puedes cambiar tus preferencias de publicidad en cualquier momento.

Introdução a genetica

6.150 visualizaciones

Publicado el

Informações sobre a história da genética, conceitos básicos de ganética clássica a moderna, avanços nos estudos e genômica.

Publicado en: Educación
  • Inicia sesión para ver los comentarios

Introdução a genetica

  1. 1. Fundamentos de Biologia MolecularFundamentos de Biologia Molecular Principais conceitos da GenéticaPrincipais conceitos da Genética Professora Dra. Adriana Dantas UERGS – Caxias do Sul , RS
  2. 2. O que é genética ? – Ramo da Biologia que estuda as leis da transmissão dos caracteres hereditários nos indivíduos, e as propriedades das partículas que asseguram essa transmissão (dicionário Aurélio).
  3. 3. – Genética Clássica – Mendel (1856-1865) – Genética Moderna – Watson e Crick (1953)
  4. 4. Species Plantarum - 1753 Origin of Species - 1859 • Classificação de organismos é um aspecto fundamental de biologia • Noção consistente de classificação deveria refletir a ‘ordem natural ' • Darwin - ordenação compartilhado com antepassados comuns Carl Linnaeus introduziu o binômio (gênero-espécies) sistema de classificação- “ad majorem Dei gloriam” (para a maior glória de Deus) Classificação de planta baseado somente em órgãos sexuais Taxonomia e evoluçãoTaxonomia e evolução
  5. 5. Hereditariedade - Genética Clássica  unidade fundamental da hereditariedade. - O processo da hereditariedade, ao mesmo tempo em que mantém semelhanças, também originam mudanças. - Indivíduos de uma espécie são “semelhantes” com “diferenças” entre si também por causas genéticas - Genética Moderna  pedaço de DNA que codifica uma proteína.
  6. 6. Textos antigos No Mishnah (200 DC) Relatada a decisão do Patriarca Rabbi- Judah que isenta o terceiro filho de uma mulher de ser circuncidado, quando os seus dois primeiros filhos morreram de hemorragia depois da circuncisão. Os rabinos constataram que tais hemorragias ocorriam unicamente em certas famílias.
  7. 7. Antes de 1860 O período que souberam que as “células vinham de células” e da descoberta do núcleo – A descoberta da célula (30 x) 1665 – Robert Hook – A descoberta do microscópio óptico (200 x) 1680 – Anton van Leeuwenhock. Analisando gotas de chuva descobriram protozoas e bactérias – A descoberta do núcleo 1833 – Robert Brown – Descrição da mitose 1835 a 1839 - Hugo von Mohl – A queda da teoria da “Geração expontânea” 1858 (término da era) Rudolf Wirchow “omnis cellula e cellula” idem Pasteur – A publicação do livro “Origem das Espécies” 1859 – Charles Darwin
  8. 8. 1860 – 1900 A publicação do trabalho de Mendel à descoberta dos cromossomos e seu comportamento – É publicado o trabalho "Experimentos em Hibridação de Plantas”. 1865 (distribuído em 1866) - Gregor Mendel – A fusão do esperma e do ovo e a formação do zigoto é descrita 1879 a 1885 - O. Hertwig – É descrito o corpúsculo cromossomo (W. Flemming) notados por C. com Nägeli em 1842 – Os corpúsculos (cromossomos) dentro do núcleo eram os portadores dos fatores hereditários 1883 - Wilhelm Roux
  9. 9. 1860 – 1900 – Haviam estruturas individuais (cromossomos) passados de uma geração para outra a despeito do seu "desaparecimento" entre a divisão celulares 1880s - Theodor Boveri, K. Rabl e E. van Breden – “A hereditariedade está baseada exclusivamente no núcleo". Em 1887 previu a ocorrência da divisão reducional, hoje chamada de "meiose“ 1885 - August Weismann – Foi usado o termo "cromossomo" 1888 - W. Waldeyer
  10. 10. O Tamanho das células
  11. 11. Formas e Funções
  12. 12. Célula vegetal Célula bacteriana Célula animal
  13. 13. 1900 – 1944 O florescimento da genética. O desenvolvimento da teoria cromossômica. Bases da teoria da evolução Avanço da genética molecular – Redescoberta dos trabalhos de Gregor Mendel 1900 – (publicado em 1866), por Hugo de Vries, Carl Corens e Erich von TschermaK – 1903 – Walter Sutton justifica as “Leis de Mendel” e daí para a descoberta de que os genes estão nos cromossomos. – Criação do primeiro “mapa gênico” 1913 – Alfred Sturtevant estudando drosófilas – Cunhada a palavra “gene” – W. L. Johansen (1857 – 1927): um elemento físico (partícula), – determinava o desenvolvimento de uma característica específica – os indivíduos possuem aos pares (um herdado do pai e outro da mãe) e os transmitem aos seus filhos.
