SlideShare una empresa de Scribd logo
1 de 34
Evolving Prolog
gene expression programming
InfoQ.com: News & Community Site
• 750,000 unique visitors/month
• Published in 4 languages (English, Chinese, Japanese and Brazilian
Portuguese)
• Post content from our QCon conferences
• News 15-20 / week
• Articles 3-4 / week
• Presentations (videos) 12-15 / week
• Interviews 2-3 / week
• Books 1 / month
Watch the video with slide
synchronization on InfoQ.com!
http://www.infoq.com/presentations
/prolog
Presented at QCon New York
www.qconnewyork.com
Purpose of QCon
- to empower software development by facilitating the spread of
knowledge and innovation
Strategy
- practitioner-driven conference designed for YOU: influencers of
change and innovation in your teams
- speakers and topics driving the evolution and innovation
- connecting and catalyzing the influencers and innovators
Highlights
- attended by more than 12,000 delegates since 2007
- held in 9 cities worldwide
mndrix
The Problem
Lending Club
peer to peer loans
which ones are good?
data!
The Result
98% success
p2pquant.com
note selection
Genetic Algorithms
because giraffes
Candida Ferreira FTW!
Genotype
ATGCTTCGGCAAGACTCAAAAAATA
Phenotype
Ophrys apifera
xkcd 1259
Genotype : Phenotype
Source : AST
*b+a-aQab+//+b+babbabbbababbaaa
Investment strategy
and
FICO >
credit
inquiries <
700 2
Prolog
Why Prolog?
homoiconic
?- writeln(hi).
hi
?- X=writeln(hi).
X = writeln(hi).
?- call($X).
hi
logic variables
?- X=writeln(Message).
X = writeln(Message).
?- X=writeln(Message), Message=hi.
Message = hi,
X = writeln(hi).
?- call($X).
hi
*b+a-aQab+//+b+babbabbbababbaaa
declarative
Fitness Function
internal rate of return
Generations
you kids get off my lawn
98% satisfied
p2pquant.com
thanks
Watch the video with slide synchronization on
InfoQ.com!
http://www.infoq.com/presentations/prolog

Más contenido relacionado

Más de C4Media

Shifting Left with Cloud Native CI/CD
Shifting Left with Cloud Native CI/CDShifting Left with Cloud Native CI/CD
Shifting Left with Cloud Native CI/CDC4Media
 
CI/CD for Machine Learning
CI/CD for Machine LearningCI/CD for Machine Learning
CI/CD for Machine LearningC4Media
 
Fault Tolerance at Speed
Fault Tolerance at SpeedFault Tolerance at Speed
Fault Tolerance at SpeedC4Media
 
Architectures That Scale Deep - Regaining Control in Deep Systems
Architectures That Scale Deep - Regaining Control in Deep SystemsArchitectures That Scale Deep - Regaining Control in Deep Systems
Architectures That Scale Deep - Regaining Control in Deep SystemsC4Media
 
ML in the Browser: Interactive Experiences with Tensorflow.js
ML in the Browser: Interactive Experiences with Tensorflow.jsML in the Browser: Interactive Experiences with Tensorflow.js
ML in the Browser: Interactive Experiences with Tensorflow.jsC4Media
 
Build Your Own WebAssembly Compiler
Build Your Own WebAssembly CompilerBuild Your Own WebAssembly Compiler
Build Your Own WebAssembly CompilerC4Media
 
User & Device Identity for Microservices @ Netflix Scale
User & Device Identity for Microservices @ Netflix ScaleUser & Device Identity for Microservices @ Netflix Scale
User & Device Identity for Microservices @ Netflix ScaleC4Media
 
Scaling Patterns for Netflix's Edge
Scaling Patterns for Netflix's EdgeScaling Patterns for Netflix's Edge
Scaling Patterns for Netflix's EdgeC4Media
 
Make Your Electron App Feel at Home Everywhere
Make Your Electron App Feel at Home EverywhereMake Your Electron App Feel at Home Everywhere
Make Your Electron App Feel at Home EverywhereC4Media
 
The Talk You've Been Await-ing For
The Talk You've Been Await-ing ForThe Talk You've Been Await-ing For
The Talk You've Been Await-ing ForC4Media
 
Future of Data Engineering
Future of Data EngineeringFuture of Data Engineering
Future of Data EngineeringC4Media
 
Automated Testing for Terraform, Docker, Packer, Kubernetes, and More
Automated Testing for Terraform, Docker, Packer, Kubernetes, and MoreAutomated Testing for Terraform, Docker, Packer, Kubernetes, and More
Automated Testing for Terraform, Docker, Packer, Kubernetes, and MoreC4Media
 
Navigating Complexity: High-performance Delivery and Discovery Teams
Navigating Complexity: High-performance Delivery and Discovery TeamsNavigating Complexity: High-performance Delivery and Discovery Teams
Navigating Complexity: High-performance Delivery and Discovery TeamsC4Media
 
High Performance Cooperative Distributed Systems in Adtech
High Performance Cooperative Distributed Systems in AdtechHigh Performance Cooperative Distributed Systems in Adtech
High Performance Cooperative Distributed Systems in AdtechC4Media
 
