A Presentation on Mechanics of Claim Construction and Drafting by Mrs. Vinita Radhakrishnan Contact Us for Intellectual Property Services BananaIP Counsels Regd Office No.40,3rd Main Road,JC Industrial Estate, Kanakapura Road,Bangalore – 560 062. Email: contact@bananaip.com Telephone: +91-80-26860414 /24/34

1. Vinita Radhakrishnan

2. PATENT SYSTEM
 RIGHTS v. DUTY
 DUTY
◦ SPECIFICATION
 DESCRIPTION
 SUFFICIENCY
 ENABLEMENT
 BEST MODE
 CLAIMS
 CLEAR AND UNAMBIGUOUS

3.  Claims define the metes and bounds of an
invention
 Claim Limits the extent of protection
 What is not claimed is disclaimed!
 Claims determine the value of your patent
 Each claim is a representation of your invention.
 Single sentence ending with a period.

4.  Implications of
◦ Claiming too broadly
◦ Claiming too narrow
 Claiming just right:
◦ This is an art and requires lots of imagination
◦ Claim must be adequately supported by the description
 Must avoid
◦ Not claiming what the client wants
◦ Claiming what the client does not use or need

5.  Cannot broaden the claims of a granted patent
 Cannot broaden the disclosure and the claims
beyond what has been included when drafting the
application that was filed
 You are responsible for getting the scope of
protection the inventor deserves
You do not get a second chance

6.  Three parts
◦ Introductory Phrase
 Introduces the subject matter of the invention
◦ Body
 defines a particular embodiment of the
invention
◦ Transition Phrase
 joins the introductory phrase and the body of
claim
 Open ended v. close ended claims

8. “I claim a pencil having an eraser fastened to one
end.”
 Introductory phrase - “a pencil”
 Transition phrase – “having”
 Body – “an eraser fastened to one end”

9.  Independent Claims
◦ Do not depend on any other claim
◦ Generally defines the essential novel features of the
most preferred embodiments of a product or a process.
 A pencil having an eraser fastened to one end.

10.  Dependent Claims
◦ Depend on either an independent claim or another
dependent claim
◦ Multiple-dependent claims
 The pencil as in claim 1, where said eraser is
fastened to said pencil on one end using an
adhesive.
 The pencil as claimed in claim 1 and 2 wherein
the said adhesive is glue.

11.  Process Claims
◦ A Process Claim is used for process inventions and has
to clearly define the steps involved in the process.
 Product Claims
◦ A product claim may be claimed as an apparatus, a
system, a device, an article or any other product.

12.  Markush Claims
 Product by process claims
 Fingerprint claims
 Structure Claim
 Composition Claim
 Gene Sequence claim
 Diagnostic method claim

13. To Generalize is the Key

18. “The feline mammal occupying, a wholly if not
entirely sedentary position, a horizontally-spread
woven textile floor-covering, as is sometimes but
not always the case".

20. Generalize to such an extent that your patent is
close to prior art but can be clearly differentiated
from the prior art

22.  Product claims
 Process claims

23.  New Chemical entity including a molecule or a
compound
 Combination
 Compositions

24.  A chemical molecule developed in the early
discovery stage which later translates into a
drug product is generally referred to as a new
chemical entity.
◦ Actual molecular structure of the NCE in the claim

25.  A compound having the formula
Scope of protection rendered by the claim stated in the
illustration is limited to the compound bearing the molecular
structure.

26.  Include a chemical entity along with the various
variants of the same
 Close ended claims
 Claim by grouping

27.  A compound having the formula
Wherein X is selected from a group consisting of Cl, Br, F and I.

28.  When the exact structure is not known but
the characteristics of the structure is
sufficient to distinguish the compound from
existing prior art.
e.g.:
What is claimed is
A chemical entity characterized by molecular weight
of 280, having a pH of 6.5, which has a melting point
of 123 degree Celsius and a boiling point of 180
degree Celsius.