  14. 14. 1900 – 1944 (cont.) – Mutação induzida – 1927 – L. Stadler e H.J. Müller “Os genes podem ser mutados artificialmente usando-se raios X” – Métodos quantitativos aplicados à genética – 1930 – 1932 R.A. Fisher; S. Wright e J.B.S. Haldane: desenvolveram as bases algébricas para a nossa compreensão de como ocorre o processo evolutivo – Bactérias como objetos de estudo – 1943 – S. Luria e M. Delbrück demonstraram que bactérias seguem padrões normais em termos genéticos
  15. 15. 1944 – Presente É a era da “genética molecular”. Tecnologia do DNA recombinante Terapia genética GENOMA (estrutural e funcional) PROTEÔMA METABÔLOMA, OUTRAS OMAS – O DNA como material genético 1944 – O. T. Avery, C.M. McLeod e M. McCarty. Demonstraram que o componente transformante das Bactérias Diplococcus pneumoniae era o DNA – Definição da estrutura do DNA 1953 – James Watson e Francis Crick – Descrição da endonucleases 1968 – 1973 W. Arbert, H. Smith, D. Nathans e colaboradores descreveram “as enzimas que abriram as portas para a manipulação do DNA” que levou a tecnologia do DNA recombinante. – Formação do primeiro DNA recombinante 1972 – Paul Berg
  16. 16. Conceito Gerais • Gene: fragmento de DNA que pode ser transcrito na síntese de proteínas. • Locus (Loco): local, no cromossomo, onde se encontra o gene. • Alelos: genes que ocupam o mesmo locus em cromossomos homólogos. • Homólogos: cromossomos que possuem genes para as mesmas características. • Genótipo: conjunto de genes de um indivíduo. • Fenótipo: características observáveis de uma espécie, que são determinadas por genes e que podem ser alteradas pelo
  17. 17. Fenótipo x Genótipo – Constituição gênica do indivíduo, isto é, são os genes que ele possui em suas células e que foram herdados dos seus pais. – Representado por letras. Ex.: A, z, T, b ... – Os avanços da revolução verde (produção é fenótipo) não se devem apenas à genética (genótipo), mas também à mecanização, fertilização, uso dos “cidas”, irrigação, nutrição animal, sanidade, etc.(ambiente). Fenótipo = genótipo + ambiente e o que se observa é fenótipo !
  18. 18. FENÓTIPO – São as características manifestadas por um indivíduo. – São características morfológicas, fisiológicas ou comportamentais. – É determinado pelo fenótipo, mas pode ser modificado pelo ambiente.
  19. 19. FenótipoFenótipo F = G + AF = G + A (Fenótipo é igual ao genótipo do indivíduo mais a(Fenótipo é igual ao genótipo do indivíduo mais a ação do ambiente).ação do ambiente). Ex.: cor de pele, textura do cabelo, tipoEx.: cor de pele, textura do cabelo, tipo sangüíneo, etc.sangüíneo, etc.
  20. 20. Cromossomos HomólogosCromossomos Homólogos São cromossomos que apresentam genesSão cromossomos que apresentam genes para as mesmas características para aspara as mesmas características para as mesmas posições.mesmas posições. Um homólogo veio do pai e outro da mãe.Um homólogo veio do pai e outro da mãe.
  21. 21. Óvulo  n Espermatozóide  n Zigoto  2n
  22. 22. Tamanho do Pé Cor de Cabelo Tipo Sanguíneo Temperamento Tamanho do Pé Cor de Cabelo Tipo Sanguíneo Temperamento
  23. 23. P c IA a P C IB a Genes alelos Alelos - Genes presentes nos mesmos locais nos cromossomos homólogos
  24. 24. • Os caracteres biológicos são determinados por GENES ou FATORES ( segundo Mendel ) existentes nos CROMOSSOMOS e são transmitidos de uma geração para outra por meio dos GAMETAS durante a reprodução. • Os genes que o indivíduo possui para uma determinada característica constituem o GENÓTIPO, e o referido CARÁTER em interação com o meio constitui o FENÓTIPO.
