Insights about isothermal Polymerase Chain Reaction (PCR) assays and how they can be used to diagnose the presence of latent diseases in the field, including those which are especially difficult to identify. They will show how assays are developed, and how they may be used to improve disease management choices. The target audience are researchers, agri-business and forestry experts, farmers and foresters and any other interested in plant health. Do not hesitate to contact EMPHASIS project through Facebook, Twitter, email (emphasisproject@gmail.com) or through their website (http://www.emphasisproject.eu/) if you want to be updated on webinars dates and content and book a ticket. To watch on Youtube: https://youtu.be/yFEG9uTEhdc

1. This project has received funding from the European Union’s Horizon 2020
research and innovation programme under grant agreement No 634179.
EMPHASIS
Effective Management of Pests and Harmful Alien Species - Integrated Solutions
Dr. Jane Thomas
Dr.Rosa Caiazzo
NIAB
“In field molecular diagnostics as an aid to disease management”

2. EMPHASIS’ WORK PACKAGES
PLANT HEALTH CHALLENGES AND EVALUATION
PRACTICAL SOLUTIONS FOR SURVEILLANCE
AND MONITORING
PRACTICAL SOLUTIONS FOR PROTECTION,
MANAGEMENT AND ERADICATION
OPEN-ENDED MULTI-ACTOR ACTIVITIES: ON-FARM
VALIDATION AND PRODUCT DEVELOPMENT
DISSEMINATION AND TRAINING
WP1
WP2
WP3
WP4
WP5

3. Why Is Diagnosis Important?
Correct and fast diagnosis is important to prevent or
reduce the amount of damage or economic loss
Plant disease management practices rely on anticipating occurrence
of disease and a correct diagnosis of a disease is necessary to
identify the pathogen

4. Why Is Diagnosis Important?
In field diagnosis – why is it needed?
- Early infections are symptomless
- Some diseases have long latent periods
- Disease complexes are difficult to diagnose
- Improve product choice
- Select better curative products
- Change programme depending on disease identification
- Potential to switch products if resistant populations detected

5. Phoma stem canker
Leptosphaeria maculans/L. biglobosa
•Airborne ascospores released from infected stem debris
•€60 M losses in UK
•Susceptible varieties
•Warm temperatures and available moisture
• Early symptoms similar for L. biglobosa/L. maculans

6. Light leaf spot
•Favours cool, wet conditions
•€30 M losses in UK
•Loss of field resistance in North of UK
•Reduced Triazole efficacy?
Pyrenopeziza brassicae
Effective chemical control of this disease
depends on the timing of fungicide sprays

7. Forecasting airborne inoculum
•to control both diseases there is a need for effective methods of
forecasting the availability of airborne inoculum in the autumn,
when newly emerged crops are susceptible to infection
•PCR-based assays or LAMP used in conjunction with conventional
spore traps have potential as a method for detecting airborne
fungal spores
Conventional methods of monitoring airborne fungal spores
use either microscopy or cultural methods
Both pathogens can be dispersed by airborne ascospores

8. Soilborne pathogens
Some diseases caused by soilborne pathogens may be difficult to
diagnose due to the absence of characteristic symptoms.
They survive for long periods on host plant debris, soil organic
matter, or as free-living organisms.
Each vegetable crop may be susceptible to several pathogens.
Many soil factors including soil type, texture, pH, moisture,
temperature, nutrient levels, and ecology affect the activity of
soilborne pathogens

9. Diagnosis in plant pathology
Proper plant identification
Identify characteristic symptoms and signs
Understand the biology of the microorganisms
Identification of the pathogen
Disease management
Accurate diagnosis is important, but not necessarily an easy task...

10. Symptoms
wilting temporary or permanent drooping of leaves, shoots, or entire plants from lack of water
necrotic localized or general death of cells or disintegration of tissues
blast sudden blighting or death of young buds, flowers, or young fruit; failure to produce fruit
or seeds
blight sudden or total discoloration and killing of large numbers of blossoms, leaves, shoots,
or limbs or the entire plant; usually young tissues are attacked;
canker a definite, dead, often sunken or swollen and cracked area on a stem, limb, trunk,
tuber, or root surrounded by living tissues
damping-off rapid death of germinating seedlings before emergence, or emerged seedlings suddenly
wilting, toppling over, and dying from rot at or near the soil line
spot a definite, localized, round to regular lesion, often with a border of a different colour
(brown spot, black spot), characterized as to location (leaf spot, fruit spot)
stripe narrow, elongated, parallel, necrotic lesions especially in leaf diseases of cereals and
grasses
chlorosis yellowing or whitening of normal green tissue
stunting or
dwarfing
the underdevelopment of the plant or some of its organs
callus overgrowth of tissues, often at margins of a canker or wound
scab roughened to crust like, more or less circular, slightly raised or sunken lesions on the
surface of leaves, stems, fruit, or tubers