29. When the product cannot be clearly defined and
is best defined by the process of preparing the
same

31.  Polyjuice potion:
◦ A potion that transforms one person to another person he
desires to look and sound like
What is claimed is a potion prepared by:
 Mixing 12 lacewing flies that have been stewed for 21 days;
 1 ounce of crude Antimony;
 4 leeches that have been “unsucculated”;
 1 pinch of powdered horn of a Bicorn that has been "lunar
extracted“; and
 Extract of The-Transfigured-Being-To-Be
followed by 21 days of brewing in a oak barrel.

32.  Reference is made to the specification
 Usually not allowed in most jurisdiction
 It’s a play safe claiming strategy

33.  A compound for treating Hemophilia, wherein the
compound is substantially as discussed in the
specification.

34.  Novel Combination product patents including
two or more already known chemical
compounds.
 These compounds may be available in the
public domain. But so long as the combination is
novel, they can be patented.
 A composition claim usually shall include
several components both essential and non
essential for the invention.

35. What is claimed is
A shampoo composition comprising
 a. 25 % of Alkyl ether sulphate;
 b. 10% of Dimethicone;
 c. 2% of imidazole and
 d. 63% water.

36. What is claimed is
1. A shampoo composition comprising
 20- 30% of at least one Surfactant;
 5-15% of at least one conditioning agent;
 1-3% of at least one anti fungal agent and
 water.
2. The shampoo composition as claimed in claim 1,
wherein the antifungal agent is selected from a
group consisting of pyrazole, imidazole, triazole,
tetrazole and pentazole.
3. The shampoo composition in claim 1 wherein said
anti fungal agent is imidazole.

37.  A shampoo composition comprising
 20- 30% of at least one Surfactant;
 5-15% of at least one conditioning agent;
 1-3% of at least one anti fungal agent and
 Water
wherein the antifungal agent is selected from a group consisting
of pyrazole, imidazole, triazole, tetrazole and pentazole.

38.  A process claim enumerates the step wise
process for manufacturing the compound or
formulation
 Steps to be enumerated in the logical order.

39.  A process for preparing a modified
phosphocalcic compound comprising:
a) adding a gem-biphosphonic acid or an alkali metal or
alkaline-earth metal salt thereof to a suspension of a
precursor phosphocalcic compound in ultrapure water;
b) stirring the reaction medium at room temperature and
c) recovering the formed compound there from by
centrifugation.

40.  Biphenyl Propionic acid

42. A compound wherein the compound is
What is claimed is a compound wherein
ring P is an aromatic ring optionally having substituent(s),
ring Q is an aromatic ring optionally further having substituent(s)
besides —Y—COOH,
and X and Y are each independently a spacer, or a salt thereof or a
prodrug thereof.

43.  Nothing is unfair when you define the scope of
your invention.
 Examiners are always stingy

45.  Product related claims
 Process related claims

46.  Gene sequence
 Amino Acid sequence
 Vector and host used for expression of the gene
 An antibody against the protein / sequence and a
kit made from the antibody / sequence

47.  What is claimed is
◦ An isolated nucleic acid comprising a nucleic acid
sequence
ATGGGCCTAACGTGAGGGAATTCGAAATT
Or
 What is claimed is
◦ An isolated nucleic acid molecule comprising a nucleic
acid Sequence of SEQ ID no. 1.

48.  A nucleic acid molecule comprising a nucleic acid
sequence that hybridizes to SEQ ID no.1 under
stringent conditions.

49. A nucleic acid molecule comprising
1) SEQ ID no.1
OR
2) a nucleic acid sequence that hybridizes to
SEQ ID no.1 under stringent conditions

50. What is claimed is
 An isolated nucleic acid molecule which encodes a
polypeptide comprising the amino acid sequence
Met Ala Asp Asp Cys Glu Phe Val Gly Ser Ala Val
Or
 An isolated nucleic acid molecule which encodes a
polypeptide comprising the amino acid sequence of
SEQ ID NO 2.

51.  Vector:
◦ A vector comprising a nucleic acid molecule as claimed
in Claim 1.
 Host Cell:
◦ A transgenic host cell that contains the vector
comprising a nucleic acid molecule comprising the
nucleic acid sequence of SEQ ID no.1.

52.  Isolated Antibody:
◦ An isolated antibody or fragment thereof
comprising the amino acid sequence of of
SEQ ID no. 2.
 Antibody Kit:
◦ A kit comprising the antibody or fragment
thereof of claim 1.