  25. 25. Homozigose – Seres diplóides apresentam duas cópias de cada gene  cada um em um cromossomo homólogo. – O indivíduo homozigoto apresenta dois alelos de um gene iguais, sejam eles genes dominantes ou recessivos. – Ex: AA, bb, ZZ, pp....
  26. 26. Heterozigose – Indivíduos que apresentam dois alelos DIFERENTES de um gene são chamados heterozigotos. – Ex.: Aa, Bb, Pp, IA IB , Zz......
  27. 27. Dominância – Alelos que se expressam da mesma forma nas condições homozigótica e heterozigótica são chamados dominantes. – Ex: Indivíduos RR e Rr para o fator Rh são Rh+.
  28. 28. Recessividade – Alelos que não se expressam na condição heterozigótica são denominados recessivos. – Ex.: o alelo r, uma vez que um indivíduo rr é Rh- .
  29. 29. Produção de GametasProdução de Gametas Que tipo de gametas um indivíduo Aa pode produzir? A a Diploide (2n) A a
  30. 30. Que tipo de gametas os indivíduos abaixoQue tipo de gametas os indivíduos abaixo podem produzir?podem produzir? AAAA BbBb BbBb AABBAABB aabbaabb AAbbAAbb AaBbAaBb
  31. 31. Qual é a probabilidade de:Qual é a probabilidade de: Um indivíduo homozigoto dominanteUm indivíduo homozigoto dominante formar um gameta A?formar um gameta A? Um indivíduo heterozigoto formar umUm indivíduo heterozigoto formar um gameta A?gameta A?
  32. 32. A partir dos cruzamentos os geneticistas podem prever a transmissão dos genes em uma família. É utilizado o “quadro de Punnett”. Gametas produzidos pelo pai Gametas produzidos pela mãe Cruzamento
  33. 33. Quadrado de Punnet A a A AA Aa a Aa aa
  34. 34. MODELO DO DNAMODELO DO DNA Watson e Crick propuseram, em 1953, um modelo de molécula de DNA, que seria em DUPLA HÉLICE e em ESPIRAL, com duas cadeias de nucleotídeos ligados por PONTES DE HIDROGÊNIO.
  35. 35. 1- a molécula de DNA era grande, longa, fina e composta de nucleotídeos: adenina; guanina; timina e citosina; 2- Os estudos de difração de raios X, realizados por Maurice King e Rosalind Franklin sugeriam a forma helicoidal; 3- Linus Pauling (1950), descreveu a estrutura helicoidal com um filamento mantida por pontes de hidrogênio em proteínas e sugeriu que o mesmo pudesse ocorrer com o DNA; 4- Erwin Chargaff havia demonstrado que a proporção entre os nucleotídeos A e T era de 1:1, o mesmo acontecendo entre G e C.
  36. 36. Difração de Raios-X 34A Estrutura Molecular
  37. 37. Modelo de molécula de DNA, que seria em DUPLA HÉLICE e em ESPIRAL, com duas cadeias de nucleotídeos ligados por PONTES DE HIDROGÊNIO.
  38. 38. DNA O Ácido Desoxirribonucléico é um polinucleotídeo formado por duas“fitas” ou hélices ligadasentre si por pontes de hidrogênio entre asbases nitrogenadas. O pareamento dasbases sempre segue a mesma ordem: Adenina com Timina e Guanina com Citosina.