11. Signs
To properly identify a fungal or bacterial disease, one must look
for the signs of the pathogen:
• Physiological symptoms (lesions etc.)
• mycelium
• spore masses (moulds or rusts)
• Sclerotia
Verticillium stem stripingPeronospora

12. Identification of the pathogen
Direct agar plating technique
Isolation and growth of the pathogen on artificial medium
Morphological identification of the pathogen
Macroscopic observation of the mycelium
Microscopic observation of multiplicative structure
Morphological identification in the plant diagnostic laboratory is
typically only made to the genus level, due to time and difficulty in
differentiating species within a genus with very close
morphologies

13. Early Blight
Alternaria spp.
• A. solani, A. alternata (syn. A. tenuissima), other Alternaria spp.
• Global threat - Major foliar pathogen in the USA, Asia and Africa
• Favours warm, wet, humid conditions
• Affects older leaves, lesions coalesce leading to defoliation
It is not always easy to distinguish the Alternaria species visually, and even with a
microscope unless spores are present
Selection of products to control disease depends on which organism is present

14. Koch's Postulates
To identify the causative agent of a particular disease
1.the microorganism or other pathogen must be present in all cases
of the disease
2.the pathogen can be isolated from the diseased host and grown in
pure culture
3.the pathogen from the pure culture must cause the disease when
inoculated into a healthy, susceptible plant
4.the pathogen must be re-isolated from the new host and shown to
be the same as the originally inoculated pathogen

15. Molecular Technologies for diagnosis
Technological advances in the identification of pathogenic
agents can allow
the identification of morphologically similar species or strains
the detection of infection prior to symptom formation
to detect an organism without prior culturing
increasing the efficacy, accuracy and speed of diagnosis

16. Molecular Technologies for diagnosis
Serology or immunoassay based techniques such as enzyme linked
immunosorbent assay (ELISA) particularly used for the identification
of plant viruses.
Nucleic acid based techniques such as conventional PCR, nucleic
acid hybridization, quantitative real-time PCR (qPCR) and
isothermal loop mediated amplification (LAMP)

17. Ribosomal RNA (rRNA/rDNA)
26S28S
FungiETS = External Transcribed Spacer
ITS = Internal Transcribed Spacer
IGS = InterGenic Spacer
PLANTS
ITS1 ITS2 IGS
ETS 18S 5.8S 25S ETS
• is an essential gene that
is present in all organisms
• is a common target for
sequencing studies; large
database for comparisons
• contains sites that are
relatively conserved
(stems) and sites that are
more free to vary (loops)
•ITS more variable than
ribosomal sub-units

18. DNA extraction
PCR
Gel electrophoresis
Pathogen
identification
ACAGATGTCTTGTAATCCGGC
CGTTGGTGGCATAGGGAAAG
GACATTTAGTGAAAGAAATTG
ATGCGATGGGTGGATCGATG
GCTTATGCTATCGATCAATCA
GGAATTCAATTTAGAGTACTT
AATAGTAGCAAAGGAGCTGC
TGTTAGAGCAACACGTGCTCA
GGCAGATAAAATATTATATCG
TCAAGCAATACGTAGTATTCT
TGAATATCAAAAATTTTTGTTG
GTTATTCA
DNA sequencing
Bioinformatics
?

19. Target genes
Internal transcribe spacer
Cytochrome b
Beta tubulin
Elongation factor
Glyceraldehyde-3-phosphate dehydrogenase
Nitrate reductase
ATPase

20. Primers Enzyme Sensitivity Equipment Detection Time
PCR 2 Taq 10-100ng thermal cycler Agarose gel 2-3 hrs
qPCR 2 Taq 10-100pg thermal cycler fluorescence 2 hrs
LAMP 4-6 Bst <10pg Heat block/bath visible or UV
light
30-60 min
Loop-mediated isothermal Amplification
•High specificity and sensitivity
•No high-tech equipment required ( it can be used in the field)
•Faster
•Cheaper
Molecular diagnostics

21. LAMP detection
Identification of a specific gene and primers design
Optimization of LAMP reaction conditions
Validation of the specificity and sensitivity of the assay
Design of an internal control assay (i.e. COX )
Test on field samples

22. Primers design
(www.premierbiosoft.com/isot
hermal/lamp.html)
(http://loopamp.eiken.co.jp/e/lamp/primer.html)

23. 5
M
F3 F2 F1 B1C B2C B3C
5’ LF LB 3’
3’ F3C F2C F1C B1 B2 B3 5’
Reaction primers
Forward Inner Primer FIP
Backward Inner Primer BIP
Forward outer primer F3
Backward outer primer B3
Loop Backward LB
Loop Forward LF
LAMP Primers