53.  Method of expression claims
 Biotechnological process claims

54. A method of expressing a target protein or
polypeptide comprising the steps of:
◦ A) transfecting a host cell with the expression vector of
claim 2;
◦ B) culturing the host cell transfected with the
expression vector under conditions that permit
expression of the target protein or polypeptide; and
◦ C) isolating the target protein or polypeptide.

55. A process for making an insulin precursor or an
insulin analog precursor, said method comprising
(i) culturing a host cell comprising a polynucleotide
sequence encoding an insulin precursor or an
insulin analog precursor according to claim 1 under
suitable culture conditions for expression of said
precursor; and
(ii) isolating the expressed precursor.

56.  Product
 Process

57. A diagnostic kit used for detecting malaria antibodies
in a biological sample comprising of the protein
encoded by SEQ ID NO.1 where the said protein is
brought in contact with the biological sample under
appropriate conditions which allow the formation of an
immune complex, wherein said peptide is labeled with
a detectable label.

58. A method for in vitro diagnosis of malaria antibodies in a
biological sample, comprising
(i) contacting said biological sample with a composition
comprising a protein encoded by SEQ ID no1 under
appropriate conditions which allow the formation of an
immune complex, wherein said peptide is labeled with a
detectable label, and
(ii) detecting the presence of said immune complexes
visually or mechanically.

59. An isolated nucleic acid encoding a flavonoid
methyltransferase molecule bearing the SEQ ID
no 1 and its amino acid sequence bearing SEQ
ID no 2

60. An isolated nucleic acid molecule according to any one of
claims 1 to 3 having the nucleotide sequence comprising:
(i) a nucleotide sequence set forth in SEQ ID NO:1;
(ii) a nucleotide sequence capable of hybridizing under
low stringency conditions to SEQ ID NO: 1 or its
complementary form;
(iv) a nucleotide sequence capable of encoding the amino
acid sequence set forth in SEQ ID NO:2;
wherein said nucleotide sequence encodes a FMT molecule
or a mutant, part, fragment or portion thereof or a functional
and/or structural equivalent or homolog thereof.

61.  Claim Dependency
 First Medical Use
 Second Medical Indication/Swiss Claim/New
Use claim
 Process Claims
 Product by process
 Gene Sequence: Isolated and Purified/Synthetic
 Method of treatment, Diagnosis
 Combination Claim

62. Pre drafting
 Understand the invention
 Identify the crux of the invention
 Consider all possible embodiments
 Plan the structure
 Play the role of a devils advocate

63. While Drafting
 Keep the inventor informed.
 Draft Claim outline before starting to draft the
description. Finalize the claim after specification
is drafted
 Avoid Unnecessary information
 Keep in mind the level of PHOSITA while drafting
the claim.

64.  Be frugal with words
 Clarity
 Every word Anchored
 Be greedy, But do not lose focus of what your
invention is

65. PRECISION!
CLARITY!
IMAGINATION!
FORESIGHT!

66.  Herbal formulation with melon extract:

67.  Herbal Preparation
 The medicinal preparation comprises of:
◦ 1. Melon Extract (40%)
◦ 2. Aloe Vera Extract (10%)
◦ 3. Saffron (5%)
◦ 4. Papaya extract (20%)
◦ 5. Water

68. 1. A personal care composition comprising of
a) 20-60% of melon extract;
b) 0-10% of moisturizing agent;
c) 3-7% of anti oxidative agent;
d)10-30% of cleansing agent; and
e) a suitable solvent.
1. The personal care composition claimed in claim 1
where in the said cleansing agent is selected from a
group consisting of papaya extract, cucumber extract
and strawberry extract.
2. The personal care composition claimed in claim 1 and
2 where in the cleansing agent is papaya extract.

69. 4. The personal care composition claimed in claim
1, where in the composition is administered as a
serum.
5. The personal care composition claimed in claim
1, where in the composition is used for treatment
of vitiligo.

70. For More Details Visit
Web: www.bananaip.com
Blog:www.bananaip.com/sinapse-blog