Rust's Journey to Async/await
Rust's Journey to Async/awaitRust's Journey to Async/await
Rust's Journey to Async/awaitC4Media
 
Opportunities and Pitfalls of Event-Driven Utopia
Opportunities and Pitfalls of Event-Driven UtopiaOpportunities and Pitfalls of Event-Driven Utopia
Opportunities and Pitfalls of Event-Driven UtopiaC4Media
 
Datadog: a Real-Time Metrics Database for One Quadrillion Points/Day
Datadog: a Real-Time Metrics Database for One Quadrillion Points/DayDatadog: a Real-Time Metrics Database for One Quadrillion Points/Day
Datadog: a Real-Time Metrics Database for One Quadrillion Points/DayC4Media
 
Are We Really Cloud-Native?
Are We Really Cloud-Native?Are We Really Cloud-Native?
Are We Really Cloud-Native?C4Media
 
CockroachDB: Architecture of a Geo-Distributed SQL Database
CockroachDB: Architecture of a Geo-Distributed SQL DatabaseCockroachDB: Architecture of a Geo-Distributed SQL Database
CockroachDB: Architecture of a Geo-Distributed SQL DatabaseC4Media
 
A Dive into Streams @LinkedIn with Brooklin
A Dive into Streams @LinkedIn with BrooklinA Dive into Streams @LinkedIn with Brooklin
A Dive into Streams @LinkedIn with BrooklinC4Media
 

Más de C4Media (20)

Shifting Left with Cloud Native CI/CD
Shifting Left with Cloud Native CI/CDShifting Left with Cloud Native CI/CD
Shifting Left with Cloud Native CI/CD
 
CI/CD for Machine Learning
CI/CD for Machine LearningCI/CD for Machine Learning
CI/CD for Machine Learning
 
Fault Tolerance at Speed
Fault Tolerance at SpeedFault Tolerance at Speed
Fault Tolerance at Speed
 
Architectures That Scale Deep - Regaining Control in Deep Systems
Architectures That Scale Deep - Regaining Control in Deep SystemsArchitectures That Scale Deep - Regaining Control in Deep Systems
Architectures That Scale Deep - Regaining Control in Deep Systems
 
ML in the Browser: Interactive Experiences with Tensorflow.js
ML in the Browser: Interactive Experiences with Tensorflow.jsML in the Browser: Interactive Experiences with Tensorflow.js
ML in the Browser: Interactive Experiences with Tensorflow.js
 
Build Your Own WebAssembly Compiler
Build Your Own WebAssembly CompilerBuild Your Own WebAssembly Compiler
Build Your Own WebAssembly Compiler
 
User & Device Identity for Microservices @ Netflix Scale
User & Device Identity for Microservices @ Netflix ScaleUser & Device Identity for Microservices @ Netflix Scale
User & Device Identity for Microservices @ Netflix Scale
 
Scaling Patterns for Netflix's Edge
Scaling Patterns for Netflix's EdgeScaling Patterns for Netflix's Edge
Scaling Patterns for Netflix's Edge
 
Make Your Electron App Feel at Home Everywhere
Make Your Electron App Feel at Home EverywhereMake Your Electron App Feel at Home Everywhere
Make Your Electron App Feel at Home Everywhere
 
The Talk You've Been Await-ing For
The Talk You've Been Await-ing ForThe Talk You've Been Await-ing For
The Talk You've Been Await-ing For
 
Future of Data Engineering
Future of Data EngineeringFuture of Data Engineering
Future of Data Engineering
 
Automated Testing for Terraform, Docker, Packer, Kubernetes, and More
Automated Testing for Terraform, Docker, Packer, Kubernetes, and MoreAutomated Testing for Terraform, Docker, Packer, Kubernetes, and More
Automated Testing for Terraform, Docker, Packer, Kubernetes, and More
 
Navigating Complexity: High-performance Delivery and Discovery Teams
Navigating Complexity: High-performance Delivery and Discovery TeamsNavigating Complexity: High-performance Delivery and Discovery Teams
Navigating Complexity: High-performance Delivery and Discovery Teams
 
High Performance Cooperative Distributed Systems in Adtech
High Performance Cooperative Distributed Systems in AdtechHigh Performance Cooperative Distributed Systems in Adtech
High Performance Cooperative Distributed Systems in Adtech
 
Rust's Journey to Async/await
Rust's Journey to Async/awaitRust's Journey to Async/await
Rust's Journey to Async/await
 
Opportunities and Pitfalls of Event-Driven Utopia
Opportunities and Pitfalls of Event-Driven UtopiaOpportunities and Pitfalls of Event-Driven Utopia
Opportunities and Pitfalls of Event-Driven Utopia
 
Datadog: a Real-Time Metrics Database for One Quadrillion Points/Day
Datadog: a Real-Time Metrics Database for One Quadrillion Points/DayDatadog: a Real-Time Metrics Database for One Quadrillion Points/Day
Datadog: a Real-Time Metrics Database for One Quadrillion Points/Day
 
Are We Really Cloud-Native?
Are We Really Cloud-Native?Are We Really Cloud-Native?
Are We Really Cloud-Native?
 