24. Detection of Alternaria alternata
Time of reaction
Specificity of the product

25. Important UK Crop diseases
oilseed rape
Disease pathogen
Phoma leafspot/stemcanker L. maculans and L.biglobosa
Light leaf spot Pyrenopeziza brassicae
Sclerotinia stem rot Sclerotinia sclerotiorum
Clubroot Plasmodiophora brassicae
Verticillium wilt Verticillium longisporum
Alternaria pod spot Alternaria sp.
potato
Disease pathogen
Late blight Phythopthora infestans
Black scurf/stem canker Rhizoctonia solani
PCN Globodera spp.
Early blight Alternaria solani mainly
wheat/barley
Disease pathogen
Tan spot Pyrenophora tritici-repentis
Septoria leaf blotch Zymoseptoria tritici
Black point Alternaria spp
Brown (leaf) rust Puccinia triticina
Yellow (stripe) rust P. striiformis f.sp.tritici
Ear blights (fusarium) F. culmorum and F. graminearum
Potato (Solanum tuberosum)
Oilseed Rape (Brassica napus)

26. In-field testing
Asymptomatic detection in LLS
Discerning between pathotypes for determining fungicide insensitivity
Optimise chemical controls through improving spray timings and monitoring for resistance

27. In-field testing
alkaline lysis
(5-10 minRT)

28. Verticillium stem striping
• An emerging soil-borne problem
•Asexual pathogen, persists in soil as microsclerotia
• 10-50% yield loss (Dunker et al., 2008)
•Brassica hosts, also affects aubergine, lettuce, tomato and
watermelon (Novakazi et al., 2015)
Verticillium longisporum
sample qPCR LAMP
ct
20.1 + 27 +
20.2 - - -
20.3 + 27 +
5.1 + 27 +
5.2 + 28 +
5.3 + 29.5 +
17.1 + 29.5 +
17.2 + 27 +
17.3 + 26 +
10.1 - 31* +
10.2 - 31.5* -
10.3 - 31* +
19.1 + 29 +
19.2 + 30 -
19.3 + 28 +
16.1 + 31 -
16.2 + 29 +
16.3 + 27 +
11.1 + 27 +
11.2 - - +
11.3 + 27 +
13.1 + 27 +
13.2 + 28 -
13.3 + 27 +
9.1 + 28 +
9.2 + 28 +
9.3 + 28 -
Positive + 26 +
Negative - - -
* ct higher than the threshold set

29. Sensitivity of LAMP
Sensitivity of the LAMP using 10 fold serial dilution of purified target DNA from Verticillium longisporum: A)
electrophoresis of the products which were run on 1.5% agarose gel lane 1-5ng, lane 2-0.5ng, lane 3-0.05ng, lane
4-0.005ng , lane 5-0.5pg,lane 6 negative control, lane L-ladder 100bp. B) Amplification plot and melting curve of
the specific target .
1 2 3 4 5 6 L
A B
5pg

30. Pathogen Target Assay
designed
Tested on
DNA
Tested on
infected sample
Assay validated
A. alternata Alt a 1 allergene P P P P
L. biglobosa beta-tubulin P P
L. maculans nitrate reductase P P P P
Pyrenophora tritici
repensis GPDH P P P
V. longisporum elongation factor P P P P
Pyrenopeziza
brassicacea beta-tubulin P P P
A. solani cytb P P P P
Peronspora belbahrii ITS P P P
Peronospora vicae
f.sp. Pisi ATPase P
Pathogens targeted

31. Conclusion
Molecular technology increases understanding of the
biology and population structure of plant pathogens,
provides quick and accurate answers to epidemiological
questions about plant diseases
support disease-management decisions
that rely on anticipating occurrence of disease

32. Plant Disease Control
Avoidance—prevent disease by selecting a time of the year or a site
where there is no inoculum or where the environment is not favourable
for infection.
Exclusion—prevent the introduction of inoculum.
Eradication—eliminate, destroy, or inactivate the inoculum.
Protection—prevent infection by means of a toxicant or some other
barrier to infection.
Resistance—utilize cultivars that are resistant to or tolerant of infection.
Therapy—cure plants that are already infected.

33. Integrated pest management
uses all suitable techniques that complement each other in order to:
 keep pest populations below the threshold at which economic
damage occurs
avoid the problem of pests developing resistance to widely used
insecticides
Using resistant crop varieties in conjunction with chemical treatment,
crop rotation and manipulation of the environment

34. Acknowledgments
Pathology Group
Jane Thomas
Tom Wood
http://www.emphasisproject.eu/partners.php