  39. 39. igações entre Nucleotídeos Polímero longoPolímero longo 1. A ligação entre a base nitrogenada e a pentose é feita covalentemente através de uma ligação N-glicosídica com a hidroxila ligada ao carbono-1 da pentose. •2. Os nucleotídeos são unidos por ligações fosfodiéster covalentes que ligar o carbono 5´de um grupo desoxirribose (pentose + base) ao carbono 3´do próximo Base Pentose 1 2 4 1 2
  40. 40. Bases Nitrogenadas GuaninaAdenina Purinas Citosina Timina Uracil Pirimidinas
  41. 41. 1. Transportar muita informação, de célula para célula e de geração para geração; 2. Capacidade de produzir cópias exatas de si mesmo, pois os cromossomos são copiados em cada divisão celular; 3. Capacidade de “replicar erros” de cópia, como se fossem o gene original; 4. Apresenta mecanismo de decodificação da informação armazenada, traduzindo-as através da produção de enzimas/proteínas; A Importância do DNAA Importância do DNA
  42. 42. A molécula da vida 1. O DNA é chamado de “molécula da vida” pois contém o código pra construção das proteínas em todos os seres vivos; 2. Nos eucariontes, o DNA é encontrado no núcleo celular formando os cromossomos e também nas mitocôndrias e nos cloroplastos; 3. Nos procariontes encontra-se uma molécula de DNA circular (cromossomo bacteriano) e outras moléculas circulares chamadas plasmídeos;
  43. 43. Wilkins, Perutz, Crick, Steinbeck, Watson, Kendrew
  44. 44. aa aa aa aa aa aa aa aa Proteína CTC ATT GTG CTT GAA TTT TTG GTG DNA GAG UAA CAC GAA CUU AAA AAC CAC mRNA
  45. 45. • O que são os cromossomos? • O que eles contém? DNA constituído por nucleotídeos
  46. 46. CCTGATGGATCGCGTACGTTGTACGCACAGTGTCGAAAAAG CATACGGGGACTGCACGTACACGTAGCACGGCGTCGATTTT GACGTGCACGTGTCAGTGCGATGAGTGAGTGACACACAGTG CAGCGTGTGTACCCATGCGCGAAGTATGT C T G G A C T
  47. 47. CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTG TCGAAAAAGCATACGGGGACTGCACGTACACGTAGCAC GGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGT GAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAA GTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTG TCGAACAAGCATACGGGGACTGCACCCCGATGTAGCAC GGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCT GAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAA CACACATTGTATCGACAGTTGTACGCACAGTGTCGAGG GCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTC GCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGA AGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT GATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGA CACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  48. 48. CCTGATGGATCGCGTACGTTGTACGCACAGTGTCGAAA AAGCATACGGGGACTGCACGTACACGTAGCACGGCGTC GATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGA CACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT Homem GTGGATGGATCGCGGCAGTTGTACGCACAGTGTCGAAC AAGCATACGGGGACTGCACCCCGATGTAGCACGGCGTC GATTTTGACGTGCACGTGTCAGTGCGAAATCTGAGTGA AGGATCAGTGCAGCGTGGAGCGCGCATGAAAAATAGGA Bactéria CACACATTGTATCGACAGTTGTACGCACAGTGTCGAGG GCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTC GCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGA AGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT Vírus
  49. 49. CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTG TCGAAAAAGCATACGGGGACTGCACGTACACGTAGCAC GGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGT GAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAA GTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTG TCGAACAAGCATACGGGGACTGCACCCCGATGTAGCAC GGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCT GAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAA CACACATTGTATCGACAGTTGTACGCACAGTGTCGAGG GCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTC GCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGA AGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT GATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGA CACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  50. 50. CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTG TCGAAAAAGCATACGGGGACTGCACGTACACGTAGCAC GGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGT GAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAA GTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTG TCGAACAAGCATACGGGGACTGCACCCCGATGTAGCAC GGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCT GAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAA CACACATTGTATCGACAGTTGTACGCACAGTGTCGAGG GCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTC GCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGA AGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT GATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGA CACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  51. 51. CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTG TCGAAAAAGCATACGGGGACTGCACGTACACGTAGCAC GGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGT GAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAA GTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTG TCGAACAAGCATACGGGGACTGCACCCCGATGTAGCAC GGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCT GAGTGAAGGATCAGTGCAGCGTGGAGCGCGCATGAAAA CACACATTGTATCGACAGTTGTACGCACAGTGTCGAGG GCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTC GCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGA AGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT GATTTTGACGTGCACGTGTCAGTGCGATGAGTGAGTGA CACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  52. 52. CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTG TCGAAAAAGCATACGGGGACTGCACGTACACGTAGCAC GGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGT GAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAA GTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTG TCGAACAAGCATACGGGGACTGCACCCCGATGTAGCAC GGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCT GAGTGAAGGATCAGTAGGTCGTGGAGCGCGCATGAAAA CACACATTGTATCGACAGTTGTACGCACAGTGTCGAGG GCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTC GCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGA AGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT GATTTTGACGTGCACGTGTCAGTGCGATGAAGGAGTGA CACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  53. 53. CCTGATGGATCGCGTACGCCATATTTGTACGCACAGTG TCGAAAAAGCATACGGGGACTGCACGTACACGTAGCAC GGCGTCGATTTTATAATGCACGTGTCAGTGCGATGAGT GAGTGACACACAGTGCAGCGTGTGTACCCATGCGCGAA GTATGTGTGGATGGATCGCGGCAGTTGTACGCACAGTG TCGAACAAGCATACGGGGACTGCACCCCGATGTAGCAC GGCGTCGATTTTGACGTGCACGTGTCAGTGCGAAATCT GAGTGAAGGATCAGTAGGTCGTGGAGCGCGCATGAAAA CACACATTGTATCGACAGTTGTACGCACAGTGTCGAGG GCGACTACGGGGACTGCACCCCGAAATAGCACGGCGTC GCATGATACGTGCACGTGTCAGTGCGAAATCTGAGTGA AGGATCAGTGCAGCGGGCAGATGTAATATATATGATTT GATTTTGACGTGCACGTGTCAGTGCGATGAAGGAGTGA CACACAGTGCAGCGTGTGTACCCATGCGCGAAGTATGT
  54. 54. ORGANIZAÇÃO GENÔMICA DE EUCARIONTES
  55. 55. Formação de proteínas
  56. 56. Código genético
  57. 57. TraduçãoTradução Molécula de mRNA A U G G C A U G C G A C G A A U U C G G A C A C A U A Cys Met Ala 5’ 3’ Asp Glu Phe His Direção do avanço do ribossomo Ribossomo Proteína tRNA AA livre codon Gly Cada códon é traduzido num AA específico
  58. 58. G A C G A A U U C G G A C A C A U A A A A U U A A U G Met Met Ala Cys Asp Glu Phe Gly His Ile Lys Leu 5’ 3’ Asn
  59. 59. A U A A A A U U A A U G A A C C C A C A A U A A T A C Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met 5’ 3’ RNAm será degradado
  60. 60. Ala Cys Asp Glu Phe Met Gly His Ile Gln Lys Pro Leu Asn Met PROTEÍNA NORMALPROTEÍNA NORMAL
  61. 61. Organismos modelo usado em estudos de genética Mais usadosMais usados Arabidopsis thalianaArabidopsis thaliana Drosofila melanogasterDrosofila melanogaster Escherichia coliEscherichia coli VírusVírus RetrovírusRetrovírus MilhoMilho LevedurasLeveduras OutrosOutros Porquinhos-da-índiaPorquinhos-da-índia GatosGatos GalinhasGalinhas Guppy (Guppy (Poecilia reticulataPoecilia reticulata)) Peixes elétricosPeixes elétricos ErvilhasErvilhas
  62. 62. HomemHomem 3.200.000.000 bases3.200.000.000 bases RatoRato 3.000.000.000 bases3.000.000.000 bases DrosophilaDrosophila 160.000.000 bases160.000.000 bases ArabidopsisArabidopsis 135.000.000 bases135.000.000 bases S. cerevisaeS. cerevisae 13.000.000 bases13.000.000 bases X. fastidiosaX. fastidiosa 2.679.572 bases2.679.572 bases H. influenzaeH. influenzae 1.830.000 bases1.830.000 bases M. pneumoniaeM. pneumoniae 810.000 bases810.000 bases HTLV-IIHTLV-II 8.952 bases8.952 bases TAMANHO DO GENOMATAMANHO DO GENOMA
  63. 63. Tamanho do genoma Número de genes
  64. 64. - Os cromossomos das mitocôndrias e dos cloroplastos apresentam padrão de organização e herança bem diferente dos cromossomos nucleares; - Os genes extranucleares também chamados genes citoplasmáticos;
  65. 65. Genoma Mitocondrial - A maioria das proteínas das mitocôndrias e dos cloroplastos são codificadas pelo DNA nuclear e importados do citosol para s organelas; - O DNA das organelas celulares são circulares; - São relativamente pequenas e simples; - Não ocorre recombinação (somente mutação); - Herança não-mendedliana (citoplasmática, herança da mãe) Marcador de linhagem materna.