CockroachDB: Architecture of a Geo-Distributed SQL Database
CockroachDB: Architecture of a Geo-Distributed SQL DatabaseCockroachDB: Architecture of a Geo-Distributed SQL Database
CockroachDB: Architecture of a Geo-Distributed SQL Database
 
A Dive into Streams @LinkedIn with Brooklin
A Dive into Streams @LinkedIn with BrooklinA Dive into Streams @LinkedIn with Brooklin
A Dive into Streams @LinkedIn with Brooklin
 

Último

Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUK Journal
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfsudhanshuwaghmare1
 
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...apidays
 
Top 10 Most Downloaded Games on Play Store in 2024
Top 10 Most Downloaded Games on Play Store in 2024Top 10 Most Downloaded Games on Play Store in 2024
Top 10 Most Downloaded Games on Play Store in 2024SynarionITSolutions
 
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers:  A Deep Dive into Serverless Spatial Data and FMECloud Frontiers:  A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FMESafe Software
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationSafe Software
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonAnna Loughnan Colquhoun
 
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingRepurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingEdi Saputra
 
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processorsdebabhi2
 
🐬 The future of MySQL is Postgres 🐘
🐬  The future of MySQL is Postgres   🐘🐬  The future of MySQL is Postgres   🐘
🐬 The future of MySQL is Postgres 🐘RTylerCroy
 
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live StreamsTop 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live StreamsRoshan Dwivedi
 
Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024The Digital Insurer
 
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...Principled Technologies
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Scriptwesley chun
 
MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024MIND CTI
 
presentation ICT roal in 21st century education
presentation ICT roal in 21st century educationpresentation ICT roal in 21st century education
presentation ICT roal in 21st century educationjfdjdjcjdnsjd
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc
 
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024The Digital Insurer
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerThousandEyes
 

Último (20)

Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdfUnderstanding Discord NSFW Servers A Guide for Responsible Users.pdf
Understanding Discord NSFW Servers A Guide for Responsible Users.pdf
 
Boost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdfBoost Fertility New Invention Ups Success Rates.pdf
Boost Fertility New Invention Ups Success Rates.pdf
 
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
Apidays New York 2024 - The Good, the Bad and the Governed by David O'Neill, ...
 
Top 10 Most Downloaded Games on Play Store in 2024
Top 10 Most Downloaded Games on Play Store in 2024Top 10 Most Downloaded Games on Play Store in 2024
Top 10 Most Downloaded Games on Play Store in 2024
 
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers:  A Deep Dive into Serverless Spatial Data and FMECloud Frontiers:  A Deep Dive into Serverless Spatial Data and FME
Cloud Frontiers: A Deep Dive into Serverless Spatial Data and FME
 
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time AutomationFrom Event to Action: Accelerate Your Decision Making with Real-Time Automation
From Event to Action: Accelerate Your Decision Making with Real-Time Automation
 
Data Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt RobisonData Cloud, More than a CDP by Matt Robison
Data Cloud, More than a CDP by Matt Robison
 
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost SavingRepurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
Repurposing LNG terminals for Hydrogen Ammonia: Feasibility and Cost Saving
 
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
+971581248768>> SAFE AND ORIGINAL ABORTION PILLS FOR SALE IN DUBAI AND ABUDHA...
 
Exploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone ProcessorsExploring the Future Potential of AI-Enabled Smartphone Processors
Exploring the Future Potential of AI-Enabled Smartphone Processors
 
🐬 The future of MySQL is Postgres 🐘
🐬  The future of MySQL is Postgres   🐘🐬  The future of MySQL is Postgres   🐘
🐬 The future of MySQL is Postgres 🐘
 
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live StreamsTop 5 Benefits OF Using Muvi Live Paywall For Live Streams
Top 5 Benefits OF Using Muvi Live Paywall For Live Streams
 
Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024Tata AIG General Insurance Company - Insurer Innovation Award 2024
Tata AIG General Insurance Company - Insurer Innovation Award 2024
 
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
Deploy with confidence: VMware Cloud Foundation 5.1 on next gen Dell PowerEdg...
 
Automating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps ScriptAutomating Google Workspace (GWS) & more with Apps Script
Automating Google Workspace (GWS) & more with Apps Script
 
MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024MINDCTI Revenue Release Quarter One 2024
MINDCTI Revenue Release Quarter One 2024
 
presentation ICT roal in 21st century education
presentation ICT roal in 21st century educationpresentation ICT roal in 21st century education
presentation ICT roal in 21st century education
 
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law DevelopmentsTrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
TrustArc Webinar - Stay Ahead of US State Data Privacy Law Developments
 
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
Bajaj Allianz Life Insurance Company - Insurer Innovation Award 2024
 
How to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected WorkerHow to Troubleshoot Apps for the Modern Connected Worker
How to Troubleshoot Apps for the Modern Connected Worker
 

Evolving Prolog