  66. 66. O genoma cloroplasto – Sequencia no genoma varia de 70kb - 201kb – 100-250 genes: – Gene expressos – Fotossíntese – 20 genes – Metabolismo Sequenciamento completo: Tabaco - 155,844 pb; Arroz -134,525 pb
  67. 67. GENOMA MITOCONDRIALGENOMA MITOCONDRIAL
  68. 68. • Análise maternal • Filogenia Sistemática •Genética de populações •Teste forensi (maternal ID) • Tamanho do mtDNA Humanos e outrros vertebrados ~16 kb (todos genes mtDNA codificam produtos) Leveduras ~80 kb Plantas ~100 kb to 2 Mb (muitos genes mtDNA não codificam produtos)
  69. 69. Marchantia polymorpha – 121Kb 136 genes: 4 rRNA, 29tRNA 90 genes codificadores de proteínas - destes 20 estão envolvidas no transporte de elétrons durante a fotossíntese
  70. 70. Genômica? • Genômica é estudo de todos os genes em um organismo…….. • Proteômica é estudo de todas as proteínas….. • Metabolômica sé o estudo de todas as vias metabólicas…
  71. 71. Cultivares antigas domesticadas
  72. 72. A diversidade humana
  73. 73. Drosofila melanogaster
  74. 74. Escherichia coli
  75. 75. Plantas Modelos • Arabidiopsis thaliana --modelo florescimento e dicotiledônea • Oryza sativa (rice) --modelo monocotiledônea • Medicago truncatula (barrel medic) --modelo leguminosas • Lycopersicon esculentum (tomato) --modelo de frutificação Também, milho, tabaco, trigo, etc.…
  76. 76. Arabidopsis thalianaArabidopsis thaliana Rapido crescimento Brassicaceae Genome: 125 Mb ( muito pequeno ) Cromossomos: 5 Genes: 25.498 Website: http://www.arabidopsis.org
  77. 77. Oryza sativa Genome: 430 Mb (1/8 do genoma humano) Um dos menores genomas de gramíneas Cromossomos: 12 Genes: ~ 50,000 (mais do que genoma humano) http://www.usricegenome.org Do arroz (Oryza sativa) tem se seqüenciado duas variedades e seu genoma é quase 4 vezes maior que o de A. thaliana e compreendem de 32.000 a 55.615 genes.
  78. 78. AS ÁREAS DA GENÉTICA ClássicaClássica MolecularMolecular EvolutivaEvolutiva -Os Princípios de-Os Princípios de MendelMendel -Meiose e Mitose-Meiose e Mitose -Determinação do-Determinação do SexoSexo -Herança Ligada ao-Herança Ligada ao SexoSexo -Mapeamento-Mapeamento CromossômicoCromossômico -Citogenética-Citogenética (mudanças(mudanças cromossômicas)cromossômicas) -Estrutura do DNA-Estrutura do DNA -Química do DNA-Química do DNA -Transcrição-Transcrição -Tradução-Tradução -Clonagem do DNA-Clonagem do DNA -Controle da Expressão-Controle da Expressão GênicaGênica -Mutação do DNA e-Mutação do DNA e ReparoReparo -Heranças-Heranças ExtracromossômicaExtracromossômica -Genética Quantitativa-Genética Quantitativa -O equilíbrio de Hardy-O equilíbrio de Hardy & Weinberg& Weinberg -Pressuposições para-Pressuposições para o Equilíbrio de H&Wo Equilíbrio de H&W -Evolução-Evolução -Especiação-Especiação
  79. 79. As áreas de estudo Hoje em dia, os limites entre estas 3 áreas estão sendo permeabilizados pelas técnicas de genética molecular ClássicaClássica MolecularMolecular EvolutivaEvolutiva Relativa a teoriaRelativa a teoria cromossômica dacromossômica da hereditariedade. Ohereditariedade. O conceito de queconceito de que genes estãogenes estão alocados em formaalocados em forma linear noslinear nos cromossomos ecromossomos e que a sua posiçãoque a sua posição relativa pode serrelativa pode ser avaliada em funçãoavaliada em função da sua frequênciada sua frequência nas progênies.nas progênies. É o estudo doÉ o estudo do material genético emmaterial genético em si, sua estrutura,si, sua estrutura, replicação ereplicação e expressão. Tambémexpressão. Também aborda os estudosaborda os estudos emanados daemanados da tecnologia do DNAtecnologia do DNA recombinante (eng.recombinante (eng. Genética).Genética). É o estudo dosÉ o estudo dos mecanismos demecanismos de evolução. Osevolução. Os mecanismos dasmecanismos das mudanças demudanças de freqüências nasfreqüências nas populações.populações.
  80. 80. Como (in)gerir as novas conquistas da genética ? – Bioética: bios (vida) + ethos (relativo à ética) – O progresso técnico deve ser controlado segundo a consciência da humanidade para que as novas descobertas e suas aplicações não tenham efeitos desastrosos no mundo, na sociedade ou sejam postos a serviço de interesse escusos